Composition for real-time fluorescent quantitative PCR (Polymerase Chain Reaction) and application thereof

Abstract

The invention provides a composition for real-time fluorescent quantitative PCR (Polymerase Chain Reaction) and application thereof, and belongs to the field of determination or inspection of nucleic acid or microorganisms. The composition for real-time fluorescent quantitative PCR comprises a specific forward primer, a specific reverse primer and a specific probe, the specific forward primer and the specific reverse primer are used for amplifying target DNA, a blocking group is added between the ith nucleotide and the (i + 1) th nucleotide from the 3'end of the specific reverse primer, and i is larger than or equal to 4 and smaller than or equal to 8; two ends of the specific probe are respectively marked with a fluorophore and a second quenching group, the middle of the specific probe is marked with a first quenching group, and a part of sequence of the specific probe is the same as a part of sequence of the reverse primer. Real-time fluorescent quantitative PCR is carried out based on the composition, and multi-target detection is realized by combining the types of fluorophores carried by the specific probes and different melting temperatures of each target PCR product.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid or microorganism determination or testing, and in particular to a composition for real-time fluorescence quantitative PCR and application thereof. Background Art

[0002] In the field of modern biological research and clinical diagnosis, nucleic acid detection technology has always occupied a pivotal position. Traditional PCR technology can quickly amplify specific DNA fragments in vitro. However, it can only perform qualitative analysis on the amplified products after the reaction is completed, and cannot accurately determine the copy number of the starting template. In addition, it is very easy to cause cross-contamination during the process of opening the cover for detection after amplification, which seriously affects the accuracy and reliability of the experimental results. With the continuous advancement of science and technology, in order to make up for the shortcomings of traditional PCR, real-time fluorescence quantitative PCR technology came into being. It cleverly combines fluorescent signals with PCR amplification, and monitors fluorescent signals in real time while the PCR reaction is in progress. By analyzing the dynamic changes of fluorescent signals, it can not only accurately quantify the starting template, but also effectively avoid the contamination problem caused by opening the cover for detection after amplification, significantly improving the sensitivity, accuracy and repeatability of the detection.

[0003] As one of the real-time fluorescence quantitative PCR methods, the TaqMan probe method is to add a specific fluorescent probe while adding a pair of primers for PCR amplification. The two ends of the probe are labeled with a fluorescent group and a quenching group respectively. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quenching group; during PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme will enzymatically degrade the probe, separating the fluorescent group and the quenching group. The fluorescence monitoring system can receive the fluorescent signal, and the accumulation of the fluorescent signal is completely synchronized with the formation of the PCR product. According to the relationship between the fluorescent signal and the number of amplification cycles, the real-time amplification curve can be obtained to achieve quantitative detection of the template copy number.

[0004] The biggest advantage of the TaqMan probe method is its high throughput and high sensitivity, and it does not require electrophoresis, hybridization and other operations after PCR, which reduces contamination and operational errors. However, the design of the TaqMan probe has high requirements for the sequence. If the probe is too short, the probe Tm will be too low and it will not be able to hybridize to the target sequence. If the probe is too long, the probe specificity will be reduced. Especially for the simultaneous detection of multiple pathogens, the interference between primers will lead to reduced detection specificity, and it will not be possible to detect or distinguish multiple types at the same time. When using the TaqMan method to construct a multiplex PCR system, it is usually limited by the number of instrument fluorescence channels. If the construction is carried out separately, the reagent cost will also increase, and the operation will be more troublesome. Summary of the invention

[0005] The invention provides a composition for real-time fluorescence quantitative PCR, which can realize multiple target detection.

[0006] In a first aspect, the present invention provides a composition for real-time fluorescent quantitative PCR, comprising a specific forward primer, a specific reverse primer and a specific probe, wherein: The specific forward primer and the specific reverse primer are used to amplify the target DNA; A blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide at the 3' end of the specific reverse primer, where 4≤i≤8, and i is a positive integer; The specific probe meets the following conditions: 1) The specific probe is a single-stranded nucleic acid molecule; 2) the first nucleotide at the first end of the specific probe is labeled with a fluorescent group, the nth nucleotide from the first end of the specific probe is labeled with a first quenching group, and the first nucleotide at the second end of the specific probe is labeled with a second quenching group, 9≤n≤30, n is a positive integer, and n is less than the total number of nucleotides of the specific probe; 3) the partial nucleotide sequence of the specific probe is identical to the nucleotide sequence from the first nucleotide to the i-th nucleotide from the 3' end of the specific reverse primer; 4) the specific probe does not bind to the specific forward primer; 5) The specific probe does not bind to the specific reverse primer.

[0007] In the present invention, the target DNA refers to a DNA fragment corresponding to the target nucleic acid fragment, which can be DNA or RNA. The target nucleic acid fragment refers to a nucleic acid fragment with certain specificity that can be used as a detection target and exists in a specific region of the gene of the pathogen to be detected. The nucleic acid fragment can be clearly distinguished from other pathogens or the gene sequence of the sample to be detected. For pathogens whose genetic material is DNA, the target nucleic acid fragment is the target DNA; for pathogens whose genetic material is RNA, the target nucleic acid fragment is reverse transcribed to obtain the target DNA.

[0008] In the present invention, the pathogen refers to an organism or substance that can cause a disease in a host (such as humans, animals, plants, etc.), such as viruses, chlamydia, rickettsia, mycoplasma, bacteria, spirochetes, fungi, and other microorganisms and parasites. In a specific embodiment, the pathogen is a virus. Furthermore, the genetic material of the virus can be DNA.

[0009] In the present invention, the target DNA is double-stranded DNA, the specific forward primer can specifically bind to one strand of the target DNA, and the specific reverse primer can specifically bind to the other strand of the target DNA, and an extension reaction is performed with the double-stranded DNA as a template under the action of DNA polymerase. The specific forward primer and the specific reverse primer are both single-stranded DNA.

[0010] In the present invention, the design principles of the specific forward primer and the specific reverse primer are the same or similar to the design principles of conventional forward primers and reverse primers in the art, with the difference that, in the present invention, a blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide from the 3' end of the specific reverse primer, 4≤i≤8, and i is a positive integer (i is one of 4, 5, 6, 7, 8), and i is less than the total number of nucleotides of the specific reverse primer; when the above-mentioned specific forward primer and the specific reverse primer are used to perform PCR amplification on the target DNA, the specific forward primer binds to the template chain of the target DNA and extends, and the extension stops after encountering the blocking group, thereby obtaining a double-stranded amplification product in which the length of one chain is smaller than the other chain.

[0011] Furthermore, the total number of nucleotides of the specific reverse primer may be 18-35 nucleotides.

[0012] In the present invention, the specific probe may be a single-stranded DNA molecule.

[0013] In the present invention, the first end may be the 5' end of the specific probe, and correspondingly, the second end is the 3' end of the specific probe; the first end may also be the 3' end of the specific probe, and correspondingly, the second end is the 5' end of the specific probe.

[0014] In the present invention, n may be any one of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30.

[0015] In the present invention, the partial nucleotide sequence of the specific probe is identical to the nucleotide sequence between the first nucleotide and the i-th nucleotide from the 3' end of the specific reverse primer. Further, the nucleotide sequence identical to the specific reverse primer in the specific probe should be close to both ends of the specific probe, so as to facilitate binding with the shorter DNA chain in the double-stranded amplification product and improve the binding rate. Furthermore, the nucleotide sequence identical to the specific reverse primer in the specific probe is close to the 3' end of the specific probe, that is, located between the nucleotides modified by the first quenching group and the second quenching group in the specific probe.

[0016] In the present invention, the above-mentioned binding means that the specific probe will not be used as a template for PCR amplification with the specific forward primer or the specific reverse primer, that is, when the target DNA is not added or the sample to be detected does not contain the corresponding pathogen, the specific probe remains in a curled state, and the fluorescent signal emitted by the fluorescent group marked at the first end of the specific probe will be absorbed by the first quenching group and / or the second quenching group, and then the corresponding fluorescent signal cannot be detected. When there are at least two specific forward primers and specific reverse primers in the PCR system, the specific probe does not bind to the specific primer pair targeting other target DNA.

[0017] The principles involved in the present invention are as follows Figure 1 As shown, specifically: when the target double-stranded DNA exists, the specific forward primer and the specific reverse primer provided by the present invention specifically bind to the target DNA and extend to produce a pre-amplification product, and the pre-amplification product includes a shorter DNA chain and a longer DNA chain; at the same time, the specific probe can bind to the shorter DNA chain in the pre-amplification product through base complementary pairing, and continue to perform PCR amplification along the 5' to 3' direction of the DNA chain. As the PCR amplification proceeds, the structure of the specific probe changes (mainly the change in the distance between the fluorescent group and the quenching group), so that the fluorescent signal emitted by the fluorescent group cannot be absorbed by the first quenching group and the second quenching group, and the fluorescent signal can be detected by the instrument. When the target double-stranded DNA does not exist, the specific forward primer and the specific reverse primer do not bind to and extend the template chain of the specific probe, the specific probe remains in a curled state, and the fluorescent signal emitted by the fluorescent group is absorbed by the first quenching group or the second quenching group (mainly the first quenching group), and the fluorescent signal cannot be detected. By observing whether there is a fluorescent signal, it can be determined whether the target double-stranded DNA exists, whether the sample to be detected contains the pathogen to be detected, and the qualitative detection of the pathogen is achieved.

[0018] When it is necessary to perform multiplex PCR tests to determine whether the sample to be tested contains multiple pathogens, different targets can be distinguished by changing the fluorescent group labeled with the specific probes. When the number of fluorescent channels is limited, that is, when the specific probes are labeled with the same fluorescent group, the melting temperature (Tm value) of each target PCR product can be changed. After the PCR amplification is completed, a melting curve analysis can be performed. Multiple target detection can also be achieved by combining the type of fluorescent group carried by the specific probe with the different Tm values ​​of each target PCR product.

[0019] The above detection process is explained by taking HPV 18 as an example: the nucleotide sequence of the target DNA for detecting HPV 18 provided by the present invention is shown in SEQ ID NO: 35; for the above target DNA, the nucleotide sequence of the specific forward primer provided by the present invention is 5'-GGTGACACTGTGCCTCAATCCT-3' (SEQ ID NO: 21), the nucleotide sequence of the specific reverse primer is 5'- ACACACAGCTGCCAGGTGAAG-3' (the first 16 nucleotide sequences are SEQ ID NO: 22), and a blocking group is connected between the 16th nucleotide (G) and the 17th nucleotide (T) from the 5' end, and the nucleotide sequence of the specific probe is 5'-ACTGCCAGTCCATCAACCTATCTGTGCAATGGCTGACATCCCCTAATGC TGAAG CAGGC -3' (SEQ ID NO: 34), and the first nucleotide (A) from the 5' end is labeled with a fluorescent group, the 13th nucleotide (T) is labeled with a first quenching group, and the 59th nucleotide (C) is labeled with a second quenching group. When the target DNA is PCR amplified using the above-mentioned specific forward primer and specific reverse primer, the obtained pre-amplification product includes a nucleotide sequence of 5'-GGTGACACTGTGCCTCAATCCTTATATATTAAAGGCACAGGTATGCCTG CTTCA -3' (SEQ ID NO:49), the 1st to the 5th nucleotides from the 3' end of the DNA chain (as underlined in the above sequence) and the 50th to the 54th nucleotides from the 5' end of the specific probe (as underlined in the above sequence) are bound by complementary pairing, and since the 3' end of the specific probe is labeled with a second quenching group, it cannot trigger the extension reaction of the DNA polymerase. Therefore, the DNA chain acts as a primer, and the specific probe is used as a template for extension to cause secondary PCR amplification. The second amplification product forms a double-stranded structure with the specific probe, and the fluorescent signal emitted by the fluorescent group cannot be absorbed by the quenching group. The fluorescent signal is detected, indicating the presence of the target DNA.

[0020] In the composition as described above, the molar ratio of the specific forward primer to the specific reverse primer is greater than or equal to 3:1, thereby increasing the amplification product chain that can bind to the specific probe. Furthermore, the molar ratio of the specific forward primer to the specific reverse primer is 3:1-10:1, and can specifically be 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 5.5:1, 6:1, 6.5:1, 7:1, 7.5:1, 8:1, 8.5:1, 9:1, 9.5:1, 10:1 or within the range of any two thereof. Furthermore, the molar ratio of the specific forward primer to the specific reverse primer is 10:1.

[0021] In the composition as described above, the length of the specific probe is 20-60 nt, and the GC content is 40%-60%.

[0022] In the composition as described above, the blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer and C12 Spacer.

[0023] In the composition as described above, the fluorescent group is selected from at least one of FAM (carboxyfluorescein), JOE (carboxydimethylfluorescein), TAMRA (tetramethylrhodamine), ROX (rhodamine X), CY3, CY5, VIC, and HEX (hexachlorofluorescein).

[0024] In the composition as described above, the quenching group is selected from at least one of BHQ1 and BHQ2.

[0025] In a second aspect, the present invention provides a method for preparing any of the above-mentioned compositions, comprising: S1. providing a specific forward primer, a specific reverse primer and a specific probe in the above composition; S2. Combining the specific forward primer, the specific reverse primer and the specific probe to obtain the composition.

[0026] In the present invention, the modification methods of the blocking group, fluorescent group and quenching group can be performed according to conventional methods in the art.

[0027] In the present invention, the specific forward primer, the specific reverse primer and the specific probe can be packaged separately or mixed together.

[0028] In a third aspect, the present invention provides an application of any of the above-mentioned compositions, wherein the application is at least one of A1) to A4): A1) Application in real-time fluorescence quantitative PCR analysis; A2) Application in the preparation of real-time fluorescence quantitative PCR analysis products; A3) Application in the detection of pathogens; A4) Use in the preparation of products for detecting pathogens.

[0029] In a fourth aspect, the present invention provides a method for pathogen detection based on real-time fluorescence quantitative PCR, comprising: D1. According to the target nucleic acid fragment of the pathogen to be detected, provide the composition as described above; prepare the nucleic acid of the sample to be detected; D2. Using the composition to perform real-time fluorescence quantitative PCR on the nucleic acid to determine whether the sample to be detected contains the pathogen to be detected.

[0030] In the method described above, the nucleic acid of the sample to be detected may be double-stranded DNA.

[0031] As described above, the methods of the present invention are suitable for any pathogen, such as a pathogen whose genome is RNA or DNA.

[0032] The method as described above, the direct purpose of the method may be non-disease diagnosis and / or non-disease treatment purposes. The above application or method is a non-disease diagnosis application or method. The above application or method does not have the direct purpose of obtaining disease diagnosis results or health conditions of living human or animal bodies.

[0033] The above method is an application or method for non-disease treatment purposes. The above method does not have the direct purpose of restoring or obtaining health or reducing pain in a living human or animal body.

[0034] In the method described above, the sample to be detected may be a sample from a non-living human or animal body, such as an environmental sample (such as air), clothing or towels, or animal tissues and / or organs used as food.

[0035] As described above, the molar concentration of the forward primer in the reaction system is 90-1000 nM, specifically 90 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1000 nM or within the range of any two thereof.

[0036] As described above, the molar concentration of the reverse primer in the reaction system is 30-100 nM, specifically 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM or within the range of any two thereof.

[0037] As described above, the molar concentration of the probe in the reaction system is 100-1000 nM, specifically 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1000 nM or within the range of any two thereof.

[0038] In the method described above, in D2, whether the sample to be detected contains the pathogen to be detected can be determined by detecting the fluorescent signal. For example, if the corresponding fluorescent signal is detected, it means that the sample to be detected contains the pathogen to be detected. If the corresponding fluorescent signal is not detected, it means that the sample to be detected does not contain the pathogen to be detected or contains the pathogen below the detection limit. In addition, for multiple PCR detection, whether the sample to be detected contains the pathogen to be detected can also be determined by detecting the fluorescent signal and the Tm value. For example, if the same fluorescent signal exists, the Tm value is analyzed by melting curve to determine the type or typing of the pathogen to be detected, thereby realizing multiple target detection.

[0039] It is understood that the composition provided by the present invention is suitable for the detection of multiple pathogens. Those skilled in the art can provide compositions for different pathogens and perform multiple PCR detection based on the content disclosed in the present invention. In a specific embodiment, the types of pathogens to be detected are not less than two, which can be multiple typings of pathogens, or multiple different types of pathogens. Further, the types of pathogens to be detected are not less than three. Further, the types of pathogens to be detected are not less than four.

[0040] In a fifth aspect, the present invention provides a composition for detecting human papillomavirus, comprising at least one of a first composition for detecting HPV 58, a second composition for detecting HPV 56, a third composition for detecting HPV 52, a fourth composition for detecting HPV 59, a fifth composition for detecting HPV 39, a sixth composition for detecting HPV 68, a seventh composition for detecting HPV 16, an eighth composition for detecting HPV 33, a ninth composition for detecting HPV 31, a tenth composition for detecting HPV 45, an eleventh composition for detecting HPV 18, a twelfth composition for detecting HPV 66, a thirteenth composition for detecting HPV 35, and a fourteenth composition for detecting HPV 51; The first composition comprises a first forward primer, a first reverse primer and a first probe for detecting HPV 58; the second composition comprises a second forward primer, a second reverse primer and a first probe for detecting HPV 56; the third composition comprises a third forward primer, a third reverse primer and a second probe for detecting HPV 52; the fourth composition comprises a fourth forward primer, a fourth reverse primer and a second probe for detecting HPV 59; the fifth composition comprises a fifth forward primer, a fifth reverse primer and a second probe for detecting HPV 39; the sixth composition comprises a sixth forward primer, a sixth reverse primer and a second probe for detecting HPV 68; the seventh composition comprises a seventh forward primer, a seventh reverse primer and a third probe for detecting HPV 16; the eighth composition comprises an eighth forward primer, an eighth reverse primer and a third probe for detecting HPV 33; the ninth composition comprises a fifth forward primer, a fifth reverse primer and a second probe for detecting HPV 39; The tenth composition comprises a ninth forward primer, a ninth reverse primer and a third probe for detecting HPV 31; the tenth composition comprises a tenth forward primer, a tenth reverse primer and a third probe for detecting HPV 45; the eleventh composition comprises an eleventh forward primer, an eleventh reverse primer and a fourth probe for detecting HPV 18; the twelfth composition comprises a twelfth forward primer, a twelfth reverse primer and a fourth probe for detecting HPV 66; the thirteenth composition comprises a thirteenth forward primer, a thirteenth reverse primer and a fourth probe for detecting HPV 35; the fourteenth composition comprises a fourteenth forward primer, a fourteenth reverse primer and a fourth probe for detecting HPV 51; The first forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 1; The second forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 3; The third forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 5; The fourth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:7; The fifth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:9; The sixth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:11; The seventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 13; The eighth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 15; The ninth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 17; The tenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 19; The eleventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:21; The twelfth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 23; The thirteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 25; The fourteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 27; The general structural formula of the reverse primer is shown in Formula 1: 5'-n(a)-Yn(b)-3' Formula 1 In Formula 1, n(a) and n(b) are polynucleotide fragments with different nucleotide sequences, and Y is a blocking group; In the first reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 2, and the nucleotide sequence of n(b) is GGACC; In the second reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:4, and the nucleotide sequence of n(b) is TCTAC; In the third reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:6, and the nucleotide sequence of n(b) is TTTCC; In the fourth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 8, and the nucleotide sequence of n(b) is GGTAG; In the fifth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 10, and the nucleotide sequence of n(b) is TCCAA; In the sixth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 12, and the nucleotide sequence of n(b) is CCCAG; In the seventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 14, and the nucleotide sequence of n(b) is GGATG; In the eighth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 16, and the nucleotide sequence of n(b) is ATGCC; In the ninth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 18, and the nucleotide sequence of n(b) is CATCT; In the tenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 20, and the nucleotide sequence of n(b) is GCATG; In the eleventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 22, and the nucleotide sequence of n(b) is TGAAG; In the twelfth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 24, and the nucleotide sequence of n(b) is TCCC; In the thirteenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 26, and the nucleotide sequence of n(b) is CAATG; In the fourteenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 28, and the nucleotide sequence of n(b) is CAACC; The first probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 31, wherein the first nucleotide of SEQ ID NO: 31 is labeled with a first fluorescent group, the 13th nucleotide is labeled with a first quenching group, and the 49th nucleotide is labeled with a second quenching group; The second probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 32, wherein the first nucleotide of SEQ ID NO: 32 is labeled with a second fluorescent group, the 12th nucleotide is labeled with a third quenching group, and the 57th nucleotide is labeled with a fourth quenching group; The third probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 33, wherein the first nucleotide of SEQ ID NO: 33 is labeled with a third fluorescent group, the 12th nucleotide is labeled with a fifth quenching group, and the 57th nucleotide is labeled with a sixth quenching group; The fourth probe is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 34, and the first nucleotide of SEQ ID NO: 34 is labeled with a fourth fluorescent group, the 13th nucleotide is labeled with a seventh quenching group, and the 59th nucleotide is labeled with an eighth quenching group.

[0041] The composition as described above also includes a composition for detecting an internal reference gene. In a specific embodiment, the internal reference gene can be a target DNA corresponding to human β-actin (β-actin). Further, the composition for detecting the target DNA corresponding to human β-actin includes a fifteenth forward primer, a fifteenth reverse primer and the first probe; The fifteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 29; The general structural formula of the fifteenth reverse primer is shown in Formula 1, and the nucleotide sequence of n(a) is SEQ ID NO: 30, and the nucleotide sequence of n(b) is TCTCG.

[0042] In the composition as described above, the blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer and C12 Spacer.

[0043] In the composition as described above, the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are independently selected from one of FAM, JOE, TAMRA, ROX, CY3, CY5, VIC, and HEX, and any two of the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are different.

[0044] In the composition as described above, the first quencher group, the second quencher group, the third quencher group, the fourth quencher group, the fifth quencher group, the sixth quencher group, the seventh quencher group, and the eighth quencher group are independently selected from one of BHQ1 and BHQ2.

[0045] In a sixth aspect, the present invention provides a kit for detecting human papillomavirus, comprising any of the above-mentioned compositions.

[0046] In a seventh aspect, the present invention provides a method for detecting human papillomavirus based on real-time fluorescence quantitative PCR, comprising: Preparing nucleic acid of a sample to be tested; Using any of the above-mentioned compositions, real-time fluorescence quantitative PCR is performed on the nucleic acid to determine whether the sample to be detected contains human papillomavirus.

[0047] In the present invention, the sample to be detected may be a cervical exfoliated cell sample or an environmental sample.

[0048] In the present invention, the nucleic acid may be DNA of a sample to be detected.

[0049] The present invention provides a novel specific forward primer, specific reverse primer and specific probe for real-time fluorescence quantitative PCR. In the process of real-time fluorescence quantitative PCR using the above composition, the specific probe is complementary paired with the amplification product and PCR amplification is continued, so that the fluorescent signal on the specific probe changes and can be detected by the instrument. Combined with the type of fluorescent group carried by the specific probe and the different melting temperatures of the PCR products of each target, multiple target detection is achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 This is a schematic diagram of the principle of the composition provided by the present invention in PCR amplification; Figure 2 The results of multiplex PCR detection of plasmid templates containing corresponding target DNA using a combination for HPV type 18, HPV type 66, HPV type 35, and HPV type 51; Figure 3 The results of multiplex PCR detection of plasmid templates containing corresponding target DNA using a combination of HPV type 58, HPV type 56 and internal reference genes; Figure 4 The results of multiplex PCR detection of plasmid templates containing corresponding target DNA using a combination of HPV types 16, 33, 31 and 45; Figure 5 The results of multiplex PCR detection of plasmid templates containing corresponding target DNA using a combination of HPV types 52, 59, 39 and 68; Figure 6 The results are shown in Figure 1. Multiplex PCR detection of HPV template plasmid mixtures using a combination of fourteen HPV and internal reference genes; Figure 7 The results are shown in Figure 1. Multiplex PCR detection of negative template plasmids using a combination of fourteen HPVs and internal reference genes; Figure 8 The result of PCR detection of negative template plasmid by the composition targeting fourteen HPVs and internal reference genes provided in Comparative Example 1; Fig. 9 The result of PCR detection of positive template plasmid by the composition targeting fourteen HPVs and internal reference genes provided in Comparative Example 1; Fig.10The result of PCR detection of negative template plasmid by the composition targeting fourteen HPVs and internal reference genes provided in Comparative Example 2; Fig.11 The results of PCR detection of positive template plasmids using the composition targeting fourteen HPVs and internal reference genes provided in Comparative Example 2. DETAILED DESCRIPTION

[0051] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0052] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0053] The nucleotide sequences of the primers and probes involved in the following examples are shown in Table 1.

[0054]

[0055] In Table 1, iSpC3 indicates that a blocking group C3 spacer is inserted into two adjacent nucleotides of the reverse primer; only the sequence located 5' upstream of the C3 spacer is listed in the sequence corresponding to the reverse primer. iBHQ1dT indicates that the base thymine (T) corresponding to the nucleotide is modified with a fluorescence quencher group BHQ1 (Black Hole Quencher 1); iBHQ2dT indicates that the base thymine (T) corresponding to the nucleotide is modified with a fluorescence quencher group BHQ2 (Black Hole Quencher 2); FAM indicates 5-carboxyfluorescein; VIC indicates green fluorescent protein; ROX indicates carboxy-X-rhodamine; CY5 indicates cyanine dye; BHQ1 and BHQ2 indicate fluorescence quenchers, respectively.

[0056] Example 1: PCR detection of fourteen types of HPV typing based on the primer-probe combination provided by the present invention Step 1, providing a plasmid containing a target DNA, wherein the nucleotide sequence of the target DNA corresponding to HPV type 18 is shown in SEQ ID NO: 35, the nucleotide sequence of the target DNA corresponding to HPV type 31 is shown in SEQ ID NO: 36, the nucleotide sequence of the target DNA corresponding to HPV type 33 is shown in SEQ ID NO: 37, the nucleotide sequence of the target DNA corresponding to HPV type 35 is shown in SEQ ID NO: 38, the nucleotide sequence of the target DNA corresponding to HPV type 39 is shown in SEQ ID NO: 39, the nucleotide sequence of the target DNA corresponding to HPV type 45 is shown in SEQ ID NO: 40, the nucleotide sequence of the target DNA corresponding to HPV type 51 is shown in SEQ ID NO: 41, the nucleotide sequence of the target DNA corresponding to HPV type 52 is shown in SEQ ID NO: 42, the nucleotide sequence of the target DNA corresponding to HPV type 56 is shown in SEQ ID NO: 43, the nucleotide sequence of the target DNA corresponding to HPV type 58 is shown in SEQ ID NO: 44, and the nucleotide sequence of the target DNA corresponding to HPV type 59 is shown in SEQ ID NO: The nucleotide sequence of the target DNA corresponding to HPV type 66 is shown in SEQ ID NO:46, the nucleotide sequence of the target DNA corresponding to HPV type 16 is shown in SEQ ID NO:47, and the nucleotide sequence of the target DNA corresponding to HPV type 68 is shown in SEQ ID NO:48.

[0057] At the same time, a negative control plasmid is provided, which does not contain the target DNA sequence, and the remaining sequences are the same as those of the plasmid containing the target DNA.

[0058] Step 2. Based on the target DNA, a primer-probe combination as shown in Table 1 is provided. According to the reaction system shown in Table 2, the plasmid containing the target DNA, the forward primer, reverse primer, probe and PCR reaction premix as shown in Table 1 are mixed to obtain a PCR reaction system with a total volume of 35 μL; wherein the PCR reaction premix includes DEPC-treated water, Tris buffer (pH 8.5), dATP, dCTP, dGTP, dUTP, KCl, MgCl2 and DNA polymerase.

[0059]

[0060] Step 3. Seal the PCR tube cap and gently mix the sample, then centrifuge briefly and let it stand at room temperature for 5 minutes. Place the PCR tube in the handheld centrifuge again, centrifuge briefly and transfer it to the tray of the SLAN real-time fluorescence quantitative PCR instrument of Shanghai Hongshi Medical Technology Co., Ltd. for PCR reaction. The PCR reaction procedure is:

[0061] Step 4: Data analysis: Use the SLAN real-time fluorescence quantitative PCR analysis software from Shanghai Hongshi Medical Technology Co., Ltd. to interpret the results based on the Tm value of the melting curve. Figure 2-7 As shown, when multiple plasmid templates are mixed for multiplex PCR detection, different types of HPV viruses can be distinguished without false positives.

[0062] Comparative Example 1 The nucleotide sequences of the forward primer and the reverse primer used in this comparative example are the same as those in Table 1, except that the reverse primer does not include the C3 spacer. The probe used is shown in Table 4.

[0063]

[0064] The positive template plasmid containing the target DNA and the positive template plasmid of the internal reference gene β-actin were mixed with the above primer-probe combination, and real-time fluorescence quantitative PCR was performed according to the method provided in Example 1. At the same time, real-time fluorescence quantitative PCR was performed using the negative template plasmid as a negative control (NTC). The reaction results are as follows: Figure 8-9 As shown in the figure, when C3spacer is not added to the 3' end of the reverse primer, in the multiplex PCR system, the primers and primers are prone to dimerization and produce nonspecific dimers, nonspecific peaks of the internal reference gene, and false positives.

[0065] Comparative Example 2 The nucleotide sequences of the forward primer and reverse primer used in this comparative example for detecting HPV are the same as those in comparative example 1, and the forward primer used for detecting the internal reference gene is the same as that in comparative example 1, except that the reverse primer and probe for detecting HPV type 35 are optimized, and the optimized sequences are shown in Table 5.

[0066]

[0067] The positive template plasmid containing HPV target DNA and the positive template plasmid of the internal reference gene β-actin were mixed with the above primer-probe combination, and real-time fluorescence quantitative PCR was performed according to the method provided in Example 1. At the same time, real-time fluorescence quantitative PCR was performed using the negative template plasmid as a negative control (NTC). The reaction results are as follows: Figure 10-11 As shown, it can be seen that by optimizing the primers and probes for detecting the internal reference gene, the non-specific peak corresponding to the internal reference gene disappears, but non-specific peaks of other targets still appear. The composition provided by the present invention can well solve the appearance of non-specific peaks and the problem of false positives, and is suitable for multiplex PCR detection.

[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A composition for real-time fluorescence quantitative PCR, characterized in that: It includes a specific forward primer, a specific reverse primer and a specific probe, wherein: The specific forward primer and the specific reverse primer are used to amplify the target DNA; A blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide at the 3' end of the specific reverse primer, where 4≤i≤8, and i is a positive integer; The specific probe meets the following conditions: 1) The specific probe is a single-stranded nucleic acid molecule; 2) the first nucleotide at the first end of the specific probe is labeled with a fluorescent group, the nth nucleotide from the first end of the specific probe is labeled with a first quenching group, and the first nucleotide at the second end of the specific probe is labeled with a second quenching group, 9≤n≤30, n is a positive integer, and n is less than the total number of nucleotides of the specific probe; 3) the partial nucleotide sequence of the specific probe is identical to the nucleotide sequence from the first nucleotide to the i-th nucleotide from the 3' end of the specific reverse primer; 4) the specific probe does not bind to the specific forward primer; 5) The specific probe does not bind to the specific reverse primer.

2. The composition according to claim 1, characterized in that The molar ratio of the specific forward primer to the specific reverse primer is greater than or equal to 3:

1.

3. Use of the composition according to claim 1 or 2, characterized in that: The application is at least one of A1) to A4): A1) Application in real-time fluorescence quantitative PCR analysis; A2) Application in the preparation of real-time fluorescence quantitative PCR analysis products; A3) Application in the detection of pathogens; A4) Use in the preparation of products for detecting pathogens.

4. A method for pathogen detection based on real-time fluorescence quantitative PCR, characterized in that: include: D1. providing the composition of claim 1 or 2 according to the target nucleic acid fragment of the pathogen to be detected; Preparing nucleic acid of a sample to be tested; D2. Using the composition to perform real-time fluorescence quantitative PCR on the nucleic acid to determine whether the sample to be detected contains the pathogen to be detected.

5. A composition for detecting human papillomavirus, characterized in that: comprising at least one of a first composition for detecting HPV 58, a second composition for detecting HPV 56, a third composition for detecting HPV 52, a fourth composition for detecting HPV 59, a fifth composition for detecting HPV 39, a sixth composition for detecting HPV 68, a seventh composition for detecting HPV 16, an eighth composition for detecting HPV 33, a ninth composition for detecting HPV 31, a tenth composition for detecting HPV 45, an eleventh composition for detecting HPV 18, a twelfth composition for detecting HPV 66, a thirteenth composition for detecting HPV 35 and a fourteenth composition for detecting HPV 51; The first composition includes a first forward primer, a first reverse primer and a first probe for detecting HPV type 58; The second composition includes a second forward primer, a second reverse primer and a first probe for detecting HPV type 56; The third composition includes a third forward primer, a third reverse primer and a second probe for detecting HPV type 52; The fourth composition includes a fourth forward primer, a fourth reverse primer and a second probe for detecting HPV type 59; The fifth composition includes a fifth forward primer, a fifth reverse primer and a second probe for detecting HPV type 39; The sixth composition includes a sixth forward primer, a sixth reverse primer and a second probe for detecting HPV type 68; The seventh composition includes a seventh forward primer, a seventh reverse primer and a third probe for detecting HPV type 16; The eighth composition comprises an eighth forward primer, an eighth reverse primer and a third probe for detecting HPV type 33; The ninth composition includes a ninth forward primer, a ninth reverse primer and a third probe for detecting HPV type 31; The tenth composition comprises a tenth forward primer, a tenth reverse primer and a third probe for detecting HPV type 45; The eleventh composition comprises an eleventh forward primer, an eleventh reverse primer and a fourth probe for detecting HPV type 18; The twelfth composition includes a twelfth forward primer, a twelfth reverse primer and a fourth probe for detecting HPV type 66; The thirteenth composition comprises a thirteenth forward primer, a thirteenth reverse primer and a fourth probe for detecting HPV type 35; The fourteenth composition comprises a fourteenth forward primer, a fourteenth reverse primer and a fourth probe for detecting HPV type 51; The first forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 1; The second forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 3; The third forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 5; The fourth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:7; The fifth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:9; The sixth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:11; The seventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 13; The eighth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 15; The ninth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 17; The tenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 19; The eleventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:21; The twelfth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 23; The thirteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 25; The fourteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 27; The general structural formula of the reverse primer is shown in Formula 1: 5'-n(a)-Yn(b)-3' Formula 1 In Formula 1, n(a) and n(b) are polynucleotide fragments with different nucleotide sequences, and Y is a blocking group; In the first reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 2, and the nucleotide sequence of n(b) is GGACC; In the second reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:4, and the nucleotide sequence of n(b) is TCTAC; In the third reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:6, and the nucleotide sequence of n(b) is TTTCC; In the fourth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 8, and the nucleotide sequence of n(b) is GGTAG; In the fifth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 10, and the nucleotide sequence of n(b) is TCCAA; In the sixth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 12, and the nucleotide sequence of n(b) is CCCAG; In the seventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 14, and the nucleotide sequence of n(b) is GGATG; In the eighth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 16, and the nucleotide sequence of n(b) is ATGCC; In the ninth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 18, and the nucleotide sequence of n(b) is CATCT; In the tenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 20, and the nucleotide sequence of n(b) is GCATG; In the eleventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 22, and the nucleotide sequence of n(b) is TGAAG; In the twelfth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 24, and the nucleotide sequence of n(b) is TCCC; In the thirteenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 26, and the nucleotide sequence of n(b) is CAATG; In the fourteenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 28, and the nucleotide sequence of n(b) is CAACC; The first probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 31, wherein the first nucleotide of SEQ ID NO: 31 is labeled with a first fluorescent group, the 13th nucleotide is labeled with a first quenching group, and the 49th nucleotide is labeled with a second quenching group; The second probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 32, wherein the first nucleotide of SEQ ID NO: 32 is labeled with a second fluorescent group, the 12th nucleotide is labeled with a third quenching group, and the 57th nucleotide is labeled with a fourth quenching group; The third probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 33, wherein the first nucleotide of SEQ ID NO: 33 is labeled with a third fluorescent group, the 12th nucleotide is labeled with a fifth quenching group, and the 57th nucleotide is labeled with a sixth quenching group; The fourth probe is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 34, and the first nucleotide of SEQ ID NO: 34 is labeled with a fourth fluorescent group, the 13th nucleotide is labeled with a seventh quenching group, and the 59th nucleotide is labeled with an eighth quenching group.

6. The composition according to claim 5, characterized in that The composition further comprises a fifteenth composition for detecting an internal reference gene, wherein the fifteenth composition comprises a fifteenth forward primer, a fifteenth reverse primer and the first probe for detecting an internal reference gene; The fifteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 29; The general structural formula of the fifteenth reverse primer is shown in Formula 1, and the nucleotide sequence of n(a) is SEQ ID NO: 30, and the nucleotide sequence of n(b) is TCTCG.

7. The composition according to claim 5 or 6, characterized in that The blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer and C12 Spacer.

8. The composition according to claim 5 or 6, characterized in that The first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are independently selected from one of FAM, JOE, TAMRA, ROX, CY3, CY5, VIC, and HEX, and any two of the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are different; And / or, the first quenching group, the second quenching group, the third quenching group, the fourth quenching group, the fifth quenching group, the sixth quenching group, the seventh quenching group, and the eighth quenching group are independently selected from one of BHQ1 and BHQ2.

9. A kit for detecting human papillomavirus, characterized in that: The invention comprises a composition according to any one of claims 5 to 8.

10. A method for detecting human papillomavirus based on real-time fluorescence quantitative PCR, characterized in that: include: Preparing nucleic acid of a sample to be tested; The nucleic acid is subjected to real-time fluorescence quantitative PCR using the composition described in any one of claims 5 to 8 to determine whether the sample to be detected contains human papillomavirus.

Images