ONT sequencing library quantitative kit and method

Abstract

The invention relates to an ONT sequencing library quantitative kit and method, the ONT sequencing library quantitative kit comprises a primer group and a TaqMan probe, the primer group is used for specifically amplifying a beta-actin gene, the amplification area of the primer group covers at least partial area of a fifth exon and at least partial area of a sixth exon of the beta-actin gene, and the TaqMan probe is used for specifically amplifying the beta-actin gene. And the TaqMan probe can be specifically combined with an amplification region of the primer group. The application finds that the concentration of the ONT sequencing library and the qPCR amplification signal of the specific region of the beta-actin gene have a linear relationship, the ONT sequencing library can be quantitatively detected, absolute quantification of the ONT sequencing library can be realized, the actual concentration of the ONT sequencing library can be more accurately obtained, correction of the size of a DNA fragment based on the ONT sequencing library does not need to be carried out, and the detection efficiency is greatly improved. The sequencing quality can be improved, so that an optimal sequencing data result is obtained.

Description

Technical Field

[0001] The present application relates to the field of gene sequencing technology, and in particular to an ONT sequencing library quantification kit and method. Background Art

[0002] ONT sequencing (Oxford Nanopore Technologies, referred to as ONT) is a third-generation sequencing technology based on electrical signal recognition of base sequences. Different bases or different modifications on DNA / RNA have different chemical properties. When a single-stranded molecule passes through a nanopore channel, the obstacles caused by the bases vary in size, thus forming a characteristic ion current change signal. By real-time detection of these electrical signals, the corresponding base type can be obtained and sequencing is completed. The judgment of base type is currently performed through a complex algorithm of "Recurrent Neural Network", which has the following characteristics:

[0003] 1) Long read length: The longest read length can reach more than 2Mb, which is conducive to the detection of structural variations such as alternative splicing and gene fusion;

[0004] 2) Low cost: Compared with other third-generation sequencing technologies, ONT sequencing sample processing is extremely simple, does not require DNA polymerase, ligase and dNTPs, and the sequencing price is low;

[0005] 3) The sequencing process does not involve PCR amplification: avoiding errors or abundance changes that may be introduced by PCR amplification in next-generation sequencing;

[0006] 4) Direct-RNA / DNA library construction can directly obtain base modification information, such as methylation modification 5mC, 6mA, etc., without the need for bisulfate conversion or immunoprecipitation enrichment experiments like the second-generation sequencing;

[0007] 5) Low GC content and base preference, no interruption is required for RNA sequencing, and transcript level expression quantification is more accurate.

[0008] The purpose of ONT sequencing library preparation is to connect specific adapter sequences to the fragmented nucleic acid fragments to be tested so that they can be sequenced on the ONT sequencing platform. The quality of the ONT sequencing library is crucial to the quality of the data produced by ONT sequencing. Therefore, before the ONT sequencing library is sequenced on the machine, its concentration needs to be accurately measured so that the appropriate sequencing concentration can be adjusted during sequencing, and ultimately the best sequencing data results can be obtained.

[0009] Using specific primers, the two end adapters in the library can be connected to the complete sample to be tested for quantitative detection. This method can eliminate the interference of non-sequenceable libraries that are not connected to adapters at one or both ends, and is currently the preferred method for library quantification. Conventional qPCR quantitative detection of library concentration is mainly based on the dye method.

[0010] The main dye molecule used in the dye method is SYBR Green, which can specifically bind to the minor groove of the double-stranded DNA. Free SYBR Green has almost no fluorescent signal, but after binding to double-stranded DNA, its fluorescent signal can increase by hundreds of times. As the PCR product increases, the amount of PCR product binding to the dye also increases, and its fluorescent signal intensity represents the number of double-stranded DNA molecules. However, fluorescent dyes cannot distinguish between different double-stranded DNAs, primer dimers will affect the sensitivity of the test, and non-specific products will affect the accuracy of the results.

[0011] How to improve the accuracy of ONT sequencing library quantification is a difficult point in improving the quality of ONT sequencing. Summary of the invention

[0012] In order to solve the above problems and improve the accuracy of ONT sequencing library quantification, the present application provides a nucleic acid composition, which includes a primer set and a TaqMan probe for specifically amplifying the β-actin gene, the amplification region of the primer set covers at least a portion of the fifth exon and at least a portion of the sixth exon of the β-actin gene, and the TaqMan probe can specifically bind to the amplification region of the primer set.

[0013] In one embodiment, the primer set satisfies at least one of the following characteristics (1) to (2):

[0014] (1) the amplification region of the primer set includes the sequence shown in SEQ ID No. 4;

[0015] (2) The upstream primer of the primer set includes the sequence shown as SEQ ID No. 1, and the downstream primer includes the sequence shown as SEQ ID No. 2.

[0016] In one embodiment, the TaqMan probe satisfies at least one of the following characteristics (1) to (2):

[0017] (1) The TaqMan probe comprises the sequence shown in SEQ ID No. 3;

[0018] (2) TaqMan probes include TaqMan-MGB probes.

[0019] The present application also provides an ONT sequencing library quantification kit, comprising the above-mentioned nucleic acid composition.

[0020] In one embodiment, the kit further comprises a PCR amplification reagent, wherein the PCR amplification reagent comprises at least one of a buffer, dNTP and a DNA polymerase.

[0021] The present application still provides a method for quantifying an ONT sequencing library, which uses the above-mentioned nucleic acid composition or the above-mentioned kit to detect the concentration of the ONT sequencing library of a target nucleic acid sample.

[0022] In one embodiment, the target nucleic acid sample satisfies at least one of the following characteristics (1) to (4):

[0023] (1) The target nucleic acid sample is derived from at least one of the body fluids, cells, tissues and organs of a mammal;

[0024] (2) The target nucleic acid sample is a human genome sample;

[0025] (3) The length of the nucleic acid fragment to be tested in the ONT sequencing library of the target nucleic acid sample is 1 kb to 2 Mb;

[0026] (4) The concentration of the ONT sequencing library of the target nucleic acid sample is 10 4 ~10 9 copies / mL.

[0027] In one embodiment, the step of detecting the concentration of the ONT sequencing library of the target nucleic acid sample comprises:

[0028] Performing PCR amplification on the ONT sequencing library of the target nucleic acid sample to obtain an amplification signal of the target nucleic acid sample;

[0029] Obtain the quantitative standard curve of ONT sequencing library;

[0030] The concentration of the ONT sequencing library of the target nucleic acid sample is determined according to the amplification signal of the target nucleic acid sample and the quantitative standard curve of the ONT sequencing library.

[0031] In one embodiment, before obtaining the quantitative standard curve of the ONT sequencing library of the target nucleic acid sample, the method further includes:

[0032] The target standard was diluted 5 to 6 times to construct ONT sequencing libraries of different concentrations;

[0033] Amplifying ONT sequencing libraries of different concentrations using an ONT sequencing library quantification kit to obtain amplification signals of ONT sequencing libraries of different concentrations; and

[0034] The ONT library quantitative standard curve of the target nucleic acid sample was drawn according to the amplification signals of the ONT sequencing library with different concentrations.

[0035] The present application also provides an ONT sequencing method, which uses the above-mentioned ONT sequencing library quantification method to detect the concentration of the ONT sequencing library of the target nucleic acid sample and then sequences the ONT sequencing library of the target nucleic acid sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0037] Figure 1 A schematic diagram of the primer design of Experimental Group 1 provided in Example 1 of the present application;

[0038] Figure 2 A schematic diagram of the primer design of Experimental Group 2 provided in Example 1 of the present application;

[0039] Figure 3 A graph showing the amplification curve results of the standard sample of Experimental Group 1 provided in Example 1 of the present application;

[0040] Figure 4 This is a graph showing the amplification curve results of the standard product of Experimental Group 2 provided in Example 1 of the present application;

[0041] Figure 5 A graph showing the amplification efficiency of the standard product of Experimental Group 1 provided in Example 1 of the present application;

[0042] Figure 6 This is a graph showing the amplification efficiency results of the standard product of Experimental Group 2 provided in Example 1 of the present application;

[0043] Figure 7 This is a graph of the amplification results of 10 national reference materials for pre-implantation chromosomal aneuploidy provided in Example 1 of the present application. DETAILED DESCRIPTION

[0044] References to embodiments of the present application will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present application without departing from the scope or spirit of the present application. For example, a feature described or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0045] Therefore, it is intended that the present application covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present application are disclosed in or are apparent from the following detailed description. It will be appreciated by those of ordinary skill in the art that this discussion is merely a description of exemplary embodiments and is not intended to limit the broader aspects of the present application.

[0046] In order to at least partially solve at least one of the above-mentioned technical problems, the first aspect of the present application provides an ONT sequencing library quantification kit, which includes a nucleic acid composition and optionally a PCR amplification reagent, wherein the nucleic acid composition includes a primer set and a TaqMan probe for specifically amplifying the β-actin gene, the amplification region of the primer set covers at least a portion of the fifth exon and at least a portion of the sixth exon of the β-actin gene, and the TaqMan probe can specifically bind to the amplification region of the primer set.

[0047] Specifically, β-actin is a protein with high mRNA expression. It is a major protein component in striated muscle fibers and a major component of muscle filaments and cytoskeletal microfilaments. It plays an important role in maintaining cell structure, intracellular movement, cell division and other cell physiological activities. This gene is expressed in almost all eukaryotic cells and is widely present in mammalian tissues and cells.

[0048] As used herein, the term "primer" refers to an oligonucleotide, whether naturally present in a purified restriction digest or produced synthetically, which can act as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid chain (e.g., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH). The primer is preferably single-stranded for maximum efficiency in amplification, or it may be double-stranded. If double-stranded, the primer is first treated to separate its chains before being used to prepare an extension product. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to initiate the synthesis of an extension product in the presence of an inducing agent. The length of the primer depends on many factors, including temperature, primer source, and the use of the method. For example, in some embodiments, primers range in length from 10 to 100 or more nucleotides (e.g., 10-300, 15-250, 15-200, 15-150, 15-100, 15-90, 20-80, 20-70, 20-60, 20-50 nucleotides, etc.).

[0049] In the present application, the amplification region of the primer set spans a partial region of the fifth exon and a partial region of the sixth exon of the β-actin gene, and has a higher amplification efficiency.

[0050] TaqMan probe is an oligonucleotide probe with a fluorescent group at the 5' end and a quencher group at the 3' end. qPCR detection based on the TaqMan probe method can provide better sensitivity and specificity than the dye method. Its basic principle is to design and synthesize a probe that can specifically bind to the β-actin gene based on the β-actin gene. The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. At the beginning, the probe is completely bound to one chain of the β-actin gene, and the fluorescent signal emitted by the fluorescent reporter group is absorbed by the fluorescent quencher group, and no fluorescent signal can be detected. When the amplification extends to the position where the probe binds, the Taq enzyme uses its 5' exonuclease activity to cut the fluorescent reporter group connected to the 5' end of the probe from the probe, so that the fluorescent reporter group and the fluorescent quencher group are separated, so that the fluorescent monitoring system can receive the fluorescent signal, and the number of fluorescent molecules detected is proportional to the number of PCR products of the primer set. Therefore, the number of initial β-actin gene templates can be calculated based on the fluorescence intensity in the PCR reaction system.

[0051] ONT sequencing is to let DNA molecules pass through nanopores and identify bases by reading electrical signals. ONT library construction generally requires adding A bases to both sides of the DNA to be tested to turn the flat ends into sticky ends, and then adding Y adapters and motor proteins to complete the construction of the ONT sequencing library. The concentration of the ONT sequencing library refers to the nucleic acid content in the ONT sequencing library.

[0052] The present application discovered that there is a linear relationship between the concentration of the ONT sequencing library and the fluorescence intensity of the β-actin gene PCR amplification in the ONT sequencing library, thereby using TaqMan probes instead of traditional fluorescent dyes for library quantification, solving the problem of fluorescent dyes binding to nonspecific amplification products when performing library quantification using the traditional dye method, and no melting curve detection is required after the PCR reaction is completed, thereby shortening the experimental time.

[0053] The present application also found that the concentration of the ONT sequencing library and the qPCR amplification signal of the specific region of the β-actin gene have a better linear relationship, the ONT sequencing library can be quantitatively detected, the absolute quantification of the ONT sequencing library can be achieved, and the actual concentration of the ONT sequencing library can be obtained more accurately. There is no need to correct the DNA fragment size based on the ONT sequencing library, which can improve the sequencing quality and obtain the optimal sequencing data results.

[0054] In some embodiments, the amplification region of the primer set includes a sequence as shown in SEQ ID No. 4. The β-actin gene in this region can achieve better amplification efficiency, and the amplification signal and the ONT sequencing library concentration have a better linear relationship, thereby achieving more accurate absolute quantification of the ONT sequencing library.

[0055] Among them, SEQ ID No.4:

[0056] CCGATCCACACGGAGTACTTGCGCTCAGGAGGAGCAATGATCTGAGGAGGGAAGGGGACAGGCAGTGAGGACCCTGGATGTGACAGCTCCCCACACACCACAGGACCCCACAGCCGACCTGCCCAGGTCAGCTCAGGCAGGAAAGACACCCACCTTGATCTTCATTGTGCTGGGTGCC

[0057] In some embodiments, the primer set includes an upstream primer and a downstream primer, the upstream primer includes a sequence as shown in SEQ ID No. 1, and the downstream primer includes a sequence as shown in SEQ ID No. 2. The primer set has a higher amplification efficiency, and the amplification signal has a better linear relationship with the ONT sequencing library concentration.

[0058] Among them, SEQ ID No. 1: 5'-CCGATCCACACGGAGTACTT-3'.

[0059] Among them, SEQ ID No. 2: 5'-GGCACCCAGCACAATGAAGA-3'.

[0060] In some embodiments, in order to increase the Tm value of the TaqMan probe, the TaqMan probe includes a TaqMan-MGB probe. Among them, the TaqMan-MGB probe is a dual-labeled probe, which is optimized and improved on the basis of the TaqMan probe. The 3' end contains a binder (Minor Groove Binder, MGB) that can be inserted into the minor groove of DNA, which can increase the melting temperature of the probe (Tm is increased by about 10°C) and stabilize the complex between the probe and the target. The TaqMan MGB probe is significantly shorter than the traditional probe and has good detection specificity. MGB is connected to a non-luminescent fluorescent quencher group (Non-Fluorescent Quencher, NFQ group), and the signal generated by the fluorescent reporter group at the other end is quenched by the NFQ group, avoiding the background generated by the traditional quencher group, the fluorescence background signal is lower, and the detection sensitivity is better.

[0061] In some embodiments, the TaqMan probe includes a sequence as shown in SEQ ID No. 3, which can specifically bind to a specific region amplified by the above primer set, thereby enhancing amplification specificity.

[0062] Among them, SEQ ID No. 3: 5'-FAM-AGGACCCTGGATGTGAC-MGB-3'.

[0063] In the present application, fluorescent reporter groups of different wavelengths can label different TaqMan probes, so multiple targets can be detected simultaneously in the same reaction system using probes labeled with different fluorescence, thereby achieving the purpose of saving experimental costs.

[0064] In the ONT sequencing library quantification kit of the present application, the nucleic acid composition can quantify the ONT sequencing library according to the detection signal of the nucleic acid composition. The PCR amplification reagent includes at least one of a buffer, dNTP and a DNA polymerase, which is used in combination with the nucleic acid composition to achieve efficient amplification of the β-actin gene, and then absolutely quantify the ONT sequencing library according to the amplification signal.

[0065] A second aspect of the present application provides an ONT sequencing library quantification method, which uses the above-mentioned ONT sequencing library quantification kit to detect the ONT sequencing library concentration of the target nucleic acid sample.

[0066] In some embodiments, the target nucleic acid sample is derived from at least one of mammalian body fluids, cells, tissues and organs, and the target nucleic acid sample contains a β-actin gene, which is used to quantify the ONT sequencing library based on the amplification signal of the β-actin gene.

[0067] In some embodiments, the target nucleic acid sample is a human genome sample, and the ONT sequencing library can be quantified based on the amplification signal of the β-actin gene.

[0068] In some embodiments, in order to achieve efficient amplification of the ONT sequencing library, the length of the nucleic acid fragment to be tested in the ONT sequencing library of the target nucleic acid sample is 1Kb to 2Mb, further 5Kb to 2Mb, further 1Mb to 2Mb, and further 1.5Mb to 2Mb.

[0069] In some embodiments, the concentration of the ONT sequencing library of the target nucleic acid sample is 10 4 ~10 9 copies / mL, and can be further increased to 10 6 ~10 9 copies / mL, and further can be 10 8 ~10 9 copies / mL.

[0070] In some embodiments, the step of detecting the concentration of the ONT sequencing library of the target nucleic acid sample comprises:

[0071] Amplifying the ONT sequencing library of the target nucleic acid sample to obtain an amplification signal of the target nucleic acid sample;

[0072] Obtaining a quantitative standard curve of the ONT sequencing library of the target nucleic acid sample; and

[0073] The concentration of the ONT sequencing library of the target nucleic acid sample is determined according to the amplification signal of the target nucleic acid sample and the ONT sequencing library quantitative standard curve.

[0074] Specifically, according to the above steps, the absolute quantification of the ONT sequencing library can be achieved, and the actual concentration of the ONT sequencing library can be obtained more accurately without the need to correct the DNA fragment size based on the ONT sequencing library, which can improve the sequencing quality and thus obtain the best sequencing data results.

[0075] In some embodiments, obtaining a quantitative standard curve of an ONT sequencing library of a target nucleic acid sample includes:

[0076] The target standard was diluted 5 to 6 times to construct ONT sequencing libraries of different concentrations;

[0077] Using the ONT sequencing library quantification kit, amplifying ONT sequencing libraries of different concentrations to obtain amplification signals of ONT sequencing libraries of different concentrations; and

[0078] The quantitative standard curve of the ONT library of the target nucleic acid sample is drawn according to the amplification signals of the ONT sequencing library of different concentrations. Specifically, according to the different sources of the target nucleic acid sample, the corresponding nucleic acid standard can be selected to construct the ONT sequencing library of different concentrations, so as to construct the quantitative standard curve of the ONT sequencing library of the target nucleic acid sample according to the linear relationship between the concentration of the ONT sequencing library of the standard and its amplification signal.

[0079] In some embodiments, if the target nucleic acid sample is derived from a human, the target standard can be extracted human genomic DNA or purchased commercial human genomic DNA standards. The standard must meet the following two conditions: (1) the concentration or copy number is known; (2) the amplification efficiency is consistent with that of the target nucleic acid sample.

[0080] The basic principle of quantification: qPCR monitors the changes of PCR amplification products in real time through the fluorescence signal value, and performs quantitative analysis during the exponential amplification period. With each cycle of PCR, the DNA increases exponentially by 2 times and soon reaches a plateau. Assuming that the amount of starting DNA is A0, after n cycles, the amount of DNA product can theoretically be expressed as: An = A0 × 2 n Theoretically, the Ct value is inversely proportional to the logarithmic value of the starting template number.

[0081] Gradiently dilute the standard product with a known concentration and use it as a template for Real Time PCR, and a series of amplification curves can be obtained at equal intervals in the order of decreasing starting DNA amount. According to the linear relationship between the Ct value and the logarithm of the starting template number, a standard curve can be made.

[0082] Substitute the Ct value of the sample with an unknown concentration into the standard curve, and the starting template amount of the sample with an unknown concentration can be obtained. This is the quantification principle of qPCR.

[0083] Standard curve: The functions of the standard curve are manifested in the following two aspects. First, for absolute quantification, a standard curve needs to be made using a target standard product with a known concentration. Second, to verify the performance of qPCR primers, a standard curve also needs to be made for judgment. Therefore, the making of the standard curve is crucial. The method for making the standard curve includes the following steps:

[0084] Perform 5 to 6 gradient dilutions on the target standard product to construct ONT sequencing libraries with different concentrations; use the ONT sequencing libraries with different concentrations as templates for RT-qPCR or qPCR reactions to obtain the Ct values of the ONT sequencing libraries with different concentrations; and, based on the concentration of the ONT sequencing library and the Ct value measured by its amplification, draw the ONT sequencing library quantification standard curve of the target nucleic acid sample.

[0085] There are two indicators for evaluating the quality of the standard curve, the correlation coefficient (r 2 ) and the slope. The correlation coefficient reflects the linearity of the standard curve. The ideal value should be greater than 0.98. The closer it is to 1, the better the linearity and the more accurate the quantification. The slope reflects the PCR amplification efficiency (E). The ideal PCR amplification efficiency E is 0.9 < E < 1.1. If the PCR amplification efficiency is low, the primers must be redesigned; if the PCR amplification efficiency is higher than the theoretical value, it indicates that there may be substances in the reaction system that hinder the reverse transcription reaction or the PCR reaction, and the extraction method needs to be improved.

[0086] The correlation coefficient of the standard curve constructed by the primer set and probe of the present application is greater than 0.99, indicating that the linear relationship between the amplification signal of the primer set and probe of the present application and the concentration of the ONT sequencing library is excellent.

[0087] The third aspect of the present application provides an ONT sequencing method. After detecting the concentration of the ONT sequencing library of the target nucleic acid sample by the above method, sequence the ONT sequencing library of the target nucleic acid sample. By performing absolute quantification on the ONT sequencing library, the present application can improve the sequencing quality and thus obtain optimal sequencing data without the need to correct the DNA fragment size based on the ONT sequencing library.

[0088] It should be noted that, although the above content has been described in some embodiments of the present application, it cannot be used to limit the present application. For those skilled in the art, the present application may have various changes and variations. The reaction reagents, reaction conditions, etc. involved in the multiple asymmetric PCR technology and the fluorescent probe melting curve method can be adjusted and changed accordingly according to specific needs. Therefore, for those skilled in the art, without departing from the concept and principle of the present application, several simple replacements can also be made, which should all be included in the protection scope of the present application.

[0089] The implementation scheme of the present application will be described in detail below with reference to examples.

[0090] The nucleic acid composition used in the present example was synthesized by Shanghai Bio-Tech Co., Ltd. The Taq DNA polymerase used in the present example was purchased from Nanjing Novozyme Biotechnology Co., Ltd., with the product number P132-d2 (Taq DNA polymerase components include: 10× Taq HS Buffer (Mg 2+ plus), dNTP Mix (10 mM each), Taq HS DNA polymerase (5 U / μL)).

[0091] The end repair buffer (item number: E7546L) and FFPE DNA repair buffer (item number: M6630L) used in the examples of this application were purchased from NEB. The rapid ligase reaction buffer (item number: M0367L) and rapid T4 DNA ligase (item number: E6056L) were purchased from NEB. The adapter mixture (item number: EXP-AMII) was purchased from ONT. The library construction reagent (item number: SQK-LSK109) used in the examples of this application includes a rapid ligation reaction buffer, an end repair reaction buffer, an end repair enzyme mixture, a FFPE DNA repair enzyme mixture, and an eluent, which were purchased from ONT.

[0092] The national reference material for preimplantation chromosomal aneuploidy used in the present application was purchased from the China Food and Drug Administration. Other reagents used in the present application were obtained through conventional commercial channels.

[0093] The amplification instrument used in the examples of the present application is the SLAN-96S fully automatic medical PCR analysis system produced by Shanghai Hongshi.

[0094] Example 1

[0095] The sequences of the primers and probes in Experimental Group 1 of this Example are as follows:

[0096] Amplification primer F1 is the upstream primer, and its base sequence is:

[0097] SEQ ID No. 1: 5'-CCGATCCACACGGAGTACTT-3'.

[0098] Amplification primer R1 is a downstream primer, and its base sequence is:

[0099] SEQ ID No. 2: 5'-GGCACCCAGCACAATGAAGA-3'.

[0100] The fluorescent probe may be a self-quenching probe with a fluorescent group and a quenching group labeled at the 5' end and the 3' end, respectively.

[0101] The base sequence of the fluorescent probe P1 is:

[0102] SEQ ID No. 3: 5'-FAM-AGGACCCTGGATGTGAC-MGB-3'.

[0103] The specific amplification region is as follows Figure 1 As shown, the amplified sequence is:

[0104] SEQ ID No.4:

[0105] CCGATCCACACGGAGTACTTGCGCTCAGGAGGAGCAATGATCTGAGGAGGGAAGGGGACAGGCAGTGAGGACCCTGGATGTGACAGCTCCCCACACACCACAGGACCCCACAGCCGACCTGCCCAGGTCAGCTCAGGCAGGAAAGACACCCACCTTGATCTTCATTGTGCTGGGTGCC.

[0106] The primer and probe sequences of Experimental Group 2 of this Example are as follows:

[0107] Amplification primer F2 is the upstream primer, and its base sequence is:

[0108] SEQ ID No. 5: 5'-CAGACCTACTGTGCACCTAC-3'.

[0109] Amplification primer R2 is a downstream primer, and its base sequence is:

[0110] SEQ ID No. 6: 5'-GGAACTCTGCAGGTTCTAT-3'.

[0111] The fluorescent probe may be a self-quenching probe with a fluorescent group and a quenching group labeled at the 5' end and the 3' end, respectively.

[0112] The base sequence of the fluorescent probe P2 is:

[0113] SEQ ID No.7: 5'-FAM-CACACGAGCCAGTGTTA-MGB-3'

[0114] The specific amplification region is as follows Figure 2 As shown, the amplified sequence is:

[0115] SEQ ID No.8:

[0116] CAGACCTACTGTGCACCTACTTAATACACACTCCAAGGCCGCTTTACACCAGCCTCATGGCCTTGTCACACGAGCCAGTGTTAGTACCTACACCCACAACACTGTCTTAGACACCTAGTCAGAGACAAACACCAGAAAAAGAGCTCATCTGGGAAAAAGCAAATAGAACCTGCAGAGTTCC.

[0117] The ONT sequencing library was constructed using human genome standards of different concentrations. The specific steps for library construction are as follows:

[0118] (1) End repair

[0119] Reagent preparation:

[0120] End repair buffer and FFPE DNA repair buffer were thawed at room temperature;

[0121] Thaw the end repair enzyme mixture and FFPE DNA repair enzyme mixture on ice;

[0122] All reagents were mixed by flicking the tube wall or inverting and centrifuged briefly;

[0123] End repair buffer and FFPE DNA repair buffer may have some precipitates. After thawing to room temperature, turn the centrifuge tube several times to ensure that the reagents are completely mixed; (you can vortex to mix)

[0124] The End Repair Enzyme Mix and FFPE DNA Repair Enzyme Mix should not be vortexed.

[0125] Fill up the volume with DNA according to the method in Table 1, mix by pipetting (if you are worried about damaging the integrity of long fragments, you can gently tap the tube wall to mix), and centrifuge briefly.

[0126] Table 1

[0127] Components volume High-quality DNA x(100fmol) Nuclease-free water Make up to 48 μL

[0128] Prepare the reaction system according to the system in Table 2, mix the mixed system by pipetting (if you are concerned about damaging the integrity of the long fragment, you can gently tap the tube wall to mix), and centrifuge instantly.

[0129] Table 2

[0130] Components volume Amplicon DNA after supplementation 48μL End Repair Reaction Buffer 3.5μL End Repair Enzyme Mix 3μL FFPE DNA Repair Buffer 3.5μL FFPE DNA Repair Enzyme Mix 2μL total 60μL

[0131] The mixed system obtained according to Table 2 is subjected to an end repair reaction according to the reaction conditions of Table 3. The end repair product can be stored at 4°C overnight.

[0132] Table 3

[0133] temperature time cycle 20℃ 5min 1 65℃ 5min 1

[0134] The purification of the end repair product was carried out according to the following steps: add 60 μL of magnetic beads, mix well by pipetting, and let stand at room temperature for 5 minutes. During the process, the tube can be inverted / plucked for better adsorption; add 200 μL of 70% ethanol to ensure that the liquid can immerse the magnetic beads. Do not resuspend the magnetic beads. Place them directly on the magnetic rack until the liquid is clear and discard the supernatant; repeat the previous step; dry for 30 seconds, add 24 μL of water and let stand at room temperature for 2 minutes to elute; take 1 μL for Qubit concentration detection.

[0135] (2) Tag ligation and purification

[0136] The tag connection is performed as follows:

[0137] Thaw the rapid ligase reaction solution on ice; fully mix the reagents and centrifuge for 5 seconds to set the liquid to the bottom; dilute all samples to 700ng or 100fmol (no dilution is required if less than 700ng / 100fmol), and make up the volume to 22.5μL with nuclease-free water. Prepare the reaction system according to Table 4, pipette and mix well (if you are worried about damaging the integrity of long fragments, you can flick the tube wall to mix well), centrifuge briefly, and place at room temperature for ligation reaction for 10 minutes to obtain the tag ligation product.

[0138] Table 4

[0139] Components volume Unfinished product 22.5μL Rapid Ligase Reaction Buffer 25μL Label 2.5μL total 50μL

[0140] The purification of the label-linked product follows the following steps: resuspend the purified magnetic beads by vortexing; add 50 μL of magnetic beads, mix by pipetting, and let stand at room temperature for 5 minutes. During the process, the tube can be inverted / plucked for better adsorption; add 200 μL of 70% ethanol to ensure that the liquid can immerse the magnetic beads. Do not resuspend the magnetic beads, and place them directly on the magnetic rack until the liquid clarifies and discard the supernatant; repeat the previous step; dry for 30 seconds, add 24 μL of water and let stand at room temperature for 2 minutes to elute; take 1 μL for Qubit detection concentration, and the label-linked product can be stored at 4°C overnight.

[0141] (3) Adapter ligation and purification

[0142] Connect the connector as follows:

[0143] Mix the above samples in equal molar ratios (or other ratios) in a 1.5 mL tube. The total amount of fragments smaller than 3 kb should be controlled at 0.1 pmol to 0.2 pmol, and make up the volume to 65 μL with nuclease-free water.

[0144] Thaw the quick ligation reaction buffer, short fragment buffer, and elution buffer at room temperature, vortex mix, centrifuge briefly, and place on ice for later use;

[0145] Mix the connector mixture by inverting / flicking the tube, do not vortex, and place on ice until needed.

[0146] Prepare the reaction system according to Table 5, use a pipette to gently pipette to mix, centrifuge briefly, and incubate at room temperature for 10 min.

[0147] Table 5

[0148] Components volume Tag connection product 65μL Rapid Ligation Reaction Buffer (5X) 20μL Joint Mixture 5μL Fast T4 DNA Ligase 10μL Total 100μL

[0149] The purification of the connector ligation product was carried out according to the following steps: the purified magnetic beads were resuspended by vortexing; 50 μL of magnetic beads were added, and the mixture was mixed by pipetting, and the mixture was incubated at room temperature in a constant temperature oscillator for 5 min; centrifuged briefly, placed on a magnetic rack for 5 min, until the liquid was clear and transparent, and the supernatant was aspirated and discarded with a pipette; 200 μL of short fragment buffer was added, and the centrifuge tube was placed on a magnetic rack after resuspending until the washing solution was transparent and colorless, and the supernatant was aspirated and discarded with a pipette; the previous step was repeated; after a brief centrifugation, the tube was placed on a magnetic rack, and the excess residual liquid was aspirated, and the tube was dried for about 30 s, but it should not be dried to cracking; the tube was removed from the magnetic rack, and eluted with 15 μL of elution buffer, and incubated at room temperature for 10 min; the tube was placed back on the magnetic rack to pellet the magnetic beads until the elution solution was clear and colorless, for at least 1 minute; 15 μL of elution solution was aspirated and transferred to a new 1.5 mL centrifuge tube.

[0150] The above primer probe sets were used to amplify and detect the ONT sequencing library constructed with human genome standards of different concentrations. The specific PCR amplification reaction system is shown in Table 6, the amplification conditions are shown in Table 7, the detection Ct values ​​of the human genome standards of the primer probe pairs (F1, R1, P1) are shown in Table 8, and the detection Ct values ​​of the human genome standards of each concentration of the primer probe pairs (F2, R2, P2) are shown in Table 9. The dilution multiples of the human genome standards are 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 .

[0151] Table 6

[0152] Components Final concentration Reagent volumes for a single reaction <![CDATA[10×Taq HS Buffer(Mg 2+ plus)]]> 1× 2.5μL dNTP Mix (10 mM each) 0.2mM 0.5μL Taq HS DNA polymerase (5U / μl) 0.01U / μL 0.5μL Upstream primer (10 μM) 0.2μM 0.5μL Downstream primer (10 μM) 0.2μM 0.5μL Probe (10 μM) 0.2μM 0.5μL ddH2O / 10μL template 5μL Total volume / 25μL

[0153] Table 7

[0154]

[0155] Table 8

[0156] Experimental Group 1 Ct value <![CDATA[Dilute the sample by 10 1 times]]> 9.25 <![CDATA[Dilute the sample by 10 2 times]]> 11.82 <![CDATA[Dilute the sample by 10 3 times]]> 14.96 <![CDATA[Dilute the sample by 10 4 times]]> 19.07 <![CDATA[Dilute the sample by 10 5 times]]> 23.45 <![CDATA[Dilute the sample by a factor of 10 6 times]]> 27.02

[0157] Table 9

[0158]

[0159]

[0160] (1) Through Table 8, Table 9 and Figure 3 , Figure 4 , Figure 5 , Figure 6 The experimental results show that the best amplification efficiency of the primer probe can be found, that is, when the Ct value of the amplification curve is less than or equal to 27.02, the library construction can be considered successful, otherwise it is considered that the library construction is not successful and needs to be reconstructed. It can be seen that the primer probe of the present application has good amplification efficiency and linearity for the library.

[0161] (2) From the Ct value, correlation coefficient, and amplification efficiency, it can be concluded that the experimental results of experimental group 1 are better than those of experimental group 2, and the primer-probe pair of experimental group 1 is more specific than the primer-probe pair of experimental group 2; thus, it can be concluded that the primer-probe combination of experimental group 1 is preferred.

[0162] The ONT sequencing library with the concentration shown in Table 10 was sequenced using the ONT sequencing platform, and the sequencing data quality control results are shown in Table 11.

[0163] Table 10

[0164]

[0165] Table 11

[0166]

[0167] The results of Table 11 show that the concentration of the ONT sequencing library quantitatively detected by the ONT sequencing library probe method based on the present embodiment is sequenced on the machine, and a higher amount of library sequencing data can be obtained, and the library sequencing data Dup is significantly reduced. Therefore, the quantitative detection of the ONT sequencing library based on the detection primer and the detection probe of the present embodiment can more accurately and effectively obtain the concentration of the ONT sequencing library, and there is no need to correct the test result. Compared with the conventional dye method qPCR quantitative detection, the operation is simpler and the result is more accurate.

[0168] Example 2

[0169] Ten national reference samples of preimplantation chromosomal aneuploidy were collected, and ONT libraries were constructed for the ten national reference samples of preimplantation chromosomal aneuploidy according to the library construction steps of Example 1 to obtain sequencing libraries.

[0170] The sequencing library obtained in the above library construction step was amplified and tested using the nucleic acid composition of experimental group 1 in Example 1. The test results are shown in Table 12 below.

[0171] Table 12

[0172] Sample No. Ct value 1 21.02 2 21.50 3 21.41 4 21.51 5 21.15 6 21.35 7 21.27 8 21.20 9 21.38 10 21.49

[0173] Combined with Table 12 and Figure 7 The test results show that the national reference materials for preimplantation chromosomal aneuploidy in 10 human embryos can all be effectively amplified, thereby achieving quantification of the ONT sequencing library.

[0174] The technical features of the above embodiments may be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0175] The above embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. An ONT sequencing library quantification kit, characterized in that: The invention comprises a nucleic acid composition, which comprises a primer set and a TaqMan probe for specifically amplifying a β-actin gene, wherein the amplification region of the primer set covers at least a part of the fifth exon and at least a part of the sixth exon of the β-actin gene, and the TaqMan probe can specifically bind to the amplification region of the primer set.

2. The ONT sequencing library quantification kit according to claim 1, characterized in that The primer set satisfies at least one of the following characteristics (1) to (2): (1) The amplification region of the primer set comprises the sequence shown in SEQ ID No. 4; (2) The primer set includes an upstream primer and a downstream primer, the upstream primer includes the sequence shown as SEQ ID No.1, and the downstream primer includes the sequence shown as SEQ ID No.

2.

3. The ONT sequencing library quantification kit according to claim 1 or 2, characterized in that The TaqMan probe satisfies at least one of the following characteristics (1) to (2): (1) The TaqMan probe comprises the sequence shown in SEQ ID No. 3; (2) The TaqMan probe includes a TaqMan-MGB probe.

4. The ONT sequencing library quantification kit according to claim 1, characterized in that Also included is a PCR amplification reagent, which includes at least one of a buffer, dNTP and a DNA polymerase.

5. A method for quantifying an ONT sequencing library, characterized in that: The ONT sequencing library quantification kit according to any one of claims 1 to 4 is used to detect the concentration of the ONT sequencing library of the target nucleic acid sample.

6. The ONT sequencing library quantification method according to claim 5, characterized in that: The target nucleic acid sample satisfies at least one of the following characteristics (1) to (4): (1) The target nucleic acid sample is derived from at least one of mammalian body fluids, cells, tissues and organs; (2) The target nucleic acid sample is a human genome sample; (3) The length of the nucleic acid fragment to be tested in the ONT sequencing library of the target nucleic acid sample is 1 kb to 2 Mb; (4) The concentration of the ONT sequencing library of the target nucleic acid sample is 10 4 ~10 9 copies / mL.

7. The ONT sequencing library quantification method according to claim 5 or 6, characterized in that: The step of detecting the concentration of the ONT sequencing library of the target nucleic acid sample comprises: Amplifying the ONT sequencing library of the target nucleic acid sample using an ONT sequencing library quantification kit to obtain an amplification signal of the target nucleic acid sample; Obtaining a quantitative standard curve of the ONT sequencing library of the target nucleic acid sample; The concentration of the ONT sequencing library of the target nucleic acid sample is determined according to the amplification signal of the target nucleic acid sample and the ONT sequencing library quantitative standard curve.

8. The ONT sequencing library quantification method according to claim 7, characterized in that: The concentration or copy number of the target standard is known and consistent with the amplification efficiency of the target nucleic acid sample; Optionally, the target standards include human genome standards.

9. The ONT sequencing library quantification method according to claim 7, characterized in that: Before obtaining the quantitative standard curve of the ONT sequencing library of the target nucleic acid sample, the following steps are required: The target standard was diluted 5 to 6 times to construct ONT sequencing libraries of different concentrations; Using the ONT sequencing library quantification kit, amplifying ONT sequencing libraries of different concentrations to obtain amplification signals of ONT sequencing libraries of different concentrations; and The ONT library quantitative standard curve of the target nucleic acid sample was drawn according to the amplification signals of the ONT sequencing library with different concentrations.

10. An ONT sequencing method, characterized in that: After determining the concentration of the ONT sequencing library of the target nucleic acid sample by using the ONT sequencing library quantification method according to any one of claims 5 to 9, the ONT sequencing library of the target nucleic acid sample is sequenced.

Images