Fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for dual identification of European and American porcine reproductive and respiratory syndrome viruses
By designing a dual-identification fluorescent RT-PCR detection kit for European and American types of porcine reproductive and respiratory syndrome virus (PRRSV), the problems of low efficiency, high cost, and easy cross-contamination in existing technologies for PRRSV typing have been solved, achieving rapid and accurate dual-identification detection that is suitable for various sample types.
Patent Information
- Application Number
- CN202511691877.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-18
- Publication Date
- 2025-12-16
AI Technical Summary
Existing technologies for PRRSV genotyping are inefficient, costly, prone to cross-contamination, lack effective endogenous quality control, and struggle to address issues such as clinical sample degradation and strain variation.
A dual-identification fluorescent RT-PCR detection kit for porcine reproductive and respiratory syndrome virus (PRRSV) European and American types was designed. The kit includes a specific primer combination, a specific fluorescent probe, an endogenous internal standard system, a fluorescent RT-PCR reaction solution, a positive control sample, and a negative control sample. The kit enables rapid identification and detection of the two genotypes through a single-tube reaction. An endogenous internal standard system is used to monitor sample quality, and an optimized fluorescent RT-PCR reaction solution is used to improve reaction efficiency and contamination prevention.
It enables rapid identification of two genotypes in a single-tube reaction, avoiding operational complexity and the risk of cross-contamination, improving detection throughput and efficiency, ensuring the accuracy and reliability of detection results, and is capable of handling strain variations and sample degradation, making it suitable for the detection of various sample types.
Smart Images

Figure CN121137271A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of virus detection technology, and more specifically, to a dual-identification fluorescent RT-PCR detection kit for European and American types of porcine reproductive and respiratory syndrome virus. Background Technology
[0002] Porcine reproductive and respiratory syndrome (PRRS), commonly known as "blue ear disease," is a highly contagious disease caused by porcine reproductive and respiratory syndrome virus (PRRSV), characterized by severe reproductive disorders in sows and respiratory disease in piglets. Since its first outbreak in the late 1980s, this disease has caused continuous and enormous economic losses to the global pig industry. PRRSV belongs to the order Heliovirales, family Arteriviridae, and is an enveloped, single-stranded, positive-sense RNA virus. The viral genome is highly variable, and based on genetic and antigenic differences, it can be divided into two genotypes: European type (Type 1, represented by strain LV) and American type (Type 2, represented by strain VR-2332). The nucleotide sequence homology between the two genotypes is only about 50-60%, and there are significant differences in geographical distribution, pathogenicity, and immunogenicity.
[0003] In actual production, single or mixed infections with European and American strains frequently occur. Currently, the main technologies used for PRRSV detection and typing include the following: ① Virus isolation and identification: This method is the "gold standard" for diagnosing PRRSV, but the operation is cumbersome and time-consuming (usually requiring 5-7 days), has high requirements for laboratory cell culture conditions, and has low sensitivity, making it unsuitable for large-scale rapid clinical diagnosis. ② Serological testing (such as ELISA): This method determines the type of infection by detecting PRRSV-specific antibodies in serum. Although this method can be used for screening group infection status, it cannot distinguish between European and American strains, and is prone to false negatives in the early stages of infection before antibody production (window period), failing to meet the needs of early, rapid, and typing-based diagnosis. ③ Conventional RT-PCR and gel electrophoresis: This method amplifies viral nucleic acid using type-specific primers and then judges the type by observing the band size using agarose gel electrophoresis. Its sensitivity is significantly improved compared to virus isolation, but the operation involves many steps and is complex, requiring the gel to be opened for electrophoresis, which easily generates aerosol contamination, leading to false positive results. Meanwhile, its identification capability is limited, making high-throughput detection difficult. ④ Single-pair real-time fluorescent RT-PCR: This technology designs primers and probes for a specific genotype (usually the American type), enabling closed-tube detection. It has the advantages of high sensitivity, high specificity, and quantification, effectively avoiding cross-contamination. However, existing single-pair kits can only detect a single type. To differentiate between European and American types, two independent RT-PCR reactions must be performed on the same sample. This not only doubles the detection cost and increases sample consumption but also increases operational complexity and inter-experimental errors, reducing detection efficiency and failing to meet the urgent clinical need for rapid typing and identification of large batches of samples.
[0004] Based on the above statements, this application proposes a fluorescent RT-PCR detection kit for dual identification of European and American types of porcine reproductive and respiratory syndrome virus (PRRSV) using RT-PCR technology. Summary of the Invention
[0005] To address the problems of low efficiency, high cost, susceptibility to cross-contamination, lack of effective endogenous quality control, and difficulty in dealing with clinical sample degradation and strain variation in existing technologies for PRRSV genotyping, this application provides a dual-identification fluorescent RT-PCR detection kit for European and American types of porcine reproductive and respiratory syndrome virus.
[0006] Firstly, this application provides a dual-identification fluorescent RT-PCR detection kit for European and American types of porcine reproductive and respiratory syndrome virus (PRRSV), comprising a specific primer pair, a specific fluorescent probe, an endogenous internal standard system, a fluorescent RT-PCR reaction solution, a positive control sample, and a negative control sample; the specific primer pair comprises a specific primer pair targeting the European type ORF7 gene of PRRSV and a specific primer pair targeting the American type ORF6 gene of PRRSV, with the following nucleotide sequences: PRRSV European type ORF7 gene-specific primer pair: Upstream primer PRRSV-EU-ORF7-F: TGCGCTCAACATCATCTTCG (SEQ ID NO.1); Downstream primer PRRSV-EU-ORF7-R: CGCTGAGAGTGTTGGCATGT (SEQ ID NO.2); PRRSV American type ORF6 gene-specific primer pair: Upstream primer PRRSV-NA-ORF6-F: GGCAAACAACGGCAAGATCA (SEQ ID NO.3); Downstream primer PRRSV-NA-ORF6-R: TCCACGCCCTTATTGTTGCT (SEQ ID NO.4).
[0007] Preferably, the total amount of the specific primer combination is 4 μL, comprising the following components: 1 μL of 20 μmol / L PRRSV-EU-ORF7-F, 1 μL of 20 μmol / L PRRSV-EU-ORF7-R, 1 μL of 20 μmol / L PRRSV-NA-ORF6-F, and 1 μL of 20 μmol / L PRRSV-NA-ORF6-R.
[0008] Preferably, the nucleotide sequences of the specific fluorescent probe are as follows: PRRSV European type ORF7 gene-specific probe PRRSV-EU-ORF7-Probe: FAM-ACACCGCAACACCTGGCCCA-BHQ1 (SEQ ID NO.5); PRRSV American type ORF6 gene-specific probe PRRSV-NA-ORF6-Probe: HEX-TGGCGAGCCTTGCCCTTGAC-BHQ1 (SEQ ID NO.6); The specific fluorescent probes are labeled with mutually distinguishable fluorescent reporter groups at their 5' ends and with fluorescent quencher groups at their 3' ends; wherein, the fluorescent reporter group of the European-type specific probe is FAM, and the fluorescent reporter group of the American-type specific probe is HEX or VIC; the fluorescent quencher group is selected from one of BHQ1, BHQ2, BHQ3, and TAMRA.
[0009] Preferably, the total amount of the specific fluorescent probe is 2 μL, comprising the following components: 1 μL of 50 μmol / L PRRSV-EU-ORF7-Probe and 1 μL of 50 μmol / L PRRSV-NA-ORF6-Probe.
[0010] Preferably, the endogenous internal standard system is a detection system for porcine β-actin genes, used to monitor sample quality and extraction efficiency, and its nucleotide sequences are as follows: Upstream internal standard primer P-β-actin-F: CACCACAGCCGAGAGGGAA (SEQ ID NO.7); Downstream internal standard primer P-β-actin-R: TCGTTGCCAATAGTGATGACC (SEQ ID NO.8); Internal standard probe P-β-actin-Probe: CY5-CCGCGAGAAGATGACCCAGATCATG-BHQ2 (SEQ ID NO. 9); The internal standard probe is labeled with a CY5 or ROX reporter fluorescent group at its 5' end and with a BHQ2 or BHQ3 quencher fluorescent group at its 3' end.
[0011] Preferably, the fluorescent RT-PCR reaction solution contains the following components: 2×One Step RT-PCR Mix, MgCl2, betaine, and UDG enzyme.
[0012] Preferably, the total volume of the fluorescent RT-PCR reaction solution is 14 μL, comprising the following components: 10 μL of 2×One Step RT-PCR Mix, 2 μL of 25 mmol / L MgCl2, 1 μL of 5 mol / L betaine, and 1 μL of 1 U / μL UDG enzyme.
[0013] Preferably, the positive control samples are PRRSV European type recombinant plasmid and PRRSV American type recombinant plasmid, both with a concentration of 1×10⁻⁶. 4 The PRRSV European recombinant plasmid contains the target sequence of the primers shown in SEQ ID NO.1-2, and the PRRSV American recombinant plasmid contains the target sequence of the primers shown in SEQ ID NO.3-4.
[0014] Preferably, the negative control sample is nuclease-free water.
[0015] Secondly, this application provides a non-diagnostic detection method for a dual-identification fluorescent RT-PCR detection kit for European and American types of porcine reproductive and respiratory syndrome virus, specifically including the following steps: S1. Sample processing: Collect the sample to be tested and extract total RNA from the sample; S2. Prepare the fluorescent RT-PCR reaction system: Mix the extracted RNA with the fluorescent RT-PCR reaction solution, specific primer combination, and specific fluorescent probe, and set up a positive control reaction system and a negative control reaction system; S3. Sample amplification: Place the prepared reaction system in a real-time quantitative PCR instrument and run the amplification program; S4. Result determination: Based on the Ct value of each fluorescence channel and the morphology of the amplification curve, determine the infection status of porcine reproductive and respiratory syndrome virus (PRRSV) European and / or American types in the sample.
[0016] Preferably, in step S1, the sample to be tested is a pig tissue sample, serum, semen, or oral swab.
[0017] Preferably, in step S2, the positive control group includes fluorescent RT-PCR reaction solution, PRRSV European type recombinant plasmid and PRRSV American type recombinant plasmid, specific primer combination and specific fluorescent probe; the negative control group includes fluorescent RT-PCR reaction solution, nuclease-free water, specific primer combination and specific fluorescent probe.
[0018] Preferably, in step S2, the total volume of the reaction system is 25 μL. The positive control group includes 14 μL of fluorescent RT-PCR reaction solution, 5 μL of PRRSV European type recombinant plasmid and PRRSV American type recombinant plasmid, 4 μL of specific primer combination, and 2 μL of specific fluorescent probe; the negative control group includes 14 μL of fluorescent RT-PCR reaction solution, 5 μL of nuclease-free water, 4 μL of specific primer combination, and 2 μL of specific fluorescent probe.
[0019] Preferably, in step S3, the amplification program is as follows: digestion stage: incubation at 35-40℃ for 4-6 min; reverse transcription stage: reaction at 45-50℃ for 10-15 min; pre-denaturation stage: reaction at 90-100℃ for 25-35 s; PCR cycling stage: denaturation at 90-100℃ for 4-8 s, annealing / extension at 55-65℃ for 25-35 s, for a total of 35-45 cycles, with fluorescence signals collected during the annealing / extension stage.
[0020] Preferably, in step S3, the amplification program is as follows: digestion stage: incubation at 35℃ for 5 min; reverse transcription stage: reaction at 45℃ for 15 min; pre-denaturation stage: reaction at 95℃ for 30 s; PCR cycling reaction stage: denaturation at 95℃ for 5 s, annealing / extension at 60℃ for 30 s, for a total of 40 cycles, and fluorescence signal is collected during the annealing / extension stage.
[0021] Preferably, in step S4, the criteria for determining infection are: If the Ct value of the FAM channel is ≤38 and a typical amplification curve appears, while the HEX channel shows no amplification, then it is determined to be PRRSV European type positive. If the Ct value of the HEX channel is ≤38 and a typical amplification curve appears, while the FAM channel shows no amplification, then it is determined to be PRRSV American type positive. If the Ct values of both the FAM and HEX channels are ≤38 and both show typical amplification curves, then it is determined to be a mixed infection of European and American types. If no amplification curve is observed in the FAM and HEX channels, but a typical amplification curve is observed in the internal standard (CY5) channel, the sample is considered negative for PRRSV. If no amplification is found in any of the channels (FAM, HEX, CY5), the detection is deemed invalid and needs to be repeated.
[0022] In summary, this application has the following beneficial effects: 1. By carefully designing and optimizing specific primers, probes, and endogenous internal standard systems for the European type ORF7 gene and the American type ORF6 gene of PRRSV, this kit can rapidly identify and detect the two genotypes in a single reaction system. This avoids the cumbersome operation process and the risk of cross-contamination caused by multiple openings in the typing test, greatly improving the detection throughput and efficiency, and reducing the biosafety risks in the laboratory.
[0023] 2. The fluorescent RT-PCR reaction solution in this kit employs an excellent integrated design. Its multiple key components are scientifically proportioned and work synergistically to ensure high efficiency and stability of the reaction. Specifically, the One-Step RT-PCR Mix combines reverse transcription and PCR amplification into one step, simplifying the operation and reducing sample loss and contamination opportunities. MgCl2 provides the necessary cofactor for enzyme activity, ensuring amplification efficiency. The addition of betaine enhances the specificity of the RT-PCR reaction, particularly aiding in the denaturation and amplification of complex secondary structure templates, thus enhancing the detection capability for degraded or difficult-to-amplify samples. The introduction of UDG enzyme (uracil-DNA glycosylase) constitutes a powerful anti-contamination mechanism, effectively degrading dUTP contamination that may be present in previous amplification products, thereby eliminating false positive results and ensuring the reliability of the detection results.
[0024] 3. The kit's built-in endogenous internal standard system targeting the porcine β-actin gene can monitor every step from nucleic acid extraction to final amplification. If the sample's internal standard channel (CY5) signal is normal, it indicates that the sample quality is qualified, nucleic acid extraction is successful, and there are no inhibitors in the reaction system. In this case, a negative PRRSV test can confirm a true negative result. If there is no signal from the internal standard, it indicates that the test result is invalid and resampling or extraction is required. This effectively avoids false negatives caused by sample degradation or operational errors, providing a solid guarantee for the accuracy of the results.
[0025] 4. The selected ORF7 and ORF6 gene target regions are relatively conserved, and the probes and primers have undergone rigorous screening to effectively address genetic variations in clinical strains, ensuring the breadth and accuracy of detection. Simultaneously, its sensitive detection performance can handle samples with low viral loads, and its broad sample type compatibility (tissue, serum, semen, swabs) allows it to meet the testing needs of various clinical scenarios. Attached Figure Description
[0026] Figure 1 The image shows the amplification results of the three primer sets in Example 1. Detailed Implementation
[0027] The present application will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only for explaining the present application and are not intended to limit the scope of the present application.
[0028] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0029] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.
[0030] Example 1: Design and Screening of Specific Primer Combinations Based on the genomic sequences of the representative European strain (LV strain) and the representative American strain (VR-2332 strain) of porcine reproductive and respiratory syndrome virus (PRRSV), and considering highly conserved regions of the European ORF7 gene and the American ORF6 gene, respectively, as well as sites with single nucleotide polymorphisms (SNPs), three sets of candidate specific primer combinations suitable for identifying and detecting European and American PRRSV using dual fluorescent RT-PCR were designed using Primer Premier 6.0 and Oligo 7.0 software. By adjusting key parameters such as Tm value, GC content, free energy, and amplicon length, these primers were optimized. The nucleotide sequences of each candidate primer are shown in Table 1.
[0031] Table 1. Nucleotide sequences of candidate specific primers for each group The three designed candidate primer combinations were used with known concentrations (1×10⁻⁶). 4 5 μL of European and American viral RNA standards (copies / μL) were used for dual fluorescent RT-PCR screening and evaluation according to the following reaction system: candidate specific primer combinations (4 primers, each with a concentration of 20 μmol / L, 1 μL of each primer), specific fluorescent probes (2 probes, each with a concentration of 50 μmol / L, 1 μL of each probe), 10 μL of 2×One Step RT-PCR Mix, 2 μL of 25 mmol / L MgCl2, 1 μL of 5 mol / L betaine, and 1 μL of 1 U / μL UDG enzyme.
[0032] The reaction procedure was as follows: digestion at 35℃ for 5 min; reverse transcription at 45℃ for 15 min; pre-denaturation at 95℃ for 30 s; denaturation at 95℃ for 5 s; annealing / extension at 60℃ for 30 s (during which FAM and HEX channel fluorescence signals were collected), for a total of 40 cycles.
[0033] After the reaction, preliminary screening was conducted by comparing the inflection point characteristics of the amplification curves and the fluorescence signal intensity (ΔRn value) of each candidate group. For example... Figure 1 The detection results showed that, compared with primer sets 2 and 3, primer set 1 had the clearest and most typical amplification curve inflection point and the highest fluorescence signal intensity (ΔRn). Therefore, this application determined that candidate primer set 1 was the optimal primer combination for detecting the European and American types of porcine reproductive and respiratory syndrome virus in subsequent embodiments.
[0034] Example 2: Detection of porcine reproductive and respiratory syndrome virus (PRRSV) using a prepared dual-identity fluorescent RT-PCR detection kit for European and American types. Kit components: ① Specific primer combination: 4 μL, containing primers shown in SEQ ID NO.1-4, each primer concentration is 20 μmol / L, and each primer volume is 1 μL; ② Specific fluorescent probes: 2 μL, containing the probes shown in SEQ ID NO.5-6, with a concentration of 50 μmol / L for each probe and a volume of 1 μL for each probe; ③Fluorescent RT-PCR reaction solution: 14 μL, 2×One Step RT-PCR Mix 10 μL, 25 mmol / L MgCl2 2 μL, 5 mol / L betaine 1 μL, 1 U / μL UDG enzyme 1 μL; ④ Positive control: containing 1×10 4 copies / μL of PRRSV European-type recombinant plasmid and 1×10 4 A mixture of 2.5 μL each of copies / μL PRRSV American-type recombinant plasmid; ⑤ Negative control: 5 μL of nuclease-free water.
[0035] ⑥ Internal control system: A mixture containing 1 μL each of the internal standard primers and probes shown in SEQ ID NO.7-9, with primer concentrations of 20 μmol / L and probe concentrations of 50 μmol / L.
[0036] Sample testing: S1. Sample processing: Serum samples were collected from pigs with clinical porcine reproductive and respiratory syndrome, and a total of 5 μL of RNA was extracted using a commercial viral RNA extraction kit; S2. Preparation of the fluorescent RT-PCR reaction system: ① Sample tube: Mix 5 μL of extracted RNA with 14 μL of fluorescent RT-PCR reaction solution, 4 μL of specific primer combination, and 2 μL of specific fluorescent probe; ② Positive control tube: Mix 5 μL of PRRSV European type recombinant plasmid and PRRSV American type recombinant plasmid with 14 μL of fluorescent RT-PCR reaction solution, 4 μL of specific primer combination, and 2 μL of specific fluorescent probe; ③ Negative control tube: Mix 5 μL of nuclease-free water with 14 μL of fluorescent RT-PCR reaction solution, 4 μL of specific primer combination, and 2 μL of specific fluorescent probe. S3. Sample amplification: Place each tube in a real-time quantitative PCR instrument and set the reaction program as follows: digest at 35℃ for 5 min; reverse transcription at 45℃ for 15 min; pre-denaturation at 95℃ for 30 s; denaturation at 95℃ for 5 s; annealing / extension at 60℃ for 30 s, for a total of 40 cycles.
[0037] S4. Result determination: FAM, HEX and CY5 channel fluorescence signals were collected at 60℃ to determine the infection status of porcine reproductive and respiratory syndrome virus European and / or American types in the sample.
[0038] The criteria for judging the test results of the reagent kit in this application are as follows: If the Ct value of the FAM channel is ≤38 and a typical amplification curve appears, while the HEX channel shows no amplification, then it is determined to be PRRSV European type positive. If the Ct value of the HEX channel is ≤38 and a typical amplification curve appears, while the FAM channel shows no amplification, then it is determined to be PRRSV American type positive. If the Ct values of both the FAM and HEX channels are ≤38 and both show typical amplification curves, then it is determined to be a mixed infection of European and American types. If no amplification curve is observed in the FAM and HEX channels, but a typical amplification curve is observed in the internal standard (CY5) channel, the sample is considered negative for PRRSV. If no amplification is found in any of the channels (FAM, HEX, CY5), the detection is deemed invalid and needs to be repeated.
[0039] Example 3: Specific detection of porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit. To verify the specificity of the porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit provided in this application, and to assess whether it has cross-reactivity with other common porcine pathogens, the following nucleic acid samples were tested using the optimal primer combination (SEQ ID NO. 1-4) screened in Example 1 of this application and the reaction system optimized in Example 2: Target pathogens: PRRSV European type nucleic acid (standard) and PRRSV American type nucleic acid (standard); Other common swine pathogens: classical swine fever virus (CSFV) nucleic acid, porcine circovirus type 2 (PCV2) nucleic acid, porcine epidemic diarrhea virus (PEDV) nucleic acid, porcine pseudorabies virus (PRV) nucleic acid, porcine deltacoronavirus (PDCoV) nucleic acid, and porcine transmissible gastroenteritis virus (TGEV) nucleic acid; Negative control: Nuclease-free water.
[0040] The specificity was detected according to the method described in Example 2, and the results are shown in Table 2.
[0041] Table 2. Specificity detection results of the dual-identification fluorescent RT-PCR detection kit for European and American types of porcine reproductive and respiratory syndrome virus. Experimental Results: As shown in Table 2, the dual-identification fluorescent RT-PCR detection kit for European and American types of porcine reproductive and respiratory syndrome virus (PRRSV) provided in this application specifically amplifies only the nucleic acids of European and American PRRSV, with typical amplification curves and early Ct values. No cross-reactivity was observed with other common porcine pathogens listed (CSFV, PCV2, PEDV, PRV, PDCoV, TGEV). No amplification was observed in the negative control, indicating that the reaction system was uncontaminated. In summary, this kit exhibits extremely high specificity and can accurately identify European and American types of PRRSV, making it suitable for precise detection in complex clinical settings.
[0042] Example 4: Sensitivity detection of the dual-identification fluorescent RT-PCR detection kit for European and American types of porcine reproductive and respiratory syndrome virus. To determine the detection sensitivity of the porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit provided in this application, specifically to determine its limit of detection (LOD) for PRRSV European and American RNA templates, in vitro transcribed RNA (ivt-RNA) standards of known copy numbers of PRRSV European (LV strain) and American (VR-2332 strain) were serially diluted 10-fold with nuclease-free water to prepare a concentration of 1×10⁻⁶. 0 1×10 1 1×10 2 1×10 3 1×10 4 1×10 5 1×10 6 The gradient dilution buffer was prepared in copies / μL. Using the optimal primer combination (SEQ ID NO. 1-4) determined in Example 1 of this application and the reaction system optimized in Example 2, the European and American ivt-RNA standards at each concentration gradient were tested, with each concentration tested 5 times.
[0043] Sensitivity testing was performed according to the method described in Example 2. After the experiment, the Ct value of each replicate reaction was recorded. Reactions producing a typical S-type amplification curve with a Ct value < 38 were considered positive. The lowest template concentration with a 95% positive rate in replicate tests was taken as the limit of detection (LOD) of this kit. The detection results are shown in Tables 3 and 4.
[0044] Table 3 Sensitivity test results for PRRSV European type Table 4. Sensitivity test results of PRRSV American type Experimental Results: The limit of detection (LOD) for European and American PRRSV ivt-RNA provided in this application is 10 copies / μL. The LOD for American PRRSV ivt-RNA is also 10 copies / μL. Even at the lowest detection concentration (10 copies / μL), the repeatability of detection for both European and American types remains good, with standard deviations of Ct values less than 1.5, indicating that the kit has extremely high sensitivity and excellent repeatability, meeting the detection requirements for samples with very low viral loads.
[0045] Example 5: Clinical Sample Testing Application and Conformity Evaluation To evaluate the detection performance of the porcine reproductive and respiratory syndrome virus (PRRSV) dual-identification fluorescent RT-PCR kit for European and American types provided in this application in clinical practice, a total of 150 clinical samples were collected from pig farms in different regions, including 80 serum samples, 40 lung tissue samples, 20 lymph node samples, and 10 semen samples. All samples underwent viral nucleic acid extraction and were then tested in parallel using both the kit provided in this application and virus isolation and identification (as a reference method).
[0046] The detection was performed according to the method described in Example 2, with positive controls, negative controls, and internal standard controls set up for both methods. The appearance of a typical amplification curve in the internal standard channel (CY5) was used as the quality control standard for the effectiveness of sample nucleic acid extraction and reaction. The detection results of the reference method were used as the standard to calculate the concordance rate, sensitivity, and specificity of the kit in this application. The detection results and concordance rate analysis are shown in Table 5.
[0047] Table 5. Evaluation results of clinical sample testing concordance rate Experimental Results: As shown in Table 5, the overall concordance rate between the kit and the reference method was 98.7%. Specifically, the concordance rate was 97.1% for European-type positive samples, 97.1% for American-type positive samples, 91.7% for mixed-infection positive samples, and 100% (35 / 35) for negative samples. The results of the two detection methods were subjected to a Kappa consistency test, with a Kappa value of 0.98 (P<0.001), indicating a high degree of consistency. The kit demonstrated excellent detection performance in clinical sample testing. Compared with the reference method, its dual detection capability not only did not reduce detection accuracy but also simultaneously obtained typing information for two genotypes in a single test, significantly improving detection efficiency and fully meeting the application needs of clinical testing.
[0048] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.
Claims
1. A dual-identification fluorescent RT-PCR detection kit for European and American types of porcine reproductive and respiratory syndrome virus, characterized in that, The kit includes a specific primer set, a specific fluorescent probe, an endogenous internal standard system, a fluorescent RT-PCR reaction solution, a positive control sample, and a negative control sample. The specific primer set includes a specific primer pair targeting the PRRSV European ORF7 gene and a specific primer pair targeting the PRRSV American ORF6 gene, with the following nucleotide sequences: PRRSV European type ORF7 gene-specific primer pair: Upstream primer PRRSV-EU-ORF7-F: TGCGCTCAACATCATCTTCG (SEQ ID NO.1); Downstream primer PRRSV-EU-ORF7-R: CGCTGAGAGTGTTGGCATGT (SEQ ID NO.2); PRRSV America-type ORF6 gene-specific primer pair: Upstream primer PRRSV-NA-ORF6-F: GGCAAACAACGGCAAGATCA (SEQ ID NO.3); Downstream primer PRRSV-NA-ORF6-R: TCCACGCCCTTATTGTTGCT (SEQ ID NO.4).
2. The porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit according to claim 1, characterized in that, The nucleotide sequences of the specific fluorescent probes are as follows: PRRSV European type ORF7 gene-specific probe PRRSV-EU-ORF7-Probe: ACACCGCAACACCTGGCCCA (SEQ ID NO.5); PRRSV Americas type ORF6 gene specific probe PRRSV-NA-ORF6-Probe: TGGCGAGCCTTGCCCTTGAC (SEQ ID NO. 6). The specific fluorescent probes are labeled with mutually distinguishable fluorescent reporter groups at their 5' ends and with fluorescent quencher groups at their 3' ends; wherein, the fluorescent reporter group of the European-type specific probe is FAM, and the fluorescent reporter group of the American-type specific probe is HEX or VIC; the fluorescent quencher group is selected from one of BHQ1, BHQ2, BHQ3, and TAMRA.
3. The porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit according to claim 1, characterized in that, The endogenous internal standard system is a detection system for porcine β-actin genes, and its nucleotide sequences are as follows: Upstream internal standard primer P-β-actin-F: CACCACAGCCGAGAGGGAA (SEQ ID NO.7); Downstream internal standard primer P-β-actin-R: TCGTTGCCAATAGTGATGACC (SEQ ID NO.8); Internal standard probe P-β-actin-Probe: CCGCGAGAAGATGACCCAGATCATG (SEQ ID NO.9); The internal standard probe is labeled with a CY5 or ROX reporter fluorescent group at its 5' end and with a BHQ2 or BHQ3 quencher fluorescent group at its 3' end.
4. The porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit according to claim 1, characterized in that, The fluorescent RT-PCR reaction solution contains the following components: 2×One Step RT-PCRMix, MgCl2, betaine, and UDG enzyme.
5. The porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit according to claim 1, characterized in that, The positive control samples were recombinant plasmids containing the target sequence of the PRRSV European type ORF7 gene and recombinant plasmids containing the target sequence of the PRRSV American type ORF6 gene.
6. The porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit according to claim 1, characterized in that, The negative control sample was nuclease-free water.
7. A non-diagnostic detection method for the porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit according to any one of claims 1-6, characterized in that, Specifically, the steps include the following: S1. Sample processing: Collect the sample to be tested and extract total RNA from the sample; S2. Prepare the fluorescent RT-PCR reaction system: Mix the extracted RNA with the fluorescent RT-PCR reaction solution, specific primer combination, and specific fluorescent probe, and set up a positive control reaction system and a negative control reaction system; S3. Sample amplification: Place the prepared reaction system in a real-time quantitative PCR instrument and run the amplification program; S4. Result determination: Based on the Ct value of each fluorescence channel and the morphology of the amplification curve, determine the infection status of porcine reproductive and respiratory syndrome virus (PRRSV) European and / or American types in the sample.
8. The non-diagnostic detection method of the porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit according to claim 7, characterized in that, In step S1, the sample to be tested is a tissue sample, serum, semen, or oral swab from a pig.
9. The non-diagnostic detection method of the porcine reproductive and respiratory syndrome virus (PRRSV) European and American dual-identification fluorescent RT-PCR detection kit according to claim 7, characterized in that, In step S3, the amplification program is as follows: digestion stage: incubation at 35-40℃ for 4-6 min; reverse transcription stage: reaction at 45-50℃ for 10-15 min; pre-denaturation stage: reaction at 90-100℃ for 25-35 s; PCR cycling stage: denaturation at 90-100℃ for 4-8 s, annealing / extension at 55-65℃ for 25-35 s, for a total of 35-45 cycles, with fluorescence signals collected during the annealing / extension stage.
Citation Information
Patent Citations
Fluorescent probe primer and kit for porcine reproductive and respiratory syndrome type European strains and application of fluorescent probe primer and kit
CN115852054A
Primer probe group and kit for detecting various porcine reproductive and respiratory syndrome viruses
CN116536457A
Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for porcine reproductive and respiratory syndrome virus and application thereof
CN119433104A
Primer probe group for simultaneously detecting American strain and European strain of porcine reproductive and respiratory syndrome virus, detection method and application
CN119614754A
Digital PCR kit for simultaneously detecting African swine fever virus, porcine reproductive and respiratory syndrome virus and swine fever virus
CN120505455A