Application of PPP1R3B gene in preparing reagent for detecting atherosclerosis or therapeutic drug

Abstract

The present invention discloses the application of the PPP1R3B gene in the preparation of atherosclerotic detection reagents or therapeutic drugs. The present invention for the first time discovers that the PPP1R3B gene is a reliable target for the diagnosis and treatment of atherosclerosis. By exogenous up-regulation of the expression of PPP1R3B, inducing the polarization of M2-type MΦ macrophages, it can alleviate the plaque inflammatory microenvironment, promote glycolipid metabolic reprogramming, support the energy load required by cells, delay the progression of atherosclerotic plaques, improve the quality of life of cardiovascular disease patients, reduce the incidence of cardiovascular and cerebrovascular events, and can be applied to the preparation of atherosclerotic diagnostic reagents and therapeutic drugs.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and particularly to the application of the PPP1R3B gene in the preparation of atherosclerotic detection reagents or therapeutic drugs. Background Art

[0002] Cardiovascular disease (CVD), as the "number one killer" threatening human life and health, is characterized by high incidence and high mortality. The latest data show that as of 2021, the number of global CVD patients was approximately 523 million, and the number of deaths reached 20.5 million, accounting for nearly one-third of the total number of deaths that year. Atherosclerotic cardiovascular disease (ASCVD) caused by atherosclerosis (AS) is the main cause of the high incidence and mortality of CVD patients. With the prevalence of obesity and cardiometabolic diseases, the incidence of ASCVD continues to rise, especially the most rapid growth in adults under 65 years old. Therefore, in-depth study of the pathogenesis of ASCVD is the top priority for reducing the incidence and mortality of CVD patients.

[0003] ASCVD is a chronic vascular inflammatory disease, and its course involves intimal injury, recruitment of inflammatory cells, and lipid accumulation. End-stage calcification and plaque rupture are likely to cause irreversible organ damage. The main reason for the continuous deterioration of ASCVD is that macrophages (MΦs) of various phenotypes in the plaque form a complex atherosclerotic inflammatory immune microenvironment. In this complex plaque environment, MΦs in the innate immune system are mainly polarized into pro-inflammatory M1-type MΦs and anti-inflammatory M2-type MΦs, and the imbalance of their metabolic regulation is the key factor for the deterioration of AS. The metabolic reprogramming of MΦs mainly involves glycolysis, the tricarboxylic acid (TCA) cycle, fatty acid, and amino acid metabolism. Different metabolic pathways meet the energy metabolic requirements of different phenotypic MΦs. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of the PPP1R3B gene in the preparation of atherosclerotic detection reagents.

[0005] Another purpose of the present invention is to provide an application of the PPP1R3B gene in the preparation of atherosclerotic therapeutic drugs.

[0006] The purpose of the present invention is achieved by the following technical solutions:

[0007] Application of the PPP1R3B gene in the preparation of atherosclerotic detection reagents.

[0008] The nucleotide sequence of the described PPP1R3B gene is as shown in SEQ ID NO.1.

[0009] A PPP1R3B gene is used in the preparation of an atherosclerotic detection reagent, including a reagent for detecting the expression level of the PPP1R3B gene.

[0010] Use of a reagent for upregulating the expression level of the PPP1R3B gene in the preparation of a therapeutic drug for atherosclerosis.

[0011] Use of a reagent for upregulating the expression level of the PPP1R3B gene in the preparation of an inducer for M2-type MΦ macrophage polarization.

[0012] A therapeutic drug for atherosclerosis, including a reagent for upregulating the expression level of the PPP1R3B gene.

[0013] The reagent for upregulating the expression level of the PPP1R3B gene is a PPP1R3B overexpression vector.

[0014] The PPP1R3B overexpression vector is a vector obtained by inserting the PPP1R3B gene into a plasmid; preferably a vector obtained by inserting it into a lentiviral overexpression plasmid; more preferably a vector obtained by inserting it into the lentiviral overexpression plasmid PGMLV-CMV-MCS-3×Flag-EF1-ZsGreen1-T2A-Puro.

[0015] The preparation method of the PPP1R3B overexpression vector includes the following steps:

[0016] Using PGMLV-CMV-MCS-3×Flag-EF1-ZsGreen1-T2A-Puro as the starting plasmid, insert the PPP1R3B gene (SEQ ID NO.1) into the multiple cloning site to construct the PPP1R3B overexpression vector PGMLV-CMV-OvPPP1R3B-3×Flag-EF1-ZsGreen1-T2A-Puro, and extract the PPP1R3B overexpression vector after passing the expression sequencing verification.

[0017] The reagent for upregulating the expression level of the PPP1R3B gene is a PPP1R3B overexpressing lentivirus prepared by co-transfecting the PPP1R3B overexpression vector and a packaging plasmid.

[0018] The preparation method of the PPP1R3B overexpressing lentivirus includes the following steps:

[0019] Culture AAV Pro-293T cells in a culture dish, use the HG-TransGene transfection reagent to transfect the packaging plasmid and the PPP1R3B overexpression vector into the cells, and collect the PPP1R3B overexpressing virus by centrifugation after culturing.

[0020] The atherosclerotic therapeutic drug described above further includes STAT3 agonist 1.

[0021] The atherosclerotic therapeutic drug described above further includes pharmaceutically acceptable excipients.

[0022] The present invention has the following advantages and effects compared with the prior art:

[0023] The present invention focuses on the key gene PPP1R3B, which serves as a reliable target for the diagnosis and treatment of atherosclerosis. By externally upregulating the expression of PPP1R3B and inducing the polarization of M2-type MΦ macrophages, it can alleviate the plaque inflammatory microenvironment, promote glycolipid metabolism reprogramming, support the energy load required by cells, delay the progression of atherosclerotic plaques, improve the quality of life of cardiovascular disease patients, reduce the incidence of cardiovascular and cerebrovascular events, and can be applied to the preparation of atherosclerotic diagnostic reagents and therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is a result graph showing the expression of PPP1R3B in different phenotypes of macrophages alone and the lentivirus knockdown and overexpression efficiency in Example 2.

[0025] Figure 2 It is the polarization situation of macrophages after knockdown and overexpression and induction stimulation in Example 2.

[0026] Figure 3 It is the glycogen accumulation situation of primary macrophages BMDM after PPP1R3B knockdown and overexpression in Example 2.

[0027] Figure 4 It is the result graph of Oil Red O staining in Example 2.

[0028] Figure 5 It is the result graph showing the effect of PPP1R3B on mitochondrial function in MΦs detected by JC-1 mitochondrial membrane potential assay in Example 2.

[0029] Figure 6 It is the immunofluorescence staining graph of aortic tissue sections in Example 2.

[0030] Figure 7 It is the expression situation of M2 macrophages in aortic plaques in vivo after overexpressing PPP1R3B in Example 3.

[0031] Figure 8 It is the representative graph of aortic glycogen staining in Example 3.

[0032] Figure 9 It is the representative result graph of Oil Red staining of the aorta of atherosclerotic mice in Example 3.

[0033] Figure 10It is the fluorescence result diagram of overexpression virus transfection of aorta in Example 3.

[0034] Figure 11 It is the H&E staining result diagram of Ctrl, AAV-PPP1R3B, and AAV-PPP1R3B + STAT3 agonist 1 groups in Example 4.

[0035] Figure 12 It is the photo diagram of plaque distribution in the gross aorta diagram in Example 4. Detailed implementation manners

[0036] The present invention will be further described in detail below in conjunction with examples and the accompanying drawings, but the implementation manners of the present invention are not limited thereto.

[0037] If the specific test conditions are not indicated in the following implementation schemes, they usually follow the conventional test conditions or the test conditions recommended by the reagent company. The materials, reagents, etc. used, unless otherwise specified, are all reagents and materials obtained from commercial channels.

[0038] Example 1 Sequencing and bioinformatics analysis of human atherosclerotic plaques

[0039] 1.1 Gene set enrichment analysis (GSEA)

[0040] GSEA is performed using GSEA software (version 3.0) and the molecular signature database. First, the GSEA presort function is used. Subsequently, a ranked list file is generated through differential expression analysis output of DESeq2. Then, the obtained data is integrated and analyzed through the multiGSEA package. Under the GPL-3 license, multiGSEA can be obtained publicly.

[0041] Using the Gene Expression Omnibus database, key genes regulating the progression of the immune microenvironment of human atherosclerotic plaques are explored. Analyzing next-generation sequencing (RNA-seq) data of 36 human plaques in the GSE57614 dataset identified 4283 differentially expressed genes (DEGs) in human M1 and M2 MΦs (|log2(FC)| > 1 and adjusted p < 0.05), among which 1959 were upregulated and 2324 were downregulated.

[0042] 1.2 Analysis of differentially expressed genes (DEGs) by WGCNA

[0043] The R package WGCNA is used to analyze the DEG co-expression modules. According to the approximate scale-free topology prerequisite condition and the cutoff criterion of ≥30 genes, the WGCNA parameters of the soft threshold power of the adjacency matrix and the criterion of the square of the correlation coefficient of the characteristic genes are defined. The dissimilarity of the adjacency matrix is 0.2. Then, the WGCNA modules (co-expression networks) of the characteristic genes are identified, and with stability correlation pWith ≤ 0.05 as the standard, a network related to M1 / M2 MΦ polarization was identified. Modules (Cd treatment, Cd accumulation, and different tissue nodes) with a gene significance (Pearson correlation coefficient) of ≥ 0.6 for M1 / M2 MΦ polarization genes were retained for further analysis.

[0044] 1.3 Metascape analysis

[0045] To perform pathway enrichment analysis and gene network reconstruction, we used the Metascape tool and the default parameter set. The gene set obtained from the WGCNA analysis was input, and pathway and enrichment analysis were performed by selecting the following genomics sources: KEGG pathway, GO biological process, Reactome gene set, canonical pathway, and CORUM.

[0046] GO and KEEG analyses showed that differentially expressed genes regulating MΦ polarization were mainly involved in immune recognition within plaques and inflammatory signaling pathways.

[0047] 1.4 Key gene PPP1R3B

[0048] Using the GSE57614 dataset, we found 4283 differentially expressed genes between M1 and M2 macrophages in plaques, of which 1959 were upregulated and 2324 were downregulated. Further GO and KEGG enrichment analyses showed that these differentially expressed genes were involved in regulating pathways related to macrophage polarization within plaques. Venn diagram and heatmap analyses of differentially expressed genes showed that PPP1R3B (Gene ID: 79660) was the target gene in the gene dataset of macrophages with different phenotypes.

[0049] Example 2 Cell experiments

[0050] 2.1 Cultivation of MΦ lines and primary MΦs

[0051] The model cells mainly included human and murine MΦs (THP-1 and RAW264.7), and the cells were cultured in a constant temperature incubator (37 °C; 5% CO2). The culture medium was RPMI 1640 complete medium containing 10% fetal bovine serum + 1% double antibiotics (penicillin, streptomycin).

[0052] Male C57BL / 6 mice, 6 - 8 weeks old, were obtained from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China) and used for the isolation of bone marrow-derived macrophages (BMDMs). The femurs and tibias of 6 - 8-week-old C57BL / 6 mice were removed, and the bone marrow was collected and lysed to remove red blood cells, followed by preparation of a single-cell suspension. The cells were cultured in a plate, and 10 ng / mL M-CSF was added to the complete medium to induce the maturation of MΦs. The medium was changed every 3 days, and after 7 days, adherent mature MΦs were obtained. Then, LPS (100 ng / mL) / IL-4 (20 ng / mL) was added to obtain M1 / M2 polarized MΦs.

[0053] 2.2 Preparation of PPP1R3B overexpression vector

[0054] Using PGMLV-CMV-MCS-3×Flag-EF1-ZsGreen1-T2A-Puro as the starting plasmid, the PPP1R3B gene (SEQ ID NO.1) was inserted into the multiple cloning site to construct the PPP1R3B overexpression vector PGMLV-CMV-OvPPP1R3B-3×Flag-EF1-ZsGreen1-T2A-Puro. After expression and sequencing verification, the plasmid containing the target gene was extracted.

[0055] 2.3 Preparation of PPP1R3B interference vector

[0056] (1) shRNA oligo sequences were designed and synthesized according to the sequence of the PPP1R3B gene. The specific sequences are as follows:

[0057] shRNA-F:

[0058] GATCCGCCTAGTTATCTGGGATATGACTCGAGTCATATCCCAGATAACTAGGCTTTTTT;

[0059] shRNA-R:

[0060] AATTAAAAAAGCCTAGTTATCTGGGATATGACTCGAGTCATATCCCAGATAACTAGGCG;

[0061] (2) The PGMLV-hU6-MCS-CMV-ZsGreen1-PGK-Puro vector was digested with enzymes. After annealing the shRNA oligo designed in step (1) to form a double strand, it was ligated to the vector and transformed into competent cells DH5α. Positive clones were identified by sequencing, and the PPP1R3B interference vector PGMLV-hU6-ShPPP1R3B -CMV-ZsGreen1-PGK-Puro was constructed.

[0062] 2.4 Lentivirus packaging

[0063] Culture AAV Pro-293T cells in a culture dish. Use HG-TransGene transfection reagent to transfect the packaging plasmid and the PPP1R3B overexpression vector / interference vector into the cells. After culturing, centrifuge to collect the PPP1R3B overexpression / interference virus concentrate, detect the titer, and store it frozen for later use.

[0064] 2.5 Lentivirus transfection

[0065] Inoculate MΦs cells at an appropriate density in a 6-well plate, with a medium volume of 2 mL per well. Add the PPP1R3B overexpression / interference virus concentrate (titer: 1×10 8 TU / mL, MOI = 20) and co-incubate with the cells overnight. After 24 h, change the medium, discard the original medium, and replace it with 2 mL of fresh medium. Use puromycin (2 - 5 μg / mL) to screen the transfected cells.

[0066] 2.6 Protein immunoblotting (Western blot) experiment and grouping

[0067] Detect the PPP1R3B protein expression level by Western blot experiment (including gel preparation / sample loading / electrophoresis / electroblotting / blocking) to analyze the transfection efficiency. The relevant primary antibodies are as follows: anti-PPP1R3B antibody (ab235049, 1:1000; Abcam), anti-Arg-1 (16001-1-AP, 1:1000; Proteintech), anti-iNOS (ab178945, 1:1000; Abcam), anti-CD206 (18704-1-AP, 1:1000; Proteintech), and β-actin (sc-8432, 1:1000; SantaCruz Biotechnology). Subsequently, add the corresponding secondary antibody (horseradish peroxidase-labeled) of the same species and incubate for 30 - 60 min. Wash 3 times with TBST solution, and after exposure, use ImageJ to measure the expression of the relevant proteins.

[0068] As shown in the experimental results Figure 1 The knockdown efficiency of the PPP1R3B interference virus (sh-PPP1R3B in Group Ⅴ) was 55.44%; the overexpression efficiency of the PPP1R3B overexpression virus (ov-PPP1R3B in Group Ⅵ) was 71.36%, demonstrating that lentivirus transfection can achieve the expected interference or overexpression effect.

[0069] Using β-actin as the control group, when comparing M0 or M1 type MΦs, there were significant differences in the expression level of PPP1R3B in M2 type MΦs. The expressions of iNOS and CD206 macrophage markers were used to determine different phenotypic MΦs. According to different inductions of lentivirus overexpression or interference, LPS (100 ng / mL) / IL-4 (20 ng / mL), it was specifically divided into 9 groups, including GroupⅠ M0, GroupⅡ M1, GroupⅢ M2, GroupⅣ sh-M0, GroupⅤ sh-M1, GroupⅥ sh-M2, GroupⅦ ov-M0, GroupⅧ ov-M1, GroupⅨ ov-M2. Among them, groups Ⅰ, Ⅱ, and Ⅲ established different induction expressions of macrophages, and under M2 type induction, the expression of PPP1R3B was up-regulated. Groups Ⅳ, Ⅴ, and Ⅵ constructed cell models with PPP1R3B knockdown and overexpression, and preliminarily verified that overexpression of PPP1R3B contributed to the expression of M2 type MΦs.

[0070] 2.7 Flow cytometry of cell lines

[0071] Obtain cell pellets according to the grouping in 2.6, add FCR block (1 μg / test; 101319; BioLegend) and incubate for 5 - 10 min for blocking. Then stain with AF488 anti-mouse F4 / 80 (1 μg / test, 123119, BioLegend), PerCP-Cy5.5 anti-mouse CD11b (0.25 μg / test, 101227, BioLegend), and PE anti-mouse CD86 (1 μg / test, 105007, BioLegend) at 4 °C for 30 min. Wash the cells 2 - 3 times with PBS, and fix the cells with cell fixation buffer (500 μL, 420801, BioLegend) in the dark at room temperature for 30 min. Centrifuge at 150 ×g for 5 min to discard the fixing solution, add 2 mL of 1× intracellular staining permeabilization wash buffer (421002, BioLegend) to resuspend the cells, centrifuge at 150×g for 5 min and discard the supernatant, and repeat the above steps 2 - 3 times. Resuspend the cells in 100 μL of 1× intracellular staining permeabilization wash buffer, add CD206 antibody (0.5 μg / tests, 141707, BioLegend), and incubate in the dark at room temperature for 30 min. After incubation, wash the cells 2 - 3 times with 2 mL of 1× intracellular staining permeabilization wash buffer, add 500 μL of cell staining buffer to resuspend the cells, and place the cells on a flow cytometer. Finally, analyze the data using FlowJo software (TreeStar Inc.).

[0072] The experimental results are asFigure 2 As shown, flow cytometry confirmed that overexpression of PPP1R3B in MΦs significantly promoted M2 polarization but inhibited M1 polarization.

[0073] 2.8 Glycogen staining

[0074] After cell transfection was completed, 70% ethanol was added for fixation for 10 min. 500 μL of periodic acid solution was added dropwise to each well. After reacting in the dark in a wet box for 10 min, the periodic acid solution was removed, and the cells were immersed in distilled water and placed on a shaker for washing for 5 min. The washing solution was aspirated, 500 μL of Schiff reagent was added dropwise to each well, placed in a wet box, and incubated at 37 °C in the dark for 1 h. The staining solution was removed, and the cells were immersed in distilled water and placed on a shaker for washing for 5 min. Observation was carried out under an inverted fluorescence microscope.

[0075] The experimental results were as Figure 3 shown, overexpression of PPP1R3B significantly depleted glycogen accumulation in MΦs, while knockdown of PPP1R3B significantly increased glycogen accumulation in MΦs.

[0076] 2.9 Oil Red O staining of cells

[0077] Cells in different groups were incubated with human oxidized low-density lipoprotein (ox-LDL, Yeasen Biotechnology Co., Ltd., 25 μg / mL) for 24 h, and then Oil Red O staining was used to evaluate cell morphological changes and foam cell formation.

[0078] The cell seeding density in 6-well culture plates was 5×10 4 cells / well. The supernatant was aspirated, and the cells were rinsed three times with PBS, then fixed with 4% paraformaldehyde for 15 min, rinsed twice with PBS, an appropriate amount of staining washing solution was added to cover the cells for 20 s, the staining washing solution was aspirated, 1 mL of Oil Red O staining working solution was added to each well, and stained for 10 - 20 min. The Oil Red O staining working solution was removed, an appropriate amount of staining washing solution was added, and left standing for 30 s. Then the staining washing solution was removed, and the cells were washed with PBS for 20 s. An appropriate amount of PBS was added to evenly cover the cells, and observation and photography were carried out under an inverted fluorescence microscope.

[0079] The experimental results were as Figure 4 shown, Oil Red O (ORO) staining showed that overexpression of PPP1R3B significantly enhanced lipid efflux from foam cells, while knockdown of PPP1R3B had the opposite effect.

[0080] 2.10 Mitochondrial membrane potential staining experiment (JC-1)

[0081] According to a density of approximately 5×10 4Seed cells at a density of [number] cells / well in a 6-well plate and wait for them to adhere. Aspirate the culture medium, wash the cells twice with PBS, add 1 mL of cell culture medium and 1 mL of JC-1 staining working solution (vortex to fully dissolve and mix). Incubate in a cell culture incubator at 37 °C, 5% CO₂ and saturated humidity for 20 min. After incubation, aspirate the supernatant and wash twice with JC-1 staining buffer. Add 2 mL of cell culture medium and observe under a laser confocal microscope.

[0082] The experimental results are as Figure 5 shown. The JC-1 aggregated fluorescence (red) in the M2-type MΦ polarization group and the PPP1R3B overexpression group was enhanced, indicating that overexpression of PPP1R3B increased the mitochondrial membrane potential of M2-type MΦs. Conversely, knocking out PPP1R3B decreased the mitochondrial membrane potential of M1-type MΦs.

[0083] 2.11 Immunofluorescence staining of tissue sections

[0084] Use frozen sections of human atherosclerotic plaques and adjacent normal vascular tissues for staining to detect the expression of relevant markers. The frozen sections are fixed with 4% paraformaldehyde, blocked with 5% BSA at room temperature for 30 min, and incubated with the primary antibody at 4 °C for 12 h. The negative control is the same IgG with the same concentration as the primary antibody. The sections are incubated with the fluorescent secondary antibody in the dark at 37 °C for 30 min and finally stained with DAPI. The sections are observed under a laser confocal microscope.

[0085] The experimental results are as Figure 6 shown. By immunohistofluorescence staining, the expression and localization of PPP1R3B in human atherosclerotic plaques and adjacent normal vascular tissues were detected. PPP1R3B was mainly co-localized with the M2-type MΦ biomarker CD206, while it had little correlation with the endothelial cell biomarker CD31, the smooth muscle cell biomarker α-SMA, and the M1-type MΦ biomarker CD86.

[0086] Example 3 Animal experiments

[0087] 3.1 Animal cultivation

[0088] All animal care and experimental procedures were approved by the Animal Policy and Welfare Committee of Wenzhou Medical University. The experimental animals used in this study were all SPF (Specific Pathogen Free) grade male ApoE - / - C57BL / 6 mice, purchased from Shanghai Slac Laboratory Animal Co., Ltd., China.

[0089] All mice were housed in a 12:12 hour light - dark cycle system with a constant room temperature and fed a standard rodent diet. These animals had been acclimated to the laboratory environment for at least 2 weeks before the start of the study. All animal experiments followed the principle of blinding. Male ApoE mice at 4 - 6 weeks of age - / - The HFD diet formula for mice was: 40 kcal% fat, 20 kcal% protein, 40 kcal% carbohydrates, and 1.25% cholesterol for 16 weeks. After the model was established, groups were randomly selected, with 3 mice in each group, and the specific treatments were as follows:

[0090] Experimental group: HFD + injection of PPP1R3B over - expression virus concentrate (dose = 5×10 11 vg, made into a 150 μl solution with normal saline);

[0091] Control group: HFD + injection of an equal volume of normal saline;

[0092] Injection method: Intravenous injection into the tail vein (the virus was injected into the tail vein, and subsequent stat3 agonists were injected intraperitoneally), single injection.

[0093] All mice were fed HFD for a total of 16 weeks. Body weight was recorded once a week. At the 16th week, all mice were sacrificed under pentobarbital sodium anesthesia, and blood samples were collected. The aorta was fixed in 4% paraformaldehyde or quickly frozen in liquid nitrogen.

[0094] 3.2 Flow cytometry of aortic tissue suspension

[0095] The aortic samples were prepared into aortic tissue suspensions through steps such as pulverization, digestion, separation, and filtration. At 4°C, the aortic single-cell suspension was centrifuged and the supernatant was removed. FCR block (1 μg / test; 101319; BioLegend) was added and incubated for 5 - 10 min for blocking. Then, AF488 anti-mouse F4 / 80 (1 μg / test, 123119, BioLegend), PerCP-Cy5.5 anti-mouse CD11b (0.25 μg / test, 101227, BioLegend), and PE anti-mouse CD86 (1 μg / test, 105007, BioLegend) were used for staining at 4°C for 30 min. The cells were washed with PBS 2 - 3 times, and then fixed with cell fixation buffer (500 μL, 420801, BioLegend) in the dark at room temperature for 30 min. After centrifuging at 150 ×g for 5 min to discard the fixing solution, 2 mL of 1× intracellular staining permeabilization washing buffer (421002, BioLegend) was added to resuspend the cells. After centrifuging at 150×g for 5 min to discard the supernatant, the above steps were repeated 2 - 3 times. The cells were resuspended with 100 μL of 1× intracellular staining permeabilization washing buffer, and CD206 antibody (0.5 μg / tests, 141707, BioLegend) was added and incubated in the dark at room temperature for 30 min. After incubation, the cells were washed with 2 mL of 1× intracellular staining permeabilization washing buffer 2 - 3 times, and then resuspended with 500 μL of cell staining buffer. The cells were placed on a flow cytometer. Finally, the data were analyzed using FlowJo software (Tree Star Inc.).

[0096] The experimental results are as Figure 7 shown. Flow cytometry of the plaque tissues of PPP1R3B overexpression mice showed a higher proportion of M2-type MΦs (Ctrl = 27.367 ± 1.600%, AAV-PPP1R3B = 49.467 ± 5.254, p<0.01).

[0097] 3.3 Oil Red O staining of ex vivo aorta

[0098] An Oil Red O staining working solution was prepared at a ratio of Oil Red O solution to Oil Red O diluent of 3:2. After mixing and standing, the precipitate was filtered through a 0.45 µm needle filter and set aside. The aorta was longitudinally incised from the aortic arch to the iliac vessels with the intima facing outwards, soaked in the Oil Red O staining working solution for 30 min, decolorized with 80% isopropanol at room temperature for 30 s, and finally washed with PBS for 5 min. The scope of aortic plaque was evaluated by gross Oil Red O staining. ImageJ software was used to quantify the lesion area of the vascular intima.

[0099] The experimental results are asFigure 8 As shown in the representative Oil Red staining images of the aortas of atherosclerotic mice, grossly (Ctrl = 20.455 ± 2.797%, AAV-PPP1R3B = 9.059 ± 0.667%, p<0.01); in cross-section (Ctrl = 3.403 ± 0.394%, AAV-PPP1R3B = 0.385 ± 0.085% p<0.001), indicating that overexpression of PPP1R3B helps to promote lipid excretion and inhibit foam cell formation. Compared with the control group, the plaque area in the PPP1R3B overexpression group was reduced by approximately 55.71%.

[0100] 3.4 Glycogen staining of isolated aorta

[0101] Take aortic frozen sections, wash with distilled water for 2 min, fix with 70% ethanol for 10 min, and wash off the fixative with distilled water. Add 500 μL of periodic acid solution to each sample, react in the dark in a wet box for 10 min, then remove the periodic acid solution, soak in distilled water and place on a shaker for washing for 5 min. Aspirate the washing solution, add 500 μL of Schiff reagent to each well, place in a wet box, and incubate at 37 °C in the dark for 1 h. Remove the staining solution, soak in distilled water and place on a shaker for washing for 5 min.

[0102] The results are as Figure 9 shown in the representative PAS staining images of the cross-sections of the aortas of atherosclerotic mice (Ctrl = 17.407 ± 0.966, AAV-PPP1R3B = 6.827 ± 0.627 p<0.0001), indicating that overexpression of PPP1R3B helps to promote glycogen consumption and enhance cell activity.

[0103] 3.5 Overexpression virus transfection

[0104] Select aortic samples with atherosclerotic plaques to prepare sections, and stain with DAPI according to the method in 2.11 of Example 2. Observe the sections under a laser confocal microscope.

[0105] The experimental results are as Figure 10 shown. Fluorescence of the overexpression virus transfected aorta indicates successful transfection, and the PPP1R3B overexpression experimental group inhibited plaque formation.

[0106] 3.6 H&E staining

[0107] All mice were euthanized by anesthesia with sodium pentobarbital at 16 weeks of age. The entire aorta was excised, and the surrounding fat and connective tissue were carefully removed. Then, it was fixed in 4% PFA overnight at 4°C and then embedded in paraffin. Finally, sections with a thickness of 5 - 10 µm were prepared and stained with H&E for histological examination.

[0108] Example 4 Animal Experiment of Combining STAT3 Agonist with Overexpression of PPP1R3B

[0109] 4.1 Animal Culturing and Experiment

[0110] To further enhance the therapeutic effect of PPP1R3B overexpression on atherosclerotic plaques, a combined STAT3 agonist regimen was further designed to verify its effect. The animal model was established with reference to the method in 3.1 of Example 3. The specific treatments were as follows:

[0111] Experimental group: HFD + injection of PPP1R3B overexpression virus concentrate (dose = 5×10 11 vg, formulated into a 150 - µl solution with normal saline);

[0112] Combined experimental group: HFD + injection of PPP1R3B overexpression virus concentrate (dose = 5×10 11 vg) + intraperitoneal injection of STAT3 agonist 1 at a dosage of 20 mg / kg;

[0113] Control group: HFD + injection of an equal volume of normal saline;

[0114] All mice were fed with HFD for a total of 16 weeks. The body weight was recorded once a week. At the 16th week, all mice were sacrificed under sodium pentobarbital anesthesia, and blood samples were collected. The aorta was fixed in 4% paraformaldehyde or quickly frozen in liquid nitrogen.

[0115] 4.2 H&E Staining

[0116] The aortic plaque samples were sectioned and stained with reference to the method in 3.6 of Example 3. The experimental results are as Figure 11 shown. The plaque area in the AAV - PPP1R3B group was reduced by 73.5% compared with the control group. After adding the STAT3 agonist, the H&E results showed that the plaque area was reduced by approximately 85.2%.

[0117] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. Use of a reagent for upregulating the expression level of PPP1R3B gene in the preparation of a drug for treating atherosclerosis, characterized in that: The reagent for upregulating the expression level of the PPP1R3B gene is a PPP1R3B overexpression lentivirus prepared by co-transfection of a PPP1R3B overexpression vector and a packaging plasmid.

Images