Application of PHGDH in disseminated tumor cell typing and prediction, screening and identification of immune escape disseminated tumor cells

Abstract

The invention relates to a novel marker phosphoglycerate dehydrogenase (PHGDH) and an application of the PHGDH as a disseminated tumor cell biomarker. In particular to application of PHGDH as a biomarker or a substance for detecting the PHGDH as the biomarker in preparation of products for detecting the PHGDH level in a sample obtained from an object to carry out disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, tumor metastasis colonization prediction and / or cancer treatment prognosis evaluation, and corresponding products and methods.

Description

Technical Field

[0001] The present application relates to the field of tumor / cancer biology. More specifically, the present application relates to a novel biomarker phosphoglycerate dehydrogenase (PHGDH) and its use in preparing products for detecting the level of PHGDH in a sample obtained from a subject for disseminated tumor cell (DTC) typing, tumor metastasis colonization prediction, immune escape DTC screening and / or identification and / or cancer treatment prognosis assessment, as well as corresponding products and methods. Background Art

[0002] Most cancer-related deaths occur due to metastasis, which is the spread of cancer cells from the primary tumor site to distant organs, i.e. the growth of cancer cells in organs far away from their organ of origin. Metastasis is the cause of most cancer-related deaths and is the final and most lethal manifestation of cancer. The vast majority of cancer patients die from the consequences of their metastatic disease, not the primary tumor.

[0003] Take hepatocellular carcinoma (hereinafter referred to as liver cancer and / or HCC) as an example. As a malignant tumor with the highest incidence and mortality rate in my country, most patients are already in the middle and late stages when they are discovered. Especially in the late stage, patients often have distant metastases such as lung, bone or brain, which are difficult to treat and have a very poor prognosis. The metastasis process of liver cancer mainly includes dissemination, entry into the blood circulation and distant colonization. First, some tumor cells of the primary tumor infiltrate into the proximal blood vessels or lymphatic vessels, and then spread through the blood or lymphatic vessels as circulating tumor cells (CTC). Due to physical, biochemical and immune stressors, the number of CTCs is greatly reduced. After CTCs reach distant organs, they are retained in the capillary bed of distant organs, and finally extravasate and migrate to the organ parenchyma as disseminated tumor cells (DTCs), completing the colonization and metastasis of tumor cells. Similarly, for breast cancer, although the survival rate of patients with early breast cancer has improved, distant recurrence is still the main cause of high mortality and is generally considered incurable. Studies have shown that up to 75% of breast cancer patients may carry micrometastases at the time of diagnosis, and metastatic recurrence often occurs years or even decades after treatment. Existing literature has reviewed the clinical and biological aspects of DTC and dormancy in breast cancer, pointing out that during clinical latency, DTCs can enter a cell cycle arrest or dormancy state at distant sites and may be shielded by immune detection and treatment (see, for example, Ring A, Spataro M, Wicki A, Aceto N. Clinical and Biological Aspects of Disseminated Tumor Cells and Dormancy in Breast Cancer Front Cell Dev Biol. 2022; 10: 929893).

[0004] Currently, the methods used in clinical practice to predict patient metastasis mainly include the detection of CTC, circulating tumor DNA (ctDNA), circulating free nucleic acid (cfDNA) and exosomes. However, these methods lack specific identification of disseminated tumor cells (DTCs), and therefore have poor warning effects on distant metastasis of cancer (such as liver cancer).

[0005] At present, WO2011150256A2 discloses the use of the number of copies of the phosphoglycerate dehydrogenase (PHGDH) gene in a biological sample in a method for diagnosing a cell proliferative disorder in a subject or assigning a prognostic risk of a cell proliferative disorder in a subject; WO2017009261A1 discloses the use of PHGDH as a biomarker to detect epithelial-mesenchymal transition (EMT) in a subject; CN115969975A discloses the use of PHGDH as a target in the preparation of a drug for preventing and / or treating colorectal cancer metastasis; EP2669682A1 uses PHGDH as one of many biomarkers to predict the prognosis (recurrence or progression) of tumors in breast cancer patients. In addition, a previous document on breast cancer disclosed that human primary tumors that uniformly express higher levels of PHGDH may grow faster than tumors that express heterogeneous or low levels of PHGDH, but are less likely to metastasize. The presence of PHGDH-low expressing cancer cells in primary tumors indicates a poor prognosis. PHGDH expression is reduced in circulating tumor cells (CTCs) and early metastatic cells, that is, low expression of PHGDH in primary tumors often indicates susceptibility to distant metastasis of breast cancer; and compared with primary tumors, the expression level of PHGDH protein on CTCs is significantly reduced (see Rossi, Matteo et al. "PHGDH heterogeneity potentiates cancer cell dissemination and metastasis." Nature vol. 605, 7911 (2022): 747-753.).

[0006] In summary, there are no research reports or related technologies on phosphoglycerate dehydrogenase (PHGDH) as a new biomarker for disseminated tumor cells (DTC) typing and prediction, diagnosis, screening and identification of immune escape disseminated tumor cells at home and abroad. In fact, until the research of the inventors of the present application, the relationship between PHGDH and disseminated tumor cells (DTC) has not been found, and there is no evidence that PHGDH can be used as a molecular marker for immune escape DTC, and samples obtained from subjects are used for disseminated tumor cell (DTC) typing, tumor metastasis colonization prediction, immune escape DTC screening and / or identification and / or cancer treatment prognosis evaluation.

[0007] Therefore, considering the current limitations and urgency of tools for predicting metastasis in tumor patients, there is an urgent need to find new biomarkers and their applications that can be effectively used for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, tumor metastasis and colonization prediction and / or cancer treatment prognosis assessment, so as to make systemic treatments such as targeted therapy and immunotherapy for distant metastasis of cancer (such as liver cancer) more targeted and provide patients with more personalized targeted treatments. Summary of the invention

[0008] This article provides a novel biomarker, phosphoglycerate dehydrogenase (PHGDH), which can be used for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, tumor metastasis and colonization prediction and / or cancer treatment prognosis assessment.

[0009] In some aspects of the present invention, there is provided the use of phosphoglycerate dehydrogenase (PHGDH) as a biomarker in the preparation of a product for detecting the level of PHGDH in a sample obtained from a subject for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis assessment.

[0010] In some aspects of the present invention, there is provided the use of a substance for detecting PHGDH as a biomarker in the preparation of a product for detecting the level of PHGDH in a sample obtained from a subject for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis assessment.

[0011] In some embodiments, the disseminated tumor cell (DTC) typing herein includes the DTC typing including immune escape DTC or non-immune escape DTC according to the PHGDH level in the sample obtained from the object. In some embodiments, the immune escape DTC screening and / or identification herein includes screening and / or identifying immune escape DTC according to the PHGDH level in the sample obtained from the object. In some embodiments, the cancer metastasis colonization prediction herein includes predicting the possibility of cancer metastasis colonization in the object according to the PHGDH level in the sample obtained from the object. In some embodiments, the cancer treatment prognosis assessment herein includes assessing the object suffering from cancer and having received treatment as having a good prognosis for treatment or a poor prognosis according to the PHGDH level in the sample obtained from the object. In some cases, the object suffering from cancer and having received treatment is, for example, an object suffering from primary cancer and having received treatment for the primary cancer and / or an object suffering from primary cancer and having received treatment for the primary cancer and receiving preventive treatment for cancer metastasis.

[0012] In some embodiments, the disseminated tumor cell (DTC) typing herein includes: typing the DTC as immune escape DTC or non-immune escape DTC based on the PHGDH level in the sample obtained from the subject, wherein if the PHGDH level is higher than the reference level, the DTC is typed as immune escape DTC, and if the PHGDH level is lower than the reference level, the DTC is typed as non-immune escape DTC.

[0013] In some embodiments, the screening and / or identification of immune escape DTCs herein includes: screening and / or identifying DTCs as immune escape DTCs based on the PHGDH level in a sample obtained from the subject, wherein if the PHGDH level in the sample obtained from the subject is higher than a reference level, the DTCs in the sample are identified as immune escape DTCs or immune escape DTCs are screened out accordingly.

[0014] In some embodiments, the prediction of cancer metastasis and colonization herein includes: predicting the possibility of cancer metastasis and colonization in the sample obtained from the subject based on the PHGDH level in the sample, wherein if the PHGDH level is higher than the reference level, the subject is prone to cancer metastasis and colonization; and if the PHGDH level is lower than the reference level, the subject is not prone to cancer metastasis and colonization.

[0015] In some embodiments, the cancer treatment prognosis assessment herein includes: assessing a subject suffering from cancer and having received treatment as having a good prognosis or a poor prognosis according to the PHGDH level in a sample obtained from the subject, wherein the subject is assessed to have a poor prognosis if the PHGDH level is higher than the reference level; and the subject is assessed to have a good prognosis if the PHGDH level is lower than the reference level. In some cases, the subject suffering from cancer and having received treatment is, for example, a subject suffering from primary cancer and having received treatment for the primary cancer and / or a subject suffering from primary cancer and having received treatment for the primary cancer and receiving preventive treatment for cancer metastasis.

[0016] In some embodiments, the PHGDH level herein is measured by the gene expression level, protein expression level and / or protein activity level of PHGDH. In some cases, the gene expression level of PHGDH herein includes nucleic acid expression level or mRNA expression level.

[0017] In some embodiments, the nucleic acid expression level herein is determined by Western blotting, quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR), RNA-Seq, multiplex qPCR or RT-qPCR, microarray analysis, SAGE, MassARRAY technology, in situ hybridization (e.g., FISH), and the like.

[0018] In some embodiments, the mRNA expression level herein is determined by real-time quantitative PCR (qRT-PCR), RNA-Seq, PCR, qPCR, RT-PCR, in situ hybridization, gene expression profiling, gene expression serial analysis, microarray analysis, etc. In some preferred embodiments, the PHGDH level herein is preferably the mRNA expression level determined by qRT-PCR. In some more preferred embodiments, the mRNA expression level is determined by real-time quantitative PCR (qRT-PCR) with a forward primer of ATGGCCTTCGCAAATCTGC (SEQ ID NO: 4) and a reverse primer of AGTTCAGCTATCAGCTCCTCC (SEQ ID NO: 5) as the PHGDH expression herein.

[0019] In some embodiments, the protein expression level and / or protein activity level of PHGDH herein are determined by mass spectrometry (MS), reverse transcriptase-polymerase chain reaction (RT-PCR), microarray analysis, gene expression serial analysis (SAGE), gene expression analysis by massive parallel feature sequencing (MPSS), immunoassay (e.g., ELISA), immunohistochemical staining (IHC), transcriptomics and proteomics techniques. In some preferred embodiments, the protein expression level and / or protein activity level of PHGDH herein are determined by immunohistochemical staining (IHC), for example, immunofluorescence, radioimmunoassay, immunoenzyme labeling, immunogold and silver method, preferably by immunoenzyme labeling. In some particularly preferred embodiments, the protein expression level and / or protein activity level of PHGDH are determined by direct detection using PHGDH antibodies (e.g., PHGDH antibodies of catalog number #ab240744 from Abcam) as PHGDH expression herein. In some preferred embodiments, the protein expression level and / or protein activity level of PHGDH is determined by immunohistochemical staining (IHC) scoring, wherein the PHGDH immunohistochemical staining (IHC) score = immunohistochemical staining intensity score × immunohistochemical staining area score; wherein the immunohistochemical staining intensity score is: no staining is 0 points, light brown is 1 point, brown is 2 points, and dark brown is 3 points; the immunohistochemical staining area score (the ratio of tumor cell positive staining area to the total tumor cell area) is: no positive staining is 0 points, <25% is 1 point, ≥25 to <50% is 2 points, ≥50 to <75% is 3 points, and ≥75% is 4 points.

[0020] In some embodiments, the PHGDH level in the sample obtained from the subject herein is the median value, mean value or standard value determined by statistical methods of the gene expression level, protein expression level and / or protein activity level measured in the sample obtained from the subject.

[0021] In some embodiments, the reference level herein is (1) the median, mean or standard value determined by statistical methods of the gene expression level, protein expression level and / or protein activity level of PHGDH in a sample obtained from the subject at a previous time point; (2) the median, mean or standard value determined by statistical methods of the gene expression level, protein expression level and / or protein activity level of PHGDH in a reference population; or (3) a pre-specified PHGDH level, for example, a pre-specified immunohistochemistry (IHC) score value.

[0022] In some embodiments, the PHGDH level in the sample obtained from the subject herein is higher than the reference level, including the median value, mean value or standard value determined by statistical methods of the gene expression level, protein expression level and / or protein activity level of PHGDH in the sample obtained from the subject relative to PHGDH in the sample obtained from the subject at a previous time point.

[0023] In some embodiments, the PHGDH level in the sample obtained from the subject herein is higher than the reference level, including that the PHGDH level in the sample obtained from the subject is increased by about 1% or more or increased by about 1-fold or more relative to the median value, mean value, or standard value determined by statistical methods of the gene expression level, protein expression level, and / or protein activity level of PHGDH in a reference population; and / or

[0024] In some embodiments, the PHGDH level in the sample obtained from the subject herein is higher than the reference level, including that the PHGDH level in the sample obtained from the subject is higher than a pre-specified PHGDH level value, for example, a pre-specified immunohistochemistry staining (IHC) score value; preferably, the immunohistochemistry staining (IHC) score is 6.

[0025] In some embodiments, the PHGDH herein is a substance selected from the group consisting of genomic DNA, cDNA, mRNA, protein of PHGDH, or a functional fragment of any of the foregoing.

[0026] In some embodiments, the PHGDH herein includes a molecule having the following sequence: (a) a genomic DNA having a sequence such as that shown in SEQ ID NO: 1 or a functional fragment thereof; (b) mRNA having a sequence such as that shown in SEQ ID NO: 2 or a functional fragment thereof; (c) a PHGDH protein having a sequence such as that shown in SEQ ID NO: 3 or a functional fragment thereof; (d) A molecule or a functional fragment thereof having a sequence homology or identity of more than 70% with any one of (a) to (c) and capable of indicating the level of PHGDH in a sample.

[0027] In some embodiments, the subject herein is a mammal, such as a human, a non-human primate (e.g., an orangutan, ape), a rodent (e.g., a rat, a mouse, a guinea pig), a pet (e.g., a cat, a dog), a livestock (e.g., a horse, a cow, a sheep, a pig, a rabbit); and / or

[0028] In some embodiments, the subject of the present invention is selected from: a subject suspected of having primary cancer; a subject suffering from primary cancer but not yet receiving treatment for primary cancer; a subject suffering from primary cancer and having received treatment for primary cancer; a subject suffering from primary cancer and having received treatment for primary cancer, but not yet receiving preventive treatment for cancer metastasis; a subject suffering from primary cancer and having received treatment for primary cancer and receiving preventive treatment for cancer metastasis; or a subject with one or more of the foregoing conditions; preferably a subject suspected of having metastatic colonization based on previous medical history and imaging examination results (e.g., CT, MRI, etc.).

[0029] In some embodiments, the sample herein can be selected from: tissue obtained from the subject, such as fresh samples, frozen samples, fixed samples (such as formalin-fixed samples, paraffin-embedded samples); preferably, biopsy tissue suspected of metastasis and colonization based on the subject's previous medical history and imaging examination results (e.g., CT, MRI, etc.).

[0030] In some embodiments, the object herein suffers from primary cancer. In some embodiments, the object herein suffers from hepatocellular carcinoma, cholangiocarcinoma, prostate cancer, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous carcinoma, peritoneal cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer or uterine cancer, salivary gland cancer, kidney cancer, vulvar cancer, thyroid cancer, gastric cancer, melanoma or cervical cancer; preferably hepatocellular carcinoma, breast cancer, colorectal cancer, lung adenocarcinoma. In some embodiments, the object described herein suffers from primary cancer and suffers from suspected cancer metastasis caused by primary cancer and / or is in the risk of suspected cancer metastasis caused by primary cancer, for example, primary cancer caused by lung (e.g. liver cancer lung metastasis), bone, brain or lymph node (e.g. liver cancer lymph node metastasis) metastasis.

[0031] In some embodiments, the product herein can be a combination of a kit or a reagent and a detection device. In some embodiments, the product herein comprises a reagent, apparatus and / or device for determining the level of PHGDH in a sample, for example, the reagent for determining the level of PHGDH in the sample includes one or more selected from the following group: a probe, a gene chip, a primer, an antibody, a protein chip, a chemical small molecule with detection specificity for PHGDH. In some embodiments, the product herein is used to determine the level of PHGDH in a sample by including but not limited to the following methods: real-time quantitative reverse transcription PCR, biochip detection method, Southern blotting, Northern blotting in situ hybridization, immunofluorescence, immunohistochemical staining (e.g., immunoenzyme labeling), or Northern blotting or in situ hybridization. In some embodiments, the reagent for determining the level of PHGDH in a sample herein is directly or indirectly labeled with a detectable label, for example, the detectable label is selected from: a radioisotope, a fluorescent group, a chemiluminescent moiety, an enzyme, an enzyme substrate, an enzyme cofactor, an enzyme inhibitor, a dye, a metal ion or a ligand.

[0032] In some aspects of the present invention, a product is provided for performing disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis assessment by detecting the PHGDH level in a subject sample (e.g., a sample, cell and / or tissue to be tested, for example, a sample, cell and / or tissue of a subject suspected of metastasis and colonization based on previous medical history and imaging examination results (e.g., CT, MRI, etc.). In some embodiments, the product comprises reagents, equipment and / or devices for detecting the PHGDH level in the sample. In some embodiments, the product comprises one or more contents as described in detail herein.

[0033] In some aspects herein, products (eg, kits) are provided for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, tumor metastasis colonization prediction, and / or cancer treatment prognosis assessment.

[0034] In some aspects of the present invention, a method for performing disseminated tumor cell (DTC) typing, tumor metastasis colonization prediction, immune escape DTC screening and / or identification, and / or cancer treatment prognosis evaluation on a sample is provided. In some embodiments, the method comprises: determining the PHGDH level in a sample obtained from a subject; comparing the PHGDH level in the sample obtained from the subject with a reference level, and performing disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis evaluation on the subject according to the PHGDH level in the sample obtained from the subject.

[0035] In some aspects of the present invention, a system is provided, which includes: a module for obtaining the PHGDH level in a sample of an object; a module for analyzing the PHGDH level in a sample obtained from an object (e.g., a module for comparing the PHGDH level in a sample obtained from an object with a reference level); and a module for performing disseminated tumor cell (DTC) typing, tumor metastasis colonization prediction, immune escape DTC screening and / or identification, and / or cancer treatment prognosis assessment on the object; an analysis result output and / or storage module. In some embodiments, the system may also optionally include one or more modules selected from the following group: a module for collecting or receiving samples of an object; a module for detecting the PHGDH level in a sample; a module for inputting, comparing, storing, and / or outputting PHGDH levels; a local, remote, or cloud data storage, reading, and / or analysis module.

[0036] Those skilled in the art may arbitrarily combine the technical solutions and technical features described herein without departing from the inventive concept and protection scope of the present invention. Other aspects of the present invention are obvious to those skilled in the art due to the disclosure of this article. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The present invention will be further described below in conjunction with the accompanying drawings, wherein these drawings are only for illustrating the embodiments of the present invention rather than for limiting the scope of the present invention.

[0038] Figure 1 : Definition of tumor microenvironment (TME) units, where a 50 × 50 μm area surrounding a tumor cell determined based on spatial transcriptomic data is defined 2 The area is defined as a TME unit, and a TME unit is further divided into 25 10 × 10 μm 2 The area is defined as 10 × 10 μm in the center 2 Regions are defined as points where tumors are located.

[0039] Figure 2A : Pseudo-temporal analysis was performed on all tumor cells. The Monocle2 R package was used to determine the pseudo-temporal differentiation trajectories and transcriptome dynamics characteristics of all tumor cells collected at different sampling time points. The pseudo-temporal analysis results automatically generated by the R package were used to divide the tumor cells into stages 1 to 4 along the pseudo-temporal axis, namely Phase 1-4.

[0040] Figure 2B : For the unsupervised clustering of TME units of all samples, the single-cell dimensionality reduction and clustering method was used to divide the TME units into 1 to 4 clusters along the pseudo-time axis, namely Cluster 1-Cluster 4.

[0041] Figure 3: The relationship between the changes in tumor cell gene expression along the pseudo-temporal axis and the cell populations in the TME unit on the timeline found that tumor cell staging and TME unit clustering were synchronized on the timeline, suggesting that tumor cells and the immune microenvironment co-evolve during the process of liver cancer metastasis and colonization.

[0042] Figure 4: The percentage of tumor cells and the number of stage 3 tumor cells at each time point (T1 (0.25 hours), T2 (1 hour), T3 (4 hours), T4 (12 hours), T5 (24 hours), T6 (2 days), T7 (8 days), T8 (21 days) and T9 (35 days)). Figure 4A The proportion of stage 3 tumor cells to all tumor cells and the proportion of all tumor cells to all cells at each time point are shown; wherein the left Y-axis represents the proportion of the number of tumor cells with stage 3 tumor cell characteristics detected in the mouse lung tissue obtained at each sampling time point to the number of all tumor cells at the sampling time point; the right Y-axis represents the proportion of the number of all tumor cells in the mouse lung tissue obtained at each sampling time point to the total number of cells. Figure 4B The number of stage 3 tumor cells at each time point is shown; wherein the Y-axis represents the absolute value of the number of tumor cells with the characteristics of stage 3 tumor cells detected in the mouse lung tissue obtained at each sampling time point.

[0043] Figure 5 : Differential expression gene analysis between Phase 3 tumor cells and other tumor cells, wherein the x-axis is Log2 (fold change) and the y-axis is -log10 (adjusted p-value). This differential expression gene analysis for many genes showed that PHGDH was most significantly upregulated in Phase 3 tumor cells (t-test). PHGDH expression overlapped more with Phase 3 tumor cells, so Phase 3 tumor cells were defined as PHGDH+ tumor cells.

[0044] Figure 6 : Pathway analysis of PHGDH+ tumor cells, where the x-axis is -log10 (adjusted p-value) and the y-axis is cell proliferation and immune response-related pathways. The results of this pathway analysis found that PHGDH+ tumor cells were significantly downregulated in cell proliferation and immune response-related pathways (t-test; NS represents no significant difference, * represents p<0.05, ** represents p<0.01, *** represents p<0.001).

[0045] Figure 7 : Immune cells in the TME of tumor cells. The results showed that the infiltration of immune cells in the TME units around PHGDH+ tumor cells was significantly reduced (t test).

[0046] Figure 8: Histochemical score (H score) of PHGDH and CD45+ immune cell infiltration in lymph node metastasis of breast cancer (BRCA), colorectal cancer (CRC), lung adenocarcinoma (LUAD) and liver cancer (HCC); PHGDH+ tumor cells were significantly enriched in micrometastasis of breast cancer (BRCA, n=3), colorectal cancer (CRC, n=4), lung adenocarcinoma (LUAD, n=4) and liver cancer (HCC, n=6) compared with macrometastasis (t-test; NS represents no significant difference, * represents p<0.05, ** represents p<0.01, *** represents p<0.001)( Fig. 8A ), and the infiltration of CD45+ immune cells was significantly reduced (t test; NS means no significant difference, * means p < 0.05, ** represents p<0.01, *** represents p<0.001)( Figure 8B ).

[0047] Figure 9: Multicolor immunofluorescence analysis of mouse lung tissue at T5 time point (sgPHGDH represents PHGDH knockout cells; sgCtrl represents control). The results showed that the immune cell infiltration around PHGDH knockout tumor cells was more than that in the control group, and the distance between the immune cells and the tumor cells was closer than that in the control group.

[0048] Fig.10 : The burden of lung metastasis (Hepa1-6 liver cancer cells, H22 liver cancer cells, MC38 colorectal cancer cells and B16-F10 melanoma cells) in mice at T8 time point (sgPHGDH represents PHGDH knockout cells; sgCtrl represents control; C57BL6 / J and BALB / C represent immune-competent mice, Nod / scid and BALB / C nude represent immune-deficient mice; t-test, NS represents no significant difference, * represents p<0.05, ** represents p<0.01, *** The results showed that in immune-competent mice, the number of lung metastases formed by PHGDH knockout tumor cells was significantly less than that of the control group, while in immunodeficient mice, there was no significant difference in the number of lung metastases formed by PHGDH knockout tumor cells and the control group.

[0049] Fig.11 : The ability of cell lines with knockdown or overexpression of PHGDH to recruit CD3+ T cells and NK cells isolated from tumor tissues in vitro (shPHGDH represents PHGDH knockdown cells; shCtrl represents control; PHGDH represents OE represents PHGDH overexpressing cells; t test, NS represents no significant difference, * represents p < 0.05, **represents p<0.01, *** Represents p<0.001). The results showed that the ability of PHGDH knockdown tumor cells to recruit T cells and NK cells was stronger than that of the control group, while the ability of PHGDH overexpression tumor cells to recruit T cells and NK cells was weaker than that of the control group.

[0050] Fig.12 : The expression levels of chemokines along the pseudo-time axis, among which the chemokine expression of PHGDH+ tumor cells (stage 3 tumor cells) was significantly lower than that of tumor cells in other stages.

[0051] Fig.13 :The activity of related transcription factors in tumor cells, among which, the activity of related transcription factors in PHGDH+ tumor cells (stage 3 tumor cells) was significantly lower than that in tumor cells of other stages.

[0052] Fig.14 :PCR and ELISA test results of mouse hepatoma cells (Hepal-6) and human hepatoma cells (Huh7). The results showed that the mRNA expression levels of Ccl20, Cxcl2, and Cxcl10 in tumor cells with PHGDH knockdown or knockout were significantly higher than those in the control group, and the secretion of CCL2, CXCL2, and CXCL10 was significantly more than that in the control group; while the mRNA expression levels of Ccl20, Cxcl2, and Cxcl10 in tumor cells with PHGDH overexpression were significantly lower than those in the control group, and the secretion of CCL2, CXCL2, and CXCL10 was significantly less than that in the control group, suggesting that PHGDH is a key factor in inhibiting the expression of chemokines in tumor cells.

[0053] Fig.15 :Mass spectrometry analysis of serine metabolites such as serine, methionine and SAM in PHGDH knockout mouse cells or PHGDH knockdown human cells. The results showed that serine metabolites such as serine, methionine and SAM were significantly reduced, while serine metabolites were significantly increased in PHGDH overexpression (sgPHGDH represents PHGDH knockout cells; sgCtrl represents the control relative to PHGDH knockout cells; shPHGDH represents PHGDH knockdown cells; shCtrl represents the control relative to PHGDH knockdown cells; PHGDH OE represents PHGDH overexpressing cells; t test, NS represents no significant difference, * represents p<0.05, ** represents p<0.01, *** represents p<0.001).

[0054] Fig.16: Multicolor immunofluorescence and digital pathology analysis of lung tissues of C57BL6 / J mice and lymph node micrometastasis samples of HCC patients at T5 time point showed that the co-expression of H3K27me3 in PHGDH+ disseminated tumor cells (DTC) was significantly increased compared with that in PHGDH- disseminated tumor cells (DTC).

[0055] Fig.17 :Single-cell epigenetic and chromatin accessibility analysis (scCPA-Tag). The results showed that the H3K27me3 modification levels of chemokines and inflammatory transcription factors such as RELA, IRF1, NFKB2 and STAT1 in PHGDH knockout tumor cells were significantly lower than those in the control group. DETAILED DESCRIPTION

[0056] After extensive and in-depth research, the inventors unexpectedly and surprisingly found for the first time that the PHGDH gene or its protein is highly expressed in disseminated tumor cells (DTC) with immune escape ability, and further confirmed through relevant experiments that PHGDH+ tumor cells are significantly enriched in micrometastatic foci, while CD45+ immune cell infiltration is significantly reduced. Therefore, PHGDH can be used as a marker for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis evaluation, thereby providing a more accurate method for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis evaluation for samples from different sources. On this basis, the present invention has been completed.

[0057] All numerical ranges provided herein are intended to clearly include all values ​​falling between the range endpoints and the numerical ranges therebetween. Features mentioned in the present invention or in the embodiments may be combined. All features disclosed in this specification may be used in combination with any form of composition, and each feature disclosed in the specification may be replaced by any alternative feature that can provide the same, equal or similar purpose. Therefore, unless otherwise specified, the disclosed features are only general examples of equal or similar features.

[0058] As used herein, “containing,” “having,” or “including” include “comprising,” “mainly consisting of,” “substantially consisting of,” and “consisting of;” “mainly consisting of,” “substantially consisting of,” and “consisting of” are subordinate concepts of “containing,” “having,” or “including.”

[0059] The numerical range herein includes its endpoints and each specific numerical point and sub-range within the numerical range. For example, 1 to 3 includes endpoints 1 and 3, specific integer numerical point 2 and non-integer numerical point therein (for example, but not limited to: 1.2, 1.5, 1.8, 2.1, 2.3, 2.4, 2.8, etc., and sub-ranges thereof (for example, but not limited to: 1 to 2, 2 to 3, 1 to 1.2, 1.5 to 1.8, etc.) Phosphoglycerate dehydrogenase (PHGDH)

[0060] Phosphoglycerate dehydrogenase (PHGDH), also known as phosphoglycerate dehydrogenase, is a key metabolic enzyme that plays a vital role in the serine biosynthesis pathway as the first rate-limiting enzyme in the synthesis of glucose-derived serine. PHGDH is responsible for catalyzing the conversion of 3-phosphoglycerate (3-PG) to 3-phosphohydroxypyruvate (3-PHP), which is the first and rate-limiting step in serine biosynthesis and plays an important role in maintaining the homeostasis of related substances in cells. Serine is a non-essential amino acid that is essential for cell proliferation and a variety of biosynthetic processes. It participates in the one-carbon metabolic pathway and promotes the biosynthesis of nucleotides, S-adenosylmethionine (SAM), reduced nicotinamide adenine dinucleotide phosphate (NADPH), and glutathione (GSH) through the transfer of one-carbon units. The reaction of 3-phosphoglycerate to 3-phosphohydroxypyruvate catalyzed by PHGDH uses NAD+ / NADH as a cofactor. PHGDH is currently known to play a role in cancer progression, and PHGDH has been found to be amplified in a considerable proportion of primary tumors, including 6% of breast cancer, 70% of estrogen receptor-negative breast tumors, and 40% of melanoma. PHGDH plays a key role in the metabolic reprogramming of cancer cells, where primary cancer cells with high expression of PHGDH have increased serine synthesis flux, thereby supporting high proliferation and tumor growth of cancer cells, where these cancer cells use PHGDH for serine synthesis. The activity of PHGDH is regulated by multiple signaling pathways, and changes in its expression and activity are closely related to a variety of biological processes, including tumor development, cell proliferation, and metabolic regulation. In addition, the heterogeneity of PHGDH expression in tumor cells is associated with tumor invasiveness and metastatic tendency, and its activity drives cancer proliferation, while the loss of PHDGH-dependent sialic acid synthesis and integrin glycosylation increases metastatic spread. A previous paper on breast cancer reported that low expression of PHGDH in primary tumors often indicates susceptibility to distant metastasis of breast cancer (see Rossi, Matteo et al. "PHGDH heterogeneity potentiates cancer cell dissemination and metastasis." Nature vol. 605, 7911 (2022): 747-753).

[0061] Currently, there is no report documenting the expression of PHGDH in disseminated tumor cells (DTCs) or their specific applications. Surprisingly and unexpectedly, the inventors of the present application found through long-term and in-depth research that one of the biological effects of PHGDH expression is that it can regulate H3K27me3-mediated DTC transcriptional silencing through SAM, inhibit chemokine expression, reduce immune cell recruitment, and promote the formation of a local immune desert microenvironment, which is beneficial to the metastasis and colonization of immune escape DTCs.

[0062] As used herein, the terms "phosphoglycerate dehydrogenase", "phosphoglycerate dehydrogenase", "PHGDH" or "PHGDH molecule" are used interchangeably and have a broad meaning, including one or more detectable PHGDH molecules present in any type of normal and tumor / cancer of a subject, such as PHGDH gene, PHGDH mRNA, PHGDH cDNA, PHGDH precursor, antisense transcript of PHGDH, miRNA of PHGDH, PHGDH polypeptide, PHGDH protein, PHGDH protein fragment, or any other active fragment or marker fragment indicating PHGDH gene expression level, polypeptide / protein expression level and / or protein activity level. In addition, the term also includes molecules obtained by modifying natural PHGDH molecules for detection purposes, such as derivative molecules obtained by fragmentation, labeling, chemical modification, binding to specific molecules, etc.

[0063] An exemplary (Homo sapiens) genomic DNA sequence of PHGDH can be shown as NCBI NG 009188.1 (SEQ ID NO: 1), its polypeptide sequence can be shown as NP_006614.2 (SEQ ID NO: 3), and its mRNA sequence can be shown as NM_006623.3 (SEQ ID NO: 2). It should be understood that when encoding the same amino acid, nucleotide substitutions in codons are acceptable. Similarly, it should be understood that when conservative amino acid substitutions are generated by nucleotide substitutions, nucleotide changes are also acceptable. In addition, it should be understood that the above-mentioned specific sequences are exemplary sequences, and any molecules having a sequence homology, similarity, identity, etc. of more than 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5% or more, or any value or numerical range therebetween) and that can indicate the level of PHGDH in a sample fall within the scope of the terms "phosphoglycerate dehydrogenase", "phosphoglycerate dehydrogenase", "PHGDH" or "PHGDH molecule" described herein. Biomarkers and their detection

[0064] As used herein, the term "biomarker" means an indicator molecule or a set of molecules that can be detected in a sample, including genes, mRNA, cDNA, precursors, antisense transcripts, miRNA, polypeptides / proteins, protein fragments, or any other active fragments or marker fragments that indicate gene expression levels, polypeptide / protein expression levels, and / or protein activity levels. In some embodiments, the "biomarker" includes genomic DNA, cDNA, mRNA, protein, or a functional fragment of any of the foregoing of PHGDH. In one embodiment, the biomarkers described herein include (a) a genomic DNA or a functional fragment thereof having a sequence such as that shown in SEQ ID NO: 1; (b) an mRNA or a functional fragment thereof having a sequence such as that shown in SEQ ID NO: 2; (c) a PHGDH protein or a functional fragment thereof having a sequence such as that shown in SEQ ID NO: 3; (d) a molecule or a functional fragment thereof that has a sequence homology or identity of more than 70% with any of the sequences in (a) to (c) and that can indicate the level of PHGDH in a sample.

[0065] The combination of a biomarker (e.g., PHGDH) and "level", "expression level" or "amount" used interchangeably herein means the detectable level of a biomarker in a sample (e.g., such as a biopsy or biopsy tissue). "Expression" generally refers to the process by which information (e.g., genetically encoded and / or epigenetic) is converted into a structure present and operating in a cell. Therefore, as used herein, "expression" may refer to transcription into polynucleotides, translation into polypeptides, or even polynucleotide and / or polypeptide modifications (e.g., post-translational modifications of polypeptides). Fragments of transcribed polynucleotides, translated polypeptides, or polynucleotide and / or polypeptide modifications (e.g., post-translational modifications of polypeptides) should also be considered to have been expressed, whether they are derived from transcripts generated by alternative splicing or degradation of transcripts, or from post-translational processing of polypeptides (e.g., by proteolysis). "Expressed genes" should be understood to include those that are transcribed into polynucleotides such as mRNA, then translated into polypeptides, and those that are also transcribed into RNA but not translated into polypeptides (e.g., transfer RNA and ribosomal RNA). Herein, the terms "PHGDH level", "PHGDH expression level", "PHGDH amount" and terms equivalent in grammar and meaning mean the gene expression level (e.g., nucleic acid expression level or mRNA expression level), polypeptide / protein expression level and / or protein activity level of PHGDH.

[0066] The level of a biomarker (eg, PHGDH) in a test sample (eg, a biopsy or tissue biopsy) can be measured by methods known to those of skill in the art and / or disclosed herein. Many methods for determining the gene expression level, polypeptide / protein expression level and / or protein activity level of PHGDH are known in the art and understood by the skilled person, including but not limited to immunohistochemistry staining ("IHC"), Western blot analysis, immunoprecipitation, molecular binding assays, ELISA, ELIFA, flow cytometry, fluorescence activated cell sorting ("FACS"), spatial transcriptomics, spatial proteomics, MassARRAY, proteomics, blood-based quantitative assays (e.g., serum ELISA), biochemical enzyme activity assays, in situ hybridization (ISH), fluorescence in situ hybridization (FISH), Southern blot analysis, Northern blot analysis, whole genome sequencing, massively parallel DNA sequencing (e.g., next generation sequencing), polymerase chain reaction (PCR) (including quantitative real-time PCR (qRT-PCR) and other amplification type detection methods, such as branched DNA, SISBA, TMA, etc.), RNA-seq, microarray analysis, gene expression profiling and / or serial analysis of gene expression ("SAGE"), as well as any of a variety of assays that can be performed by protein, gene and / or tissue array analysis. Typical protocols for evaluating the status of genes and gene products can be found in, for example, Ausubel et al., eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), Unit 4 (Southern Blotting), Unit 15 (Immunoblotting), and Unit 18 (PCR Analysis).

[0067] In some embodiments, PHGDH level is determined by the gene expression level (e.g., nucleic acid expression level or mRNA expression level) of PHGDH, for example, by measuring the PHGDH gene copy number. The method of assessing the PHGDH gene copy number is well known in the art, including but not limited to hybridization and analysis based on amplification.

[0068] Any hybridization-based detection method can be used to detect the copy number of the PHGDH gene in a biological sample. One such method is Western blotting, in which genomic DNA can be fragmented, separated by electrophoresis, transferred to a membrane, and then hybridized with a PHGDH-specific probe. The relative PHGDH gene copy number corresponding to the specific probe used can be estimated by comparing the hybridization signal intensity of the target region probe with the signal intensity of a control probe of a normal non-amplified, single-copy genomic DNA region in the same genome. An increase in signal compared to the control indicates the presence of amplification. Another method for determining the copy number of the PHGDH gene in a sample is in situ hybridization, such as fluorescence in situ hybridization (FISH). In situ hybridization generally includes the following steps: (1) fixation of the biological sample to be analyzed; (2) pre-hybridization treatment of the biological sample to increase accessibility of the target DNA and reduce nonspecific binding; (3) hybridization of a nucleic acid mixture with nucleic acids in the biological sample; (4) post-hybridization washing to remove nucleic acid fragments that are not bound in the hybrid. And (5) detection of the hybridized nucleic acid fragments. Gene copy number can also be determined by comparative genomic hybridization (CGH). In the comparative genomic hybridization method, a group of "test" nucleic acids are labeled with a first marker, while another group (e.g., from normal cells or tissues) is labeled with a second marker. The ratio of nucleic acid hybridization is determined by the ratio of the first and second markers combined on each fiber in the array. For example, the difference in the signal ratio from the two markers due to gene amplification in the test set is detected, and the ratio provides a measured value of the gene copy number corresponding to the specific probe used. The cytogenetic characterization of DNA copy number variation can be generated by CGH, which can provide a fluorescence ratio of differentially labeled test and reference genomic DNA along the length of the chromosome. In addition, amplification-based analysis can also be used to measure the copy number of the PHGDH gene. In such an assay, the corresponding PHGDH nucleic acid sequence serves as a template for an amplification reaction (e.g., polymerase chain reaction or PCR). In quantitative amplification, the amount of amplified product is proportional to the amount of template in the original sample. According to the principles discussed above, compared with appropriate controls, the copy number of the PHGDH gene corresponding to the specific probe used can be measured. The real-time quantitative PCR (qRT-PCR) method using TaqMan probes is well known in the art. TaqMan-based detection methods can also be used to quantify PHGDH polynucleotides. TaqMan-based detection methods use fluorescent oligonucleotide probes containing a 5' fluorescent dye and a 3' quencher. The probe hybridizes to the PCR product but cannot extend itself due to the blocker at the 3' end. When the PCR product is amplified in subsequent cycles, the 5' nuclease activity of the polymerase (e.g., AmpliTaq) causes cleavage of the TaqMan probe. This cleavage separates the 5' fluorescent dye and the 3' quencher, resulting in an increase in fluorescence as a function of amplification.Other suitable amplification methods include, but are not limited to, ligase chain reaction (LCR), transcription amplification, self-sustaining sequence replication, etc. In addition, the PHGDH gene copy number can also be determined using a microarray-based platform (e.g., single nucleotide polymorphism (SNP) array) because microarray technology has high resolution.

[0069] In some embodiments, nucleic acid expression levels can be determined by Western blot, quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR), RNA-Seq, multiplex qPCR or RT-qPCR, microarray analysis, SAGE, MassARRAY technology, in situ hybridization (e.g., FISH), etc. In other embodiments, mRNA expression levels can be determined by real-time quantitative PCR (qRT-PCR), RNA-Seq, PCR, qPCR, RT-PCR, in situ hybridization, gene expression profiling, gene expression serial analysis, microarray analysis, etc. In some preferred embodiments, mRNA expression levels can be determined by qRT-PCR. In some more preferred embodiments, mRNA expression levels can be determined by real-time quantitative PCR (qRT-PCR) using a forward primer of ATGGCCTTCGCAAATCTGC (SEQ ID NO: 4) and a reverse primer of AGTTCAGCTATCAGCTCCTCC (SEQ ID NO: 5).

[0070] In some embodiments, the PHGDH level is determined by the protein expression level and / or protein activity level of PHGDH. It is known in the art that the presence and / or expression level (amount) of a biomarker (e.g., PHGDH) can be measured by measuring the protein expression level and / or protein activity level of the biomarker. Methods for measuring polypeptide / protein expression levels and / or protein activity levels are also well known in the art, including but not limited to mass spectrometry (MS), reverse transcriptase-polymerase chain reaction (RT-PCR), microarrays, gene expression serial analysis (SAGE), gene expression analysis by massively parallel feature sequencing (MPSS), immunoassays (e.g., ELISA), immunohistochemical staining (IHC), transcriptomics and proteomics techniques. In some embodiments, proteins in tissue samples can be stained and detected using specific antibodies by immunohistochemical staining (IHC) techniques. For example, in the detection of PHGDH protein levels, the expression of PHGDH protein in tissues is observed by IHC techniques. IHC techniques use labeled specific antibodies to qualitatively, positionally or quantitatively study the distribution and content of certain chemical components in tissue sections or cell specimens in situ. According to the principle of antigen-antibody reaction and chemical color development, the antigen in the tissue section or cell specimen is first combined with a primary antibody, and then the primary antibody is used to react with a secondary antibody labeled with biotin, fluorescein, etc. The former is then combined with an anti-biotin (such as streptavidin, etc.) labeled with horseradish peroxidase (HRP) or alkaline phosphatase (AKP), etc., and finally the chemical components in the cell or tissue are displayed by color reaction or fluorescence. The antigen-antibody reaction products occurring in the cell can be clearly seen under an optical microscope or a fluorescence microscope, so that the distribution and content of certain chemical components can be determined in situ on the cell slide or tissue section. Those skilled in the art are familiar with how to use immunohistochemistry (IHC) technology to evaluate polypeptide / protein expression levels and / or protein activity levels, and select specific categories of IHC technology according to specific needs. For example, according to the type of marker, fluorescent dyes, radioactive isotopes, enzymes (mainly horseradish peroxidase and alkaline phosphatase), ferritin, colloidal gold, etc. are selected; according to the specific type, immunofluorescence, radioimmunoassay, immunoenzyme labeling and immunogold and silver methods are selected; according to the staining steps, direct methods (also known as one-step methods) and indirect methods (two-step, three-step or multi-step methods) are selected; according to the binding mode, antigen-antibody binding (such as peroxidase-antiperoxidase (PAP) method) or affinity connection such as avidin-biotin-peroxidase complex (ABC) method, streptavidin-peroxidase linking (SP) method, etc. are selected. In some preferred embodiments, considering that the immunoenzyme labeling method has the advantages of accurate positioning, good contrast, long-term storage of stained specimens, and suitability for optical and electron microscopic research compared with the immunofluorescence technology, the immunoenzyme labeling method is selected to determine the protein expression level of PHGDH.In some more preferred embodiments, direct detection using PHGDH antibody (e.g., PHGDH antibody from Abcam with catalog number #ab240744) is selected for immunoenzyme labeling. In a preferred embodiment, PHGDH level is determined by PHGDH immunohistochemical staining (IHC) scoring, wherein the PHGDH immunohistochemical staining score = immunohistochemical staining intensity score × immunohistochemical staining area score; wherein the immunohistochemical staining intensity score is: no staining is 0 points, light brown is 1 point, brown is 2 points, and dark brown is 3 points; the immunohistochemical staining area score (the proportion of tumor cell staining positive area to the total tumor cell area) is: no staining positive is 0 points, <25% is 1 point, ≥25 to <50% is 2 points, ≥50 to <75% is 3 points, and ≥75% is 4 points.

[0071] In some embodiments, the PHGDH level is the median value, mean value or standard value determined by statistical methods of the PHGDH level measured by detecting a sample obtained from a subject using any of the above methods for detecting the level of a biomarker in a sample.

[0072] As used herein, the term "reference level", "reference expression level" or the same terms in grammar and meaning thereof means the PHGDH level measured in a reference sample, a reference cell, a reference tissue, a control sample, a control cell, a control tissue or an internal control (e.g., a housekeeping gene), or a pre-specified PHGDH level, for example, an immunohistochemical staining (IHC) score value. The reference level used herein may be a numerical point or a threshold range. A person of ordinary skill in the art may determine a specific numerical value or numerical range according to common knowledge in the art. As used herein, the terms "reference sample", "reference cell", "reference tissue", "control sample", "control cell" or "control tissue" are used interchangeably and mean a sample, cell, tissue, standard or level for comparison purposes. In one embodiment, a reference level, a reference sample, a reference cell, a reference tissue, a control sample, a control cell or a control tissue is obtained from a healthy and / or non-diseased body part (e.g., a tissue or cell) of the same subject or individual. For example, a reference level, a reference sample, a reference cell, a reference tissue, a control sample, a control cell or a control tissue may be a healthy and / or non-diseased cell or tissue (e.g., a cell or tissue adjacent to a tumor) adjacent to a diseased cell or tissue. In another embodiment, the reference sample is obtained from untreated tissues and / or cells of the body of the same object or individual. In yet another embodiment, the reference level, reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is obtained from a healthy and / or non-diseased body part (e.g., tissue or cell) that is not the object or individual. In even another embodiment, the reference level, reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is obtained from untreated tissues and / or cells that are not the body of the object or individual. In some embodiments, the reference level is the median, mean, or statistically determined standard value of the PHGDH level in the sample obtained from the object at a previous time point. In some embodiments, the reference level is the median, mean, or statistically determined standard value of the PHGDH level in the reference population (e.g., from the same patient or different objects, such as healthy tissue samples of healthy objects, or the average (e.g., mean or median) expression level of multiple individuals or patients). In some embodiments, the reference level is a pre-specified PHGDH level. In some preferred embodiments, the reference level is a pre-assigned immunohistochemistry staining (IHC) score value, for example, an immunohistochemistry staining (IHC) score of 6.

[0073] As used herein, reference to a specific biomarker (e.g., PHGDH) level that is "higher than," "greater than," "increased," or grammatically equivalent terms thereof, means that the gene expression level (e.g., nucleic acid expression level or mRNA expression level), protein expression level, and / or protein activity level of the biomarker in the sample tested is increased by about 1% or more (e.g., about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103 , 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1,0 00%, 2,000%, 5,000% or about 10,000% or more) or by about 1-fold or more (e.g., about 1-fold, about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 3-fold, about 3.5-fold, about 4-fold, about 4.5-fold, about 5-fold, about 5.5-fold, about 6-fold, about 6.5-fold, about 7-fold , about 7.5 times, about 8 times, about 8.5 times, about 9 times, about 9.5 times, about 10 times, about 11 times, about 12 times, about 13 times, about 14 times, about 15 times, about 16 times, about 17 times, about 18 times, about 19 times, about 20 times, about 30 times, about 40 times, about 50 times, about 100 times, about 500 times, about 1,000 times or more, or higher than a pre-specified PHGDH level value, for example, a pre-specified immunohistochemistry staining (IHC) score value; preferably the immunohistochemistry staining (IHC) score is 6.

[0074] Reference to a specific biomarker (e.g., PHGDH) level being "lower than," "less than," "reduced," or grammatically equivalent words thereof, means that the gene expression level (e.g., nucleic acid expression level or mRNA expression level), protein expression level, and / or protein activity level of the biomarker in the sample tested is reduced by about 1% or more (e.g., about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1,000% , 2,000%, 5,000% or about 10,000% or more) or by about 1-fold or more (e.g., about 1-fold, about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 3-fold, about 3.5-fold, about 4-fold, about 4.5-fold, about 5-fold, about 5.5-fold, about 6-fold, about 6.5-fold, about 7-fold, about 7.5 times, about 8 times, about 8.5 times, about 9 times, about 9.5 times, about 10 times, about 11 times, about 12 times, about 13 times, about 14 times, about 15 times, about 16 times, about 17 times, about 18 times, about 19 times, about 20 times, about 30 times, about 40 times, about 50 times, about 100 times, about 500 times, about 1,000 times or more, or lower than a pre-specified PHGDH level value, for example, a pre-specified immunohistochemistry staining (IHC) score value; preferably the immunohistochemistry staining (IHC) score is 6. Cancer metastasis and disseminated tumor cells (DTC)

[0075] As used herein, the terms "sample", "biological sample" or "sample to be tested" are used interchangeably and refer to a sample obtained from a subject and used to detect PHGDH. The sample can be a tissue obtained from the subject, such as a fresh tissue, a frozen sample, a fixed sample (such as a formalin-fixed sample, a paraffin-embedded sample), etc., preferably a fresh tissue, a formalin-fixed or paraffin-embedded tissue, and particularly preferably a biopsy tissue suspected of metastasis and colonization based on the subject's medical history and imaging examination results (e.g., CT, MRI, etc.). .

[0076] It is known in the art that cancer metastasis includes a series of biological events, the process mainly includes dissemination, entry into the blood circulation and distant colonization; each of these events is driven by the ability of tumor cells to adopt different phenotypic cell states and co-select the immune and stromal cells around them in the tumor environment to support their growth and escape the immune system. Specifically, during the dissemination process, the cancer cells of the primary tumor first acquire the ability to penetrate the basement membrane and invade the surrounding tissues; these cells then acquire the ability to enter the blood circulation or lymphatic system through intravasation, that is, the cancer cells enter the adjacent blood vessels or lymphatic vessels. After entering the blood circulation, cancer cells form circulating tumor cells (CTCs). Although CTCs will cause a large number of losses at this stage due to physical, biochemical and immune factors, some CTCs can survive in the form of single cells or cell microclusters and be coated by platelets, neutrophils or tumor-derived stromal cells, thereby helping them to escape immune surveillance and increase their metastatic potential. In the distant colonization stage, CTCs eventually leave the blood vessels through the process of extravasation and migrate to the parenchymal tissue of distant organs to form disseminated tumor cells (DTCs). In distant organs, although DTCs may be cleared by local immune defenses, some cells can still survive and enter a dormant state. Although these surviving DTCs have not yet expanded to form clinically detectable metastatic lesions, they can adapt to and escape immune surveillance in the organ-specific microenvironment, ultimately leading to the formation of clinically detectable macroscopic metastases (see, for example, Gerstberger S, Jiang Q, Ganesh K. Metastasis. Cell. 2023; 186(8): 1564-1579).

[0077] As used herein, the term "disseminated tumor cells (DTCs)" refers to tumor cells that have shed from the primary tumor focus of the primary cancer and circulated in blood vessels or lymphatic vessels and then colonized and survived after reaching a distant target organ, for example, tumor cells that have not yet expanded to form clinically detectable metastatic lesions. Therefore, the term "disseminated tumor cells (DTCs)" is relative to the concept of "circulating tumor cells (CTCs)" that are disseminated from the primary cancer and are in the blood circulation.

[0078] The cancer that causes / generates disseminated tumor cells (DTC) can be any cancer, such as any primary cancer or a metastatic cancer caused by a primary cancer. In this article, the terms "tumor" and "cancer" are used interchangeably herein, referring to cells known in the art and referring to, for example, the presence of cells with characteristics unique to cancer cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, reduced cell death / apoptosis, and certain unique morphological characteristics in the subject. Cancer cells are usually in the form of solid tumors. However, cancer also includes non-solid tumors, such as blood tumors, such as leukemias, in which cancer cells are derived from bone marrow. The term "cancer" used herein includes precancerous lesions and malignant cancers and tumors. It is known that many types of cancers can metastasize and shed circulating tumor cells or have metastatic properties, such as secondary cancers caused by primary cancers that have metastasized. Other cancers may include, but are not limited to, the following organs or systems: brain, heart, lung, gastrointestinal, urogenital tract, liver, bone, nervous system, gynecology, hematology, skin, breast, and adrenal glands.Examples of cancer include, but are not limited to, acoustic neuroma, acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia (monocytic, myeloblastic, adenocarcinoma, angiosarcoma, astrocytoma, myelomonocytic and promyelocytic), acute T-cell leukemia, basal cell carcinoma, bile duct cancer, bladder cancer, brain cancer, breast cancer, bronchial cancer, cervical cancer, chondrosarcoma, chordoma, choriocarcinoma, chronic leukemia, chronic lymphocytic leukemia, chronic myeloid (granulocytic) leukemia, chronic bone marrow cancer, Leukemia, colon cancer, colorectal cancer, craniopharyngioma, cystadenocarcinoma, diffuse large B-cell lymphoma, Burkitt's lymphoma, abnormal proliferation changes, dysplasia and metaplasia, embryonal carcinoma, endometrial cancer, endothelial sarcoma, ependymoma, epithelial cancer, erythroleukemia, esophageal cancer, estrogen receptor positive breast cancer, essential thrombocythemia, Ewing's sarcoma, fibrosarcoma, follicular lymphoma, germ cell testicular cancer, glioma, heavy chain disease, hemangioblastoma, liver cancer, hepatocellular carcinoma, hormone insensitive prostate cancer, Leiomyosarcoma, liposarcoma, lung cancer, lymphangioendothelioma, lymphangiosarcoma, lymphoblastic leukemia, lymphoma (Hodgkin and non-Hodgkin), malignancies and hyperproliferative disorders of the bladder, breast, colon, lung, ovary, pancreas, prostate, skin, and uterus, lymphoid malignancies of T-cell or B-cell origin, leukemia, lymphoma, medullary carcinoma, medulloblastoma, melanoma, meningioma, mesothelioma, multiple myeloma, myeloid leukemia, myeloma, myxosarcoma, neuroblastoma tumors, non-small cell lung cancer, oligodendroglioma, oral cancer, osteogenic sarcoma, ovarian cancer, pancreatic cancer, papillary adenocarcinoma, papillary carcinoma, pinealoma, polycythemia vera, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, sarcoma, sebaceous gland carcinoma, seminoma, skin cancer, small cell lung cancer, solid tumors (tumors and sarcomas), small cell lung cancer, gastric cancer, squamous cell carcinoma, synovioma, sweat adenoma, thyroid cancer, primary macroglobulinemia, testicular tumors, uterine cancer and Wilms' tumor.Other cancers include primary cancer, metastatic cancer, oropharyngeal cancer, hypopharyngeal cancer, liver cancer, gallbladder cancer, bile duct cancer, small intestine cancer, urethral cancer, kidney cancer, bladder epithelial cancer, female genital tract cancer, uterine cancer, gestational trophoblastic disease, male genital tract cancer, seminal vesicle cancer, testicular cancer, germ cell tumors, endocrine gland tumors, thyroid cancer, adrenal cancer, pituitary cancer, hemangioma, sarcomas arising from bone and soft tissue, Kaposi's sarcoma, neural cancer, eye cancer, meningeal cancer, glioblastoma, neuroma, neuroblastoma, schwannoma, solid tumors from malignant blood diseases such as leukemia, metastatic melanoma, recurrent or persistent ovarian epithelial cancer, fallopian tube cancer, primary peritoneal cancer, gastrointestinal stromal tumors, colorectal cancer, gastric cancer, melanoma, glioblastoma multiforme, non-squamous non-small cell lung cancer, malignant glioma , epithelial ovarian cancer, primary peritoneal serous carcinoma, metastatic liver cancer, neuroendocrine cancer, refractory malignancies, triple-negative breast cancer, HER2-amplified breast cancer, nasopharyngeal carcinoma, oral cancer, bile duct cancer, hepatocellular carcinoma, squamous cell carcinoma of the head and neck (SCCHN), non-thyroid medullary cancer, recurrent glioblastoma multiforme, neurofibromatosis type 1, CNS cancer, liposarcoma, leiomyosarcoma, salivary gland cancer, mucosal melanoma, acral lentiginous melanoma, paraganglioma, pheochromocytoma, advanced metastatic cancer, solid tumors, triple-negative breast cancer, colorectal cancer, sarcoma, melanoma, renal cancer, endometrial cancer, thyroid cancer, rhabdomyosarcoma, multiple myeloma, ovarian cancer, glioblastoma, gastrointestinal stromal tumor, mantle cell lymphoma, and refractory malignancies.

[0079] In some embodiments, the subject is a mammal, such as a human, a non-human primate (e.g., a gorilla, ape), a rodent (e.g., a rat, a mouse, a guinea pig), a pet (e.g., a cat, a dog), a livestock (e.g., a horse, a cow, a sheep, a pig, a rabbit). In some embodiments, the subject is selected from the group consisting of: ■Subjects suspected of having primary cancer; ■People who have primary cancer but have not received treatment for the primary cancer; ■Those who have primary cancer and have received treatment for the primary cancer; ■People who have primary cancer and have received treatment for the primary cancer but have not yet received preventive treatment for cancer metastasis; ■ Subjects who have primary cancer and have received treatment for the primary cancer and are receiving preventive treatment for cancer metastasis; and / or ■Objects with one or more of the above conditions.

[0080] In some embodiments, subjects suspected of metastasis and colonization based on their medical history and imaging examination results (eg, CT, MRI, etc.) are preferred.

[0081] In some embodiments, the subject has a primary cancer, for example, hepatocellular carcinoma, cholangiocarcinoma, prostate cancer, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous carcinoma, peritoneal cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer or uterine cancer, salivary gland cancer, kidney cancer, vulvar cancer, thyroid cancer, gastric cancer, melanoma or cervical cancer; preferably hepatocellular carcinoma, breast cancer, colorectal cancer, lung adenocarcinoma. In some embodiments, the subject has the above-mentioned primary cancer and has a suspected cancer metastasis caused by the primary cancer and / or is at risk of a suspected cancer metastasis caused by the primary cancer, for example, a primary cancer causes lung (e.g., liver cancer lung metastasis), bone, brain or lymph node (e.g., liver cancer lymph node metastasis) metastasis.

[0082] As used herein, the term "immune escape DTC" means disseminated tumor cells with immune escape ability, which can escape the recognition and attack / killing of the body's immune system through various mechanisms, or resist the surveillance and attack / killing of the immune system, thereby surviving, activating and proliferating in vivo. For example, immune escape DTC can downregulate the enrichment of immune response-related pathways through various mechanisms, significantly reduce or inhibit immune cell infiltration (e.g., CD45+ immune cell infiltration), inhibit chemokine expression, reduce immune cell recruitment, antigen presentation defects, escape immune response, be in a quiescent state, and / or promote metastasis and colonization by shaping an immune desert microenvironment. Testing products and methods

[0083] Provided herein are products and methods for performing disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis assessment based on PHGDH levels in subject samples.

[0084] The product herein may be a detection kit and / or a detection device and / or a detection system. The reagents, components, modules, etc. contained therein may be selected according to the requirements in practical applications (e.g., the selected detection method, the specific conditions of the object, etc.).

[0085] The product of this article may include: (i) one or more reagents, devices and / or modules for detecting an effective amount of PHGDH molecules; (ii) one or more substances selected from the following group: containers, instructions for use, positive controls, negative controls, buffers, adjuvants or solvents, such as solutions for suspending or fixing cells, detectable labels or markers, solutions for making nucleic acids easy to hybridize, solutions for lysing cells, or solutions for nucleic acid purification.

[0086] As used herein, the terms "detection reagent" or "reagent for detecting PHGDH molecules" or "reagent for detecting the level / amount of PHGDH in a biological sample" are used interchangeably and refer to reagents that are specific to PHGDH molecules and can be used to directly or indirectly detect the presence and / or content of PHGDH molecules.

[0087] Since the sequence of the PHGDH molecule is known in the art, a person skilled in the art can prepare a reagent specific for the PHGDH molecule based on conventional means or obtain it commercially. For example, available detection reagents include, but are not limited to: probes, gene chips, PCR primers, antibodies, chemical binding molecules, etc., which have detection specificity for the PHGDH molecule, such as the antisense sequence of the PHGDH molecule, primers for the sequence shown in SEQ ID NO: 4 and / or 5, etc.

[0088] To facilitate detection, the detection reagent may also carry a detectable label, which includes but is not limited to: radioactive isotopes, fluorophores, chemiluminescent moieties, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, ligands (such as biotin or haptens), etc.

[0089] The detection reagent can be present in a solution, fixed on a carrier (such as a substrate, an adsorbent) or in other conventional ways in the art, as long as the presence is suitable for the detection of PHGDH molecules in a biological sample. For example, when the detection reagent is a nucleic acid probe, it can be present in the form of a biochip (or "microarray").

[0090] The product in this article (such as a detection kit) may also be accompanied by instructions for use of the kit, which record how to use the kit for detection, and how to use the test results to perform disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis and colonization prediction and / or cancer treatment prognosis assessment.

[0091] The product herein may also include other reagents for clinically used in subject disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis assessment, to assist or verify the results obtained by detecting PHGDH molecules. Those of ordinary skill in the art may make routine selections according to specific needs.

[0092] In some embodiments, the PHGDH level in a biological sample is detected by a real-time quantitative reverse transcription PCR (qRT-PCR) method, and the product used may include: a PHGDH-specific reverse transcription primer and a PCR primer. In some specific examples, the PHGDH level in a biological sample is detected by a real-time quantitative reverse transcription PCR (qRT-PCR) method, and the product used may include: (a) Reverse transcriptase; (b) RNase inhibitors; (c) reverse transcription buffer; (d) Target gene (PHGDH) reverse transcription primer and PCR upstream primer and downstream primer: The forward primer was ATGGCCTTCGCAAATCTGC (SEQ ID NO: 4); The reverse primer was AGTTCAGCTATCAGCTCCTCC (SEQ ID NO: 5); (e) PCR buffer; (f) dNTPs; (g) Taq DNA polymerase.

[0093] In some embodiments, the PHGDH level in a biological sample is detected by immunohistochemistry (IHC), and the product used may include a specific antibody, for example, a PHGDH antibody, such as PHGDH antibody with catalog number # ab240744 from Abcam.

[0094] The "specific antibodies" and / or "PHGDH antibodies" described herein include polyclonal antibodies and monoclonal antibodies specific for PHGDH polypeptides, especially monoclonal antibodies. The term "specific antibody" refers to an antibody that can bind to a product or fragment of a PHGDH gene (e.g., a human PHGDH gene). Preferably, an antibody that can bind to a human PHGDH gene product or fragment but does not recognize and bind to other non-related antigen molecules. The antibodies in the present invention include those that can bind to and inhibit PHGDH proteins, as well as those that do not affect the function of PHGDH proteins. The present invention also includes antibodies that can bind to modified or unmodified forms of PHGDH gene products. The "specific antibodies" and / or "PHGDH antibodies" described herein include not only complete monoclonal or polyclonal antibodies, but also immunologically active antibody fragments, such as Fab' or (Fab)2 fragments; antibody heavy chains; antibody light chains; genetically engineered single-chain Fv molecules or chimeric antibodies, such as antibodies that have mouse antibody binding specificity but still retain antibody parts from humans. The "specific antibodies" and / or "PHGDH antibodies" described herein can be prepared by various techniques known to those skilled in the art or can be purchased commercially. Disseminated tumor cell (DTC) classification, cancer metastasis and colonization prediction, Immune escape DTC screening and / or identification and / or cancer treatment prognosis assessment

[0095] Provided herein are products and methods for performing disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis assessment on a sample obtained from a subject.

[0096] In this article, the classification of disseminated tumor cells (DTCs) is to classify DTCs as immune escape DTCs or non-immune escape DTCs based on the PHGDH level in the sample obtained from the subject. This article first revealed that tumor cells with high PHGDH expression are significantly enriched in micrometastatic foci, while CD45+ immune cell infiltration is significantly reduced. Therefore, DTCs can be classified as "immune escape DTCs"; otherwise, they belong to "non-immune escape DTCs".

[0097] As used herein, the terms "immune escape DTC", "immune escape-capable DTC" or their grammatical variations are used interchangeably and refer to a key tumor cell population that escapes immune surveillance and killing during cancer metastasis and promotes the proliferation and expansion of metastatic lesions.

[0098] In this article, immune escape DTC screening and / or identification is based on the PHGDH level in the sample obtained from the subject to screen and / or identify immune escape DTC. This article first reveals that tumor cells with high PHGDH expression are significantly enriched in micrometastatic foci, while CD45+ immune cell infiltration is significantly reduced. Therefore, according to the PHGDH level in the sample obtained from the subject, it is identified as immune escape DTC, wherein the PHGDH level is higher than the reference level, the DTC is immune escape DTC; and the PHGDH level is lower than the reference level, the DTC is identified as non-immune escape DTC.

[0099] In this article, the cancer metastasis colonization prediction is to predict the possibility of cancer metastasis colonization in the subject according to the PHGDH level in the sample obtained from the subject. This article first reveals that tumor cells with high PHGDH expression create an immune desert microenvironment to promote cancer metastasis colonization. Therefore, the possibility of cancer metastasis colonization in the sample is predicted according to the PHGDH level in the sample obtained from the subject, wherein the PHGDH level is higher than the reference level, the subject is prone to cancer metastasis colonization; and the PHGDH level is lower than the reference level, the subject is not prone to cancer metastasis colonization.

[0100] Herein, cancer treatment prognosis assessment is to assess a subject suffering from cancer and having received treatment (e.g., a subject suffering from primary cancer and having received treatment for the primary cancer and / or a subject suffering from primary cancer and having received treatment for the primary cancer and receiving preventive treatment for cancer metastasis) as having a good or poor prognosis for treatment according to the PHGDH level in the sample obtained from the subject. Therefore, a subject suffering from cancer and having received treatment is assessed as having a good or poor prognosis according to the PHGDH level in the sample obtained from the subject, wherein the subject is assessed as having a poor prognosis if the PHGDH level is higher than the reference level; and the subject is assessed as having a good prognosis if the PHGDH level is lower than the reference level.

[0101] As used herein, the term "prognosis" refers to the prediction of the possible course and outcome of a disease, which includes the determination of specific consequences of the disease (such as recovery, the appearance or disappearance of certain symptoms, signs, complications and other abnormalities, and death). The poor prognosis described in the present invention includes, but is not limited to: a subject suffering from primary cancer and having received treatment for the primary cancer develops a secondary cancer, for example, a metastatic cancer caused by the primary cancer, for example, a metastasis of the lung (such as liver cancer lung metastasis), bone, brain or lymph node (such as liver cancer lymph node metastasis) caused by the primary cancer; a metastatic cancer in a subject suffering from primary cancer and having received treatment for the primary cancer and receiving preventive treatment for cancer metastasis and aggravation, for example, an immune desert microenvironment or the appearance of disseminated tumor cell colonization.

[0102] The control level used herein can be a numerical point or a threshold range. A person of ordinary skill in the art can determine a specific numerical value or numerical range based on common knowledge in the art.

[0103] This article discloses the use of a novel marker, phosphoglycerate dehydrogenase (PHGDH), and PHGDH as a biomarker or a substance for detecting PHGDH as a biomarker in the preparation of a product for detecting the level of PHGDH in a sample obtained from a subject to perform disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, tumor metastasis and colonization prediction, and / or cancer treatment prognosis evaluation, providing new ideas and approaches for disseminated tumor cell (DTC) research and development of disseminated tumor cell (DTC) detection and the like, thereby providing a novel biomarker in the art with clinical application prospects. Example

[0104] The present application will be further described below in conjunction with specific embodiments and accompanying drawings. It should be understood that these embodiments are only used to illustrate the present application and are not intended to limit the scope of the present application. Those skilled in the art may make appropriate modifications and changes to the present invention, and these modifications and changes are within the scope of the present invention.

[0105] The experimental methods in the following examples where specific conditions are not specified are generally carried out under conventional conditions such as those described in Michael R. Green et al., 4th edition, Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 2017), or under conventional conditions or under conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0106] The mice used in the examples were purchased from Shanghai Lingchang Biotechnology Co., Ltd.; the experimental ethics involving clinical patients in the examples were approved by the Ethics Committee of Zhongshan Hospital Affiliated to Fudan University, and written informed consent signed by all included patients or their families was obtained.

[0107] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein may be applied to this application. The preferred implementation methods and materials described herein are for demonstration purposes only. Example 1: Characterizing the changing characteristics of disseminated tumor cells (DTC) during metastasis and colonization

[0108] In order to characterize the changing characteristics of disseminated tumor cells (DTC) during metastasis and colonization, C57BL6 / J immune-competent mice (purchased from Shanghai Lingchang Biotechnology Co., Ltd.) were injected with Hepal-6 liver cancer cells (50uL cell suspension, cell injection volume 6*10 6 The mouse model of liver cancer lung metastasis was constructed by adding 10 cells / mouse. The success of the model construction was judged by the following criteria: CT examination of the mice 3 weeks after cell injection indicated the presence of lung metastases; the mice were killed 5 weeks after cell injection, and the lung tissues of the mice were fixed, embedded, and stained with HE, and the HE results confirmed the presence of lung metastases.

[0109] After constructing a liver cancer lung metastasis mouse model (n=27), lung tissues were collected at nine time points after cell injection, namely T1 (0.25 hours), T2 (1 hour), T3 (4 hours), T4 (12 hours), T5 (24 hours), T6 (2 days), T7 (8 days), T8 (21 days) and T9 (35 days) (fresh mouse lung tissues were collected after the mice were sacrificed), and spatial transcriptome sequencing and single-cell transcriptome sequencing were performed based on the BGI Stereo-seq platform (T1: n=1; T2: n=1; T3: n=2, T4: n=2, T5: n=2, T6: n=3, T7: n=4, T8: n=2, T9: n=1, total n=18) and 10x genomics platform (n=1 at each time point).

[0110] Spatial transcriptome sequencing was performed according to the conditions, methods and / or parameters recommended by the BGI Stereo-seq platform in the following steps: ■Sample preparation: Tissue samples were frozen, OCT-embedded, and sliced, and then placed on the Stereo-seq chip; ■Tissue permeabilization and library construction: After fixation and permeabilization of tissue sections, probes capture mRNA molecules in situ on the chip, followed by cDNA synthesis, amplification and library construction; ■Sequencing: Sequencing is completed based on BGI DNBSEQ series high-throughput sequencers.

[0111] Single-cell transcriptome sequencing was performed according to the conditions, methods and / or parameters recommended by the 10x genomics platform with the following steps: ■Preparation of single cell suspension: Prepare single cell suspension based on grinding and enzymatic hydrolysis, mix trypan blue staining solution with cell suspension in a ratio of 1:9. Observe the staining under a microscope, count the number of cells and viability, repeat twice and perform subsequent experimental operations only when the average value meets the quality control value recommended by the 10x Genomics platform; ■Cell capture and cDNA amplification: Resuspend cells in PBS containing 0.1% BSA and mix with gel beads and oil droplets. Add cells (about 20,000 cells / sample) to the Chromium Chip channel and form an oil-in-water structure system through the microfluidic system. The gel beads release primer sequences after cell lysis, and mRNA is reverse transcribed to generate cDNA with 10x Barcode and unique molecular identifier (UMI) information. After the oil-in-water structure system is broken, the cDNA is purified and amplified by PCR to finally obtain stable cDNA. ■Library construction and sequencing: The amplified cDNA is fragmented, end-repaired, and connected to sequencing primers to construct a 3' end expression library. Double-end sequencing is performed based on the Illumina Novaseq 6000 sequencing platform.

[0112] To investigate the dynamic changes of the immune microenvironment around disseminated tumor cells (DTCs) during metastasis and colonization, a 50 × 50 μm area around tumor cells was defined based on spatial transcriptome data. 2 The area is a tumor microenvironment (TME) unit, and a TME unit is further divided into 25 10×10 μm 2 The area is defined as 10 × 10 μm in the center 2 The region is defined as the tumor location point ( Figure 1 ).

[0113] Subsequently, the inventors performed unsupervised clustering on the TME units of all samples, using single-cell dimensionality reduction and clustering methods to divide the TME units into 1 to 4 clusters along the pseudo-time axis, namely Cluster 1-Cluster 4 ( Figure 2B ). The specific steps are as follows: ■Identify highly variable genes in the single-cell data expression matrix and perform PCA dimensionality reduction; ■Unsupervised clustering of cells based on gene expression profiles; ■Using the Uniform manifold approximation and projection (UMAP) algorithm to visualize single-cell clusters; ■Based on the clustering results, the data are divided into Cluster 1 to Cluster 4.

[0114] At the same time, pseudo-time analysis was performed on all tumor cells. The Monocle2R package was used to determine the pseudo-time differentiation trajectory and transcriptome dynamics characteristics of all tumor cells collected at different sampling time points. Based on the pseudo-time analysis results automatically generated by the R package analysis, the tumor cells were divided into 1 to 4 stages along the pseudo-time axis, namely Phase 1-4 (Phase 1-4) ( Figure 2A ).

[0115] Table 1: TME cell clusters and tumor cells at each time point

[0116] Table 2: Changes in gene expression in tumor cells along the pseudo-temporal axis

[0117] Finally, the gene expression information from the same tumor cell is matched with the information of its surrounding TME units to construct the relationship between the changes in tumor cell gene expression along the pseudo-temporal axis and the cell population in the TME unit on the timeline ( Figure 3 ).

[0118] Analysis found that tumor cell staging and TME unit clustering were synchronized on the timeline, suggesting that tumor cells and the immune microenvironment co-evolve during liver cancer metastasis and colonization. Example 2: Quiescent PHGDH+ tumor cells that escape immune killing are transiently enriched during cancer metastasis and colonization set

[0119] In order to analyze the percentage of tumor cells and the number of Phase 3 tumor cells at time points T1 (0.25 hours), T2 (1 hour), T3 (4 hours), T4 (12 hours), T5 (24 hours), T6 (2 days), T7 (8 days), T8 (21 days) and T9 (35 days), the inventors calculated the proportion of Phase 3 tumor cells to all tumor cells and the proportion of all tumor cells to all cells at each time point ( Figure 4A ) and the number of stage 3 tumor cells at each time point ( Figure 4B ).

[0120] Figure 4AThe proportion of stage 3 tumor cells to all tumor cells and the proportion of all tumor cells to all cells at each time point are shown; wherein the left Y-axis represents the proportion of the number of tumor cells with stage 3 tumor cell characteristics detected in the mouse lung tissue obtained at each sampling time point to the number of all tumor cells at the sampling time point; the right Y-axis represents the proportion of the number of all tumor cells in the mouse lung tissue obtained at each sampling time point to the total number of cells. Figure 4B The number of stage 3 tumor cells at each time point is shown; the Y axis represents the absolute value of the number of tumor cells with the characteristics of stage 3 tumor cells detected in the mouse lung tissue obtained at each sampling time point. Figure 4A and 4B As shown in the results, stage 3 tumor cells are basically concentrated at T5-T7 time points, accounting for about half of all tumor cells that survived immune pressure, while the number and proportion of cells at other time points are lower. This result indicates that stage 3 tumor cells are transiently enriched in disseminated tumor cells (DTC) that escape immune pressure.

[0121] The inventors further performed differentially expressed gene analysis on stage 3 tumor cells and other tumor cells, and used the FindMarkers function in the R package Seurat to calculate the up-regulated or down-regulated genes of the target cell subpopulation compared with other cell subpopulations. Gene expression levels were compared, and p = 0.05 was selected as the "significant" threshold to obtain differentially expressed genes ( Figure 5 ).

[0122] Figure 5 The differentially expressed gene analysis between stage 3 tumor cells and other tumor cells is shown, where the x-axis is Log2 (fold change) and the y-axis is -log10 (adjusted p value). The above differentially expressed gene analysis of multiple genes showed that PHGDH was most significantly upregulated in stage 3 tumor cells (t-test), and PHGDH expression was highly overlapped with stage 3 tumor cells, so stage 3 tumor cells were defined as PHGDH+ tumor cells and subsequent studies were performed.

[0123] Subsequently, the inventors performed pathway analysis on PHGDH+ tumor cells and used the Metascape online tool to perform GO and KEGG enrichment analysis on differentially expressed genes. The R package GSVA was used to analyze the pathway activity of individual cells. The R package GSEABase was used to analyze gene sets from MSigDB, KEGG, and Canonical pathways.

[0124] The above pathway analysis results showed that the enrichment of PHGDH+ tumor cells in cell proliferation and immune response-related pathways was significantly downregulated ( Figure 6 ), and the immune cell infiltration in the TME units around PHGDH+ tumor cells was significantly reduced ( Figure 7), suggesting that PHGDH+ tumor cells have characteristics such as escaping immune response and being in a quiescent state.

[0125] The above results indicate that PHGDH+ disseminated tumor cells (DTC) may be the key tumor cell population that escapes immune surveillance and killing during liver cancer metastasis and promotes the proliferation and expansion of metastatic lesions. Example 3: PHGDH+ tumor cells are significantly enriched in micrometastases and CD45+ immune cell infiltration is significantly reduced

[0126] The inventors collected paraffin-embedded lymph node metastasis samples from pan-cancer patients containing both macrometastases and micrometastases from the clinic, and performed multi-color immunofluorescence staining and cell analysis based on a digital pathology platform.

[0127] Specifically, based on the patient's medical history and the pathologist's diagnosis information, the inventors retrospectively screened from the pathology specimen library of Zhongshan Hospital Affiliated to Fudan University, and finally obtained paraffin tissue samples of lymph node metastasis from 6 patients with hepatocellular carcinoma, 4 patients with colorectal cancer, 3 patients with breast cancer, and 3 patients with lung cancer. The pathologist confirmed that the above samples all had macrometastases (more than 100 tumor cells in the metastatic nest) and micrometastases (single tumor cell metastasis or less than 100 tumor cells in the metastatic nest).

[0128] Each paraffin tissue sample was subjected to multicolor immunofluorescence staining, wherein the antibody information was anti-PanCK antibody (Abcam, Catalog No. ab7753), anti-PHGDH antibody (Abcam, Catalog No. ab240744) and anti-CD45 antibody (CST, Catalog No. 47937). The method of multicolor immunofluorescence staining is known in the art, including antigen repair, blocking, primary and secondary antibody incubation after dewaxing and hydration, and fluorescent dye reaction and antibody elution after incubation. Nuclei were stained after multiple rounds of repeated staining. After sealing, the whole slide was scanned using a fully automatic pathology scanning system, and digital analysis was completed by HALO software (v3.2, IndicaLabs).

[0129] As shown in the results in Figure 8, in breast cancer (BRCA), colorectal cancer (CRC), lung adenocarcinoma (LUAD) and HCC lymph node metastases, PHGDH+ tumor cells were significantly enriched in micrometastases compared with macrometastases, while CD45+ immune cell infiltration was significantly reduced.

[0130] The above results further indicate that PHGDH+ disseminated tumor cells (DTC) are a key tumor cell population that evades immune surveillance and killing during cancer metastasis and promotes the proliferation and expansion of metastatic lesions. Example 4: PHGDH+ tumor cells shape the immune desert microenvironment and promote cancer metastasis and colonization

[0131] In order to study the effects of PHGDH+ tumor cells on shaping the immune desert microenvironment and promoting cancer metastasis and colonization, PHGDH knockout (sgPHGDH) and control (sgCtrl) mouse cell lines were further constructed, including Hepal-6 liver cancer cells, H22 liver cancer cells, B16-F10 melanoma cells and MC38 colorectal cancer cells, and immune-competent mice and immune-deficient mice were constructed by tail vein injection.

[0132] The method for constructing the above-mentioned PHGDH knockout and control mouse cell lines is known in the art. For example, lentiCRISPRv2-mCherry is digested with BsmB1 enzyme, and then four sgRNAs targeting PHGDH are cloned into lentiCRISPRv2-mCherry using standard molecular cloning methods. Hepa1-6 tumor cells were pre-plated in a 6-well plate, the required virus volume was calculated according to the cell MOI value and virus titer, and the virus suspension and transfection reagent Polybrene were added to infect Hepa1-6 tumor cells. After 48 hours of transfection, the cells were transferred to a 96-well plate and clones with successful PHGDH knockout were selected to achieve PHGDH knockout in tumor cells. In the construction of the control group Hepa1-6 cell line, the sgRNA used did not knock out any gene.

[0133] After constructing immune-competent mice and immune-deficient mice by tail vein injection, multicolor immunofluorescence was performed on the lung tissues of mice at the T5 time point. As shown in Figure 9, the results showed that the immune cell infiltration in the PHGDH knockout cell group was significantly increased compared with the control group.

[0134] In addition, lung tissues were collected at T8 time point for comparison of lung metastasis burden. Fig.10 The load of lung metastasis (Hepa1-6 liver cancer cells, H22 liver cancer cells, MC38 colorectal cancer cells and B16-F10 melanoma cells) in mice at the T8 time point is shown, where sgPHGDH represents PHGDH knockout cells; sgCtrl represents control; C57BL6 / J and BALB / C represent immune-competent mice, and Nod / scid and BALB / C nude represent immune-deficient mice; t-test, NS represents no significant difference, * represents p<0.05, ** represents p<0.01, ** * represents p < 0.001. Therefore, it was found that in immune-competent mice, the lung metastasis burden of the PHGDH knockout cell group was significantly lower than that of the control group; while in immunodeficient mice, there was no significant difference between the two groups ( Fig.10 ).

[0135] The inventors also constructed knockdown (shPHGDH) or overexpression (PHGDH) of PHGDH based on the human hepatoma cell line Huh7 cells. OE) cell line was used to recruit CD3+T cells and NK cells isolated from tumor tissue in vitro. The experimental results showed that compared with the control group (shCtrl), the PHGDH knockdown group significantly increased the recruitment of CD3+T cells and NK cells, while overexpression of PHGDH significantly inhibited the migration of CD3+T cells and NK cells ( Fig.11 ).

[0136] The above results indicate that PHGDH+ tumor cells can promote metastasis and colonization by shaping the immune desert microenvironment. Example 5: PHGDH downregulates chemokine expression through H3K27me3-mediated epigenetic silencing to promote immune Formation of the immune desert microenvironment and tumor cell colonization

[0137] To elucidate the molecular mechanism by which PHGDH shapes the immune desert microenvironment, the inventors compared the chemokine expression and related transcription factor activity of PHGDH+ tumor cells (stage 3 tumor cells) compared with other tumor cells.

[0138] like Fig.12 and Fig.13 As shown, chemokine expression of PHGDH+ tumor cells (stage 3 tumor cells) ( Fig.12 ) and related transcription factor activities ( Fig.13 ) was significantly lower than that of other tumor cells.

[0139] At the same time, the inventors used PCR and ELISA to verify in human and mouse cell lines. The experimental results of PCR and ELISA suggest that PHGDH is a key factor in inhibiting the expression of chemokines in tumor cells ( Fig.14 ).

[0140] In addition, since PHGDH itself is the most critical rate-limiting enzyme in serine metabolism and provides adenosylmethionine (SAM) for histone methylation, the inventors also performed mass spectrometry analysis on serine metabolites such as serine, methionine and SAM in PHGDH knockout mouse cells or PHGDH knockdown human cells. Fig.15 As shown, mass spectrometry analysis revealed that in PHGDH knockout mouse cells or PHGDH knockdown human cells, serine metabolites such as serine, methionine and SAM were significantly decreased, while serine metabolites overexpressing PHGDH were significantly increased.

[0141] It is known that SAM can regulate H3K27me3 (a histone methylation modification, catalyzed by EZH2, and related to gene expression silencing). Therefore, we performed multicolor immunofluorescence and digital pathology analysis on mouse lung tissue and HCC patient lymph node micrometastasis samples at the T5 time point. Based on the multicolor fluorescence results and analyzed using the digital pathology platform, the number of H3k27me3+PHGDH+ disseminated tumor cells (DTC) compared with H3k27me3+PHGDH-DTC in each field of view was obtained, and a t-test was performed, where p<0.05. Fig.16 As shown in the figure, PHGDH+ disseminated tumor cells (DTC) co-expressed H3K27me3 significantly more than PHGDH- disseminated tumor cells (DTC), suggesting that the presence of H3k27me3+PHGDH+ tumor cell infiltration in micrometastatic lesions is a potential intervention point for tumor metastasis. The above results indicate that PHGDH mediates the upregulation of H3K27me3 in disseminated tumor cells (DTC) by regulating SAM.

[0142] In addition, based on single-cell epigenetic and chromatin accessibility maps (scCPA-Tag), we found that chemokine and related transcription factor genes (e.g., inflammatory transcription factors such as RELA, IRF1, NFKB2, and STAT1) showed significantly lower H3K27me3 modification levels in PHGDH knockout tumor cells compared with the control group ( Fig.17 ), indicating that H3K27me3 can inhibit chemokine transcriptional expression.

[0143] In summary, PHGDH expression regulates H3K27me3-mediated transcriptional silencing of disseminated tumor cells (DTC) through SAM, inhibits chemokine expression, reduces immune cell recruitment, and then promotes the formation of a local immune desert microenvironment, which is beneficial to the metastasis and colonization of PHGDH+ disseminated tumor cells (DTC). Example 6: PHGDH as a biomarker for disseminated tumor cell (DTC) typing and tumor metastasis colonization prediction Detection, screening and / or identification of immune escape DTCs and / or cancer treatment prognosis assessment

[0144] Based on the patients' medical history and pathologist's diagnosis information, the inventors randomly selected 6 paraffin tissue samples with lymph node metastasis from hepatocellular carcinoma patients and 6 paraffin tissue samples without lymph node metastasis from hepatocellular carcinoma patients (liver cancer lymph node metastasis group), 6 paraffin tissue samples with lymph node metastasis from colorectal cancer patients and 6 paraffin tissue samples without lymph node metastasis from colorectal cancer patients (intestinal cancer lymph node metastasis group), 6 paraffin tissue samples with lymph node metastasis from breast cancer patients and 6 paraffin tissue samples without lymph node metastasis from breast cancer patients (breast cancer lymph node metastasis group).

[0145] The samples were masked with the logos indicating the relevant cancer and metastasis and delivered to an immunohistochemical (IHC) staining supplier (Nanjing Frese Biotechnology Co., Ltd.). The samples in the liver cancer lymph node metastasis group, the colorectal cancer lymph node metastasis group, and the breast cancer lymph node metastasis group were subjected to immunohistochemical (IHC) staining in a blind test according to the scheme provided by the immunohistochemical (IHC) staining supplier, wherein PHGDH antibody (e.g., PHGDH antibody with catalog number #ab240744 from Abcam) was used for direct detection. After immunohistochemical (IHC) staining, PHGDH immunohistochemical staining was scored.

[0146] PHGDH immunohistochemical staining score = immunohistochemical staining intensity score × immunohistochemical staining area score; where, ■The immunohistochemical staining intensity was scored as follows: no staining for 0 points, light brown for 1 point, brown for 2 points, and dark brown for 3 points; ■The immunohistochemical staining area score (the ratio of tumor cell positive staining area to total tumor cell area) is: no positive staining is 0 points, <25% is 1 point, ≥25 to <50% is 2 points, ≥50 to <75% is 3 points, and ≥75% is 4 points.

[0147] The PHGDH immunohistochemistry (IHC) scores of each sample are shown in Table 3. The IHC score results of each sample were correlated with the results of the markers indicating the relevant cancer and metastasis conditions, and the results were confirmed to be consistent through pathological medical examination.

[0148] Table 3: Sample IHC scores and corresponding labels

[0149] The above immunohistochemical staining (IHC) results correspond to the sample conditions, indicating that PHGDH can be used as a biomarker to classify disseminated tumor cells (DTCs), predict tumor metastasis and colonization, screen and / or identify immune escape DTCs, and / or evaluate the prognosis of cancer treatment, and the results are accurate.

[0150] In addition, the above results were confirmed by the pathologist again and showed that: 1) When the IHC score of the sample is higher than the pre-specified immunohistochemistry (IHC) score value (i.e., the reference level), the disseminated tumor cell (DTC) is an immune escape DTC, and if it is lower than this value, it is a non-immune escape DTC; 2) When the IHC score of the sample is higher than the pre-specified immunohistochemistry (IHC) score value (i.e., the reference level), cancer metastasis colonization is likely to occur, while when it is lower than this value, cancer metastasis colonization is unlikely to occur; 3) When the IHC score of the sample is higher than a pre-specified immunohistochemistry (IHC) score value (ie, a reference level), the subject has a poor prognosis; and when it is lower than this value, it indicates that the subject has a good prognosis.

[0151] The above examples show that phosphoglycerate dehydrogenase (PHGDH), as a new type of disseminated tumor cell (DTC) biomarker, can be used for disseminated tumor cell (DTC) prediction, diagnosis, screening and identification of immune escape disseminated tumor cells, specifically, DTC typing, immune escape DTC screening and / or identification, tumor metastasis colonization prediction and / or cancer treatment prognosis evaluation. The above reference can make systemic treatments such as targeted therapy and immunotherapy for distant metastasis of cancer more targeted, and provide patients with more personalized targeted treatment.

[0152] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. Use of phosphoglycerate dehydrogenase (PHGDH) as a biomarker or a substance detecting PHGDH as a biomarker in the preparation of a product for detecting the level of PHGDH in a sample obtained from a subject to perform disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis assessment.

2. The use according to claim 1, wherein The DTC typing includes typing the DTC as immune escape DTC or non-immune escape DTC according to the PHGDH level in the sample obtained from the subject; for example, if the PHGDH level in the sample obtained from the subject is higher than the reference level, the DTC is typed as immune escape DTC, and if the PHGDH level is lower than the reference level, the DTC is typed as non-immune escape DTC; The immune escape DTC screening and / or identification includes screening and / or identifying immune escape DTC according to the PHGDH level in the sample obtained from the subject; for example, if the PHGDH level in the sample obtained from the subject is higher than the reference level, the DTC in the sample is identified as an immune escape DTC or the immune escape DTC is screened out accordingly; The cancer metastasis colonization prediction includes predicting the possibility of cancer metastasis colonization in the subject according to the PHGDH level in the sample obtained from the subject; for example, if the PHGDH level in the sample obtained from the subject is higher than the reference level, the subject is prone to cancer metastasis colonization; and if the PHGDH level is lower than the reference level, the subject is not prone to cancer metastasis colonization; The cancer treatment prognosis assessment includes assessing a subject suffering from cancer and having received treatment (e.g., a subject suffering from primary cancer and having received treatment for the primary cancer and / or a subject suffering from primary cancer and having received treatment for the primary cancer and receiving preventive treatment for cancer metastasis) as having a good or poor treatment prognosis based on the PHGDH level in the sample obtained from the subject; for example, if the PHGDH level in the sample obtained from the subject is higher than the reference level, the subject is assessed to have a poor prognosis; and if the PHGDH level is lower than the reference level, the subject is assessed to have a good prognosis.

3. The use according to any one of claims 1 to 2, wherein The PHGDH level is determined by the gene expression level, protein expression level and / or protein activity level of PHGDH; wherein the gene expression level of PHGDH includes the nucleic acid expression level or the mRNA expression level; For example, the nucleic acid expression level is determined by Western blot, quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR), RNA-Seq, multiplex qPCR or RT-qPCR, microarray analysis, SAGE, MassARRAY technology, in situ hybridization (e.g., FISH), etc.; For example, the mRNA expression level is measured by real-time quantitative PCR (qRT-PCR), RNA-Seq, PCR, qPCR, RT-PCR, in situ hybridization, gene expression profiling, gene expression serial analysis, microarray analysis, etc.; preferably, the mRNA expression level is measured by qRT-PCR, more preferably, the real-time quantitative PCR (qRT-PCR) is measured by forward primer ATGGCCTTCGCAAATCTGC (SEQ ID NO: 4) and reverse primer AGTTCAGCTATCAGCTCCTCC (SEQ ID NO: 5); For example, the protein expression level and / or protein activity level of PHGDH is determined by mass spectrometry (MS), reverse transcriptase-polymerase chain reaction (RT-PCR), microarray analysis, serial analysis of gene expression (SAGE), gene expression analysis by massively parallel signature sequencing (MPSS), immunoassay (e.g., ELISA), immunohistochemical staining (IHC), transcriptomics and proteomics techniques; Preferably, the protein expression level and / or protein activity level of PHGDH is determined by immunohistochemistry (IHC), for example, immunofluorescence, radioimmunoassay, immunoenzyme labeling, immunogold and silver assay; more preferably, by immunoenzyme labeling, particularly preferably by direct detection using PHGDH antibody; Preferably, the protein expression level and / or protein activity level of PHGDH is determined by immunohistochemical staining (IHC) scoring, wherein the PHGDH immunohistochemical staining (IHC) score = immunohistochemical staining intensity score × immunohistochemical staining area score; wherein the immunohistochemical staining intensity score is: no staining is 0 points, light brown is 1 point, brown is 2 points, and dark brown is 3 points; the immunohistochemical staining area score (the ratio of tumor cell positive staining area to the total tumor cell area) is: no positive staining is 0 points, <25% is 1 point, ≥25 to <50% is 2 points, ≥50 to <75% is 3 points, ≥75% is 4 points.

4. The use according to any one of claims 1 to 3, wherein The PHGDH level in the sample obtained from the subject is the median value, mean value or standard value determined by statistical methods of the gene expression level, protein expression level and / or protein activity level measured in the sample obtained from the subject; and / or the reference level is: (1) the median value, mean value or standard value determined by statistical methods of the gene expression level, protein expression level and / or protein activity level of PHGDH in a sample obtained from the subject at a previous time point; (2) the median, mean or standard value determined by statistical methods of the gene expression level, protein expression level and / or protein activity level of PHGDH in the reference population; or (3) A pre-specified PHGDH level, for example, a pre-specified immunohistochemistry staining (IHC) score value.

5. The use according to any one of claims 2 to 4, wherein the PHGDH level in the sample obtained from the subject is higher than the reference level comprising: The PHGDH level in the sample obtained from the subject is increased by about 1% or more or increased by about 1-fold or more relative to (1) the median, mean or standard value determined by statistical methods for the gene expression level, protein expression level and / or protein activity level of PHGDH in the sample obtained from the subject at a previous time point or (2) the median, mean or standard value determined by statistical methods for the gene expression level, protein expression level and / or protein activity level of PHGDH in a reference population; and / or The PHGDH level in the sample obtained from the subject is higher than a pre-specified PHGDH level value, for example, a pre-specified immunohistochemistry staining (IHC) score value; preferably, the immunohistochemistry staining (IHC) score is 6.

6. The use according to any one of claims 1 to 5, wherein The PHGDH is a substance selected from the group consisting of genomic DNA, cDNA, mRNA, protein, or any functional fragment of PHGDH; For example, the PHGDH is a molecule comprising the following sequence: (a) a genomic DNA having a sequence such as that shown in SEQ ID NO: 1 or a functional fragment thereof; (b) mRNA having a sequence such as that shown in SEQ ID NO: 2 or a functional fragment thereof; (c) a PHGDH protein having a sequence such as that shown in SEQ ID NO: 3 or a functional fragment thereof; (d) A molecule or a functional fragment thereof having a sequence homology or identity of more than 70% with any one of (a) to (c) and capable of indicating the level of PHGDH in a sample.

7. The use according to any one of claims 1 to 6, wherein The subject is a mammal, such as a human, a non-human primate (e.g., an ape), a rodent (e.g., a rat, a mouse, a guinea pig), a pet (e.g., a cat, a dog), or a livestock (e.g., a horse, a cow, a sheep, a pig, a rabbit); and / or The subject is selected from the following group: a subject suspected of having primary cancer; a subject suffering from primary cancer but not yet receiving treatment for primary cancer; a subject suffering from primary cancer and having received treatment for primary cancer; a subject suffering from primary cancer and having received treatment for primary cancer but not yet receiving preventive treatment for cancer metastasis; a subject suffering from primary cancer and having received treatment for primary cancer and receiving preventive treatment for cancer metastasis; or a subject having one or more of the foregoing conditions; preferably a subject suspected of having metastatic colonization based on previous medical history and imaging examination results (e.g., CT, MRI, etc.); and / or The sample is selected from: tissue obtained from the subject, such as fresh samples, frozen samples, fixed samples (such as formalin-fixed samples, paraffin-embedded samples); preferably, biopsy tissue suspected of metastasis and colonization based on the subject's previous medical history and imaging examination results (such as CT, MRI, etc.).

8. The use according to any one of claims 1 to 7, wherein The subject has a primary cancer, for example, hepatocellular carcinoma, cholangiocarcinoma, prostate cancer, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous carcinoma, peritoneal cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer or uterine cancer, salivary gland cancer, kidney cancer, vulvar cancer, thyroid cancer, gastric cancer, melanoma or cervical cancer; preferably hepatocellular carcinoma, breast cancer, colorectal cancer, lung adenocarcinoma; and / or The subject has a primary cancer and has and / or is at risk of cancer metastasis suspected to be caused by the primary cancer, e.g., metastasis to the lung (e.g., lung metastasis from liver cancer), bone, brain, or lymph node (e.g., lymph node metastasis from liver cancer) caused by the primary cancer.

9. The use according to any one of claims 1 to 8, wherein The product is a kit, for example a kit comprising a combination of reagents and a detection device; and / or The product comprises reagents, equipment and / or devices for determining the level of PHGDH in a sample, for example, the reagents for determining the level of PHGDH in the sample include one or more selected from the following group: probes, gene chips, primers, antibodies, protein chips, chemical small molecules with detection specificity for PHGDH; and / or The product is used to determine the PHGDH level in a sample by a method selected from the following group: real-time quantitative reverse transcription PCR, biochip detection, Southern blotting, Northern blotting in situ hybridization, immunofluorescence, immunohistochemical staining (e.g., immunoenzyme labeling), or Northern blotting or in situ hybridization; and / or The reagent for determining the PHGDH level in the sample is directly or indirectly labeled with a detectable label, for example, the detectable label is selected from: radioisotopes, fluorescent groups, chemiluminescent moieties, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions or ligands.

10. A product for performing disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis assessment by detecting the PHGDH level in a subject sample, For example, the product comprises reagents, equipment and / or devices for detecting the level of PHGDH in the sample; and / or For example, the product comprises one or more contents corresponding to the features defined in any one of claims 1-9.

Images