Ovarian cancer molecular marker SEMA3D and application thereof

Abstract

The invention discloses an ovarian cancer molecular marker SEMA3D and application thereof, and relates to a biomarker related to ovarian cancer metastasis, in particular to an SEMA3D gene as an ovarian cancer diagnostic marker and application thereof. The invention finds that SEMA3D is related to ovarian cancer metastasis for the first time, early diagnosis of ovarian cancer is realized by detecting the expression level of SEMA3D, and metastasis of ovarian cancer cells can be inhibited by inhibiting the expression of SEMA3D. Compared with normal people, SEMA3D in ovarian cancer tissues, ascites and serum is obviously increased, and the SEMA3D can be used for preparing products and kits for diagnosing ovarian cancer. The invention provides a new therapeutic target, provides a theoretical basis for the metastasis mechanism of the ovarian cancer, and has great clinical significance.

Description

Technical Field

[0001] The present invention belongs to the field of diagnosis and treatment of ovarian cancer, and specifically relates to an ovarian cancer molecular marker SEMA3D and application thereof. Background Art

[0002] Ovarian cancer remains the fifth leading cause of cancer death among women worldwide and is the gynecological malignancy with the highest mortality rate. Due to the lack of typical clinical symptoms and effective diagnostic methods, most ovarian cancer patients are already in the late stage when they are discovered, with extensive abdominal and distant metastases, which seriously endanger women's health and have a low five-year survival rate. Therefore, in-depth exploration of the molecular mechanism of ovarian cancer metastasis has great clinical significance. Finding early diagnostic markers and therapeutic targets for ovarian cancer is of great significance for improving the diagnosis and treatment outcomes of ovarian cancer patients.

[0003] SEMA3D was originally discovered as an axon guidance molecule. As a secretory protein, it has been confirmed in recent years to play an important role in the occurrence and development of cancer. Recent studies have found through analysis of the TCGA database that the overall survival rate and prognosis of bladder cancer patients with downregulated SEMA3D are better than those with high expression of SEMA3D, and it is speculated that it may be a high-risk molecule for bladder cancer. At the same time, it was found that knocking out SEMA3D in pancreatic ductal adenocarcinoma can effectively inhibit the migration and invasion of adenocarcinoma. However, the role of SEMA3D in ovarian cancer is still unclear, so it is important to explore the importance of SEMA3D as a molecular marker and therapeutic target for ovarian cancer. Summary of the invention

[0004] In view of the above problems, the purpose of the present invention is to provide an ovarian cancer molecular marker SEMA3D and its application.

[0005] The objective of the present invention is achieved through the following technical solutions:

[0006] As a first aspect, a molecular marker for diagnosing ovarian cancer is provided, which is SEMA3D.

[0007] As a second aspect, there is provided the use of a SEMA3D gene or a reagent for detecting the expression level of a protein encoded by the SEMA3D gene in the preparation of a product for auxiliary diagnosis of ovarian cancer.

[0008] Furthermore, the product for auxiliary diagnosis of ovarian cancer includes: a test kit.

[0009] Furthermore, the kit is used to quantitatively detect the expression level of SEMA3D.

[0010] Furthermore, the kit performs detection based on real-time quantitative reverse transcription PCR, immunohistochemical staining, enzyme-linked immunosorbent assay or mass spectrometry sequencing; the kit contains specific primers for amplifying the SEMA3D gene or antibodies that specifically bind to the SEMA3D protein.

[0011] Furthermore, the kit for diagnosing ovarian cancer by detecting the expression level of SEMA3D by immunohistochemical staining or enzyme-linked immunosorbent assay includes an antibody that specifically binds to SEMA3D.

[0012] Furthermore, the kit for diagnosing ovarian cancer by detecting the expression level of SEMA3D by real-time quantitative reverse transcription PCR includes at least a pair of specific primers, as shown in SEQ ID NO.1 and SEQ ID NO.2.

[0013] As a third aspect, provided is the use of an inhibitor for inhibiting the expression level of the SEMA3D gene in the preparation of a drug for treating ovarian cancer and / or a drug for inhibiting ovarian cancer metastasis.

[0014] Furthermore, the inhibitor comprises at least one of shRNA, siRNA, peptide or antibody of SEMA3D.

[0015] Furthermore, the shRNA of SEMA3D is shown in SEQ ID NO.5 and SEQ ID NO.6.

[0016] The beneficial effects of the present invention are as follows: the present invention first discovered that SEMA3D is significantly highly expressed in tissue samples, ascites and serum of ovarian cancer, and early diagnosis of ovarian cancer is achieved by detecting the expression of SEMA3D in subjects. Knocking down the expression of SEMA3D can significantly inhibit the metastatic ability of ovarian cancer, providing a new therapeutic target for the treatment of ovarian cancer. The present invention provides a theoretical basis for the study of the mechanism of ovarian cancer, indicating that SEMA3D can be used as a molecular marker and target for diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The schematic diagram of the expression level of SEMA3D in the ascites of ovarian cancer patients and normal patients detected by ELISA and the statistical results;

[0018] Figure 2 This is a schematic diagram of the expression level of SEMA3D in the plasma of ovarian cancer patients and normal patients detected by ELISA and the statistical results;

[0019] Figure 3The figure is a schematic diagram of the expression content and statistical results of SEMA3D in tissue samples of ovarian cancer patients and normal patients detected by immunohistochemistry; wherein A is a representative figure of the expression of SEMA3D in tissue samples of ovarian cancer patients and normal patients detected by immunohistochemistry, and B is a statistical figure of the expression of SEMA3D in tissue samples of ovarian cancer patients and normal patients;

[0020] Figure 4 This is a schematic diagram of the expression level of SEMA3D mRNA after knocking down SEMA3D in ovarian cancer cells using two shRNAs;

[0021] Figure 5 This is a schematic diagram of the results of knocking down SEMA3D secretory protein content in ovarian cancer cells using two shRNAs;

[0022] Figure 6 The statistical graphs of the results of inhibiting the expression of SEMA3D to inhibit the migration and invasion of ovarian cancer cells, wherein A is the statistical graph of the results of inhibiting the expression of SEMA3D to inhibit the migration and invasion of ovarian cancer cells, and B is the statistical graph of the results of inhibiting the expression of SEMA3D to inhibit the invasion and invasion of ovarian cancer cells;

[0023] * represents p<0.05, ** represents p<0.01, *** represents p<0.001, and **** represents p<0.0001.

[0024] Specific implementation method

[0025] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0026] The present invention provides a molecular marker SEMA3D for diagnosing ovarian cancer. The sources of SEMA3D include but are not limited to tissues, plasma and ascites.

[0027] The present invention also provides an application of a molecular marker SEMA3D in the preparation of a diagnostic kit for ovarian cancer, wherein the kit diagnoses ovarian cancer by quantitatively detecting the expression level of SEMA3D. The kit can detect the expression level of the SEMA3D gene in a sample based on real-time quantitative reverse transcription PCR, immunohistochemical staining, enzyme-linked immunosorbent assay or mass spectrometry sequencing. The expression level of SEMA3D detected by real-time quantitative reverse transcription PCR comprises at least a pair of specific primers, as shown in SEQ ID NO.1 and SEQ ID NO.2, and the expression level of SEMA3D detected by immunohistochemistry and enzyme-linked immunosorbent assay comprises an antibody specifically binding to SEMA3D.

[0028] The present invention also provides a drug for treating ovarian cancer, the drug comprising an agent for inhibiting SEMA3D. The agent comprises but is not limited to one of shRNA, siRNA, peptide or antibody of SEMA3D. In the embodiment of the present invention, the sequence of shRNA of SEMA3D is shown in SEQ ID NO.5 and SEQ ID NO.6.

[0029] The present invention also provides an application of the above medicine in treating ovarian cancer.

[0030] Example 1: Differential expression of SEMA3D in plasma and ascites of ovarian cancer patients

[0031] 1. Specimen source

[0032] The specimens were selected from ovarian tumor tissues and benign ovarian tumor tissues removed during surgery in the hospital.

[0033] 2. Case screening

[0034] All patients with ovarian tumors and benign ovarian tumors were newly diagnosed and had signed informed consent. None of them had received chemotherapy, radiotherapy or other treatments before surgery. There was no personal history of malignant tumors or major diseases in other parts of the body.

[0035] 3. Reagents used

[0036] Table 1: Reagents used

[0037]

[0038]

[0039] 4. Equipment used

[0040] Table 2: Equipment used

[0041]

[0042]

[0043] 5. ELISA

[0044] (1) Sample collection and storage: Plasma samples use EDTA or heparin as an anticoagulant. Within 30 minutes after sample collection, centrifuge at 1000 g for 15 minutes at 4°C, and remove the supernatant for immediate testing. For ascites samples, centrifuge at 1000 g for 15 minutes at 4°C, and remove the supernatant for immediate testing within 30 minutes after sample collection.

[0045] (2) Move all reagents to room temperature and equilibrate for at least 30 minutes.

[0046] (3) Sample addition: Set up standard wells and sample wells. Add 100 μL of standard or sample to be tested to each well, shake gently to mix, cover with plate sticker, and incubate at 37°C for 2 hours. Discard the liquid, spin dry, and do not wash.

[0047] (4) Add 100 μL of biotin-labeled antibody working solution to each well, cover with a new plate sticker, and incubate at 37°C for 1 hour.

[0048] (5) Discard the liquid in the wells, spin dry, wash the plate three times, soaking for 2 minutes each time, 200 μL per well, and spin dry.

[0049] (6) Add 100 μL of horseradish peroxidase-labeled avidin working solution to each well, cover with a new plate sticker, and incubate at 37°C for 1 hour.

[0050] (7) Discard the liquid in the wells, spin dry, wash the plate 5 times, soak for 2 minutes each time, 200 μL per well, and spin dry.

[0051] (8) Add 90 μL of substrate solution to each well and incubate at 37°C in the dark for 15-30 minutes.

[0052] (9) Add 50 μL of stop solution to each well to terminate the reaction.

[0053] (10) Within 5 minutes after the reaction was terminated, the optical density (OD value) of each well was measured in sequence using a microplate reader at a wavelength of 450 nm.

[0054] 6. Statistical analysis

[0055] The data results in the study are expressed as Mean ± SD, and statistical analysis was performed using GraphPad Prism 9.0 software. Normally distributed data were analyzed using Student's t-test, and non-normally distributed data were analyzed using Mann-Whitney Utest. * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, and **** represents p < 0.0001. All experiments in this study were repeated at least three times independently.

[0056] 7. Results

[0057] The results are as follows Figure 1 As shown in the figure, compared with the ascites of benign ovarian cancer patients, the expression level of SEMA3D in the ascites of ovarian cancer patients was significantly upregulated, and the difference was statistically significant (P<0.05). Figure 2 As shown, compared with the plasma of benign ovarian cancer patients, the expression level of SEMA3D in the plasma of ovarian cancer patients was significantly upregulated, and the difference was statistically significant (P<0.05).

[0058] Example 2: Differential expression of SEMA3D in ovarian cancer patient tissues

[0059] 1. Fix the fresh tissue sample with 4% paraformaldehyde, dehydrate it with low to high concentration alcohol as a dehydrating agent, and then put it in xylene for transparent treatment. Put it into melted paraffin after transparent treatment, embed it after the paraffin completely immerses the tissue, let it cool and solidify into a block, and then cut it into thin slices with a slicer. Iron the cut slices in hot water, stick them on a slide, and dry them in a constant temperature box.

[0060] 2. Place the paraffin tissue sections in xylene to remove the paraffin in the sections, then soak them in alcohol from high concentration to low concentration, and finally wash them with distilled water.

[0061] 3. Perform antigen retrieval in boiling citrate buffer.

[0062] 4. Rinse with PBS three times, 5 minutes each time, and then block with 3% hydrogen peroxide.

[0063] 5. Spread the sections flat in a humidified box and block with 5% BSA antigen at room temperature for 60 minutes.

[0064] 6. Use filter paper to absorb the blocking solution, add the diluted primary antibody working solution, and incubate at 4°C overnight.

[0065] 7. Remove the slices from the dark box and rinse them with PBS three times, 5 minutes each time.

[0066] 8. Use filter paper to absorb excess water, add diluted secondary antibody working solution, and incubate at room temperature for 30 minutes.

[0067] 9. Rinse with PBS three times, 5 minutes each time, absorb excess water, add 1×DAB color developing solution drops to the paraffin tissue, observe the color development reaction under a microscope, and stop the color development with tap water when it turns brown.

[0068] 10. Seal the slides, scan and photograph the sections, and analyze the images using K-Viewer software.

[0069] 11. Statistical analysis: The data results in the study were statistically analyzed using GraphPad Prism 9.0 software. The expression of SEMA3D in normal and ovarian cancer patients was tested using the chi-square test. **** represents p < 0.0001.

[0070] 12. The results are as follows Figure 3 As shown, the expression of SEMA3D in ovarian cancer tissues was significantly higher than that in benign ovarian cancer tissues.

[0071] Example 3: Effect of SEMA3D on ovarian cancer cell metastasis

[0072] 1. Cell recovery

[0073] After taking out the frozen cells from -80℃ or liquid nitrogen tank, quickly place them in a 37℃ constant temperature water bath to thaw the cells quickly. After adding 5mL of fresh complete culture medium to a sterile centrifuge tube, quickly add the thawed cells to the sterile centrifuge tube with complete culture medium, and centrifuge at 1000rpm for 5 minutes at room temperature. Discard the supernatant, resuspend with 1mL of culture medium, and then inject the cell suspension into a cell culture bottle or cell culture dish with a certain amount of complete culture medium. Shake slightly to evenly cover the bottom of the bottle or dish with cells, and place the container in a constant temperature incubator at 37℃ and 5% CO2.

[0074] 2. Conventional cell culture

[0075] Human ovarian cancer cell line A2780-M was cultured in RPMI-1640 medium containing 10% FBS, penicillin (100 U / mL), and streptomycin (0.1 mg / mL). The cells were cultured in a constant temperature incubator at 37°C and 5% CO2. The cells were cultured and subcultured every 2-3 days. The cells were used for subsequent experiments when they were in the logarithmic growth phase.

[0076] 3. RNA Extraction

[0077] (1) Taking a six-well plate as an example, when the cell fusion density reaches about 80%, add PBS to wash the six-well plate 2-3 times, discard the PBS, add about 1 mL of Trizol to each well, and let it stand at room temperature for 15 minutes to allow the cells to fully lyse. After gently pipetting and mixing, transfer the suspension to a 1.5 mL RNase-free EP tube.

[0078] (2) Add 200 μL of chloroform to each tube, shake vigorously for 15 seconds, and let stand for 15 minutes.

[0079] (3) Place the tube in a pre-cooled centrifuge and centrifuge at 4°C, 14,000 rpm for 15 minutes. The liquid in the tube will be separated into three layers. Use a 200 μL pipette tip to carefully pipette the upper aqueous phase into a new 1.5 mL RNase-free EP tube. Be careful not to pipette the middle layer.

[0080] (4) Add an equal volume of isopropanol to the upper aqueous phase, mix thoroughly, and let stand for 15 minutes.

[0081] (5) Centrifuge at 4°C, 14,000 rpm for 15 minutes. A white precipitate will be visible at the bottom of the tube. Discard the supernatant.

[0082] (6) Add pre-cooled 75% ethanol to the tube, centrifuge at 4°C, 7500 rpm for 5 minutes, discard the supernatant, and repeat the wash.

[0083] (7) Discard the supernatant, invert the EP tube on absorbent paper, let it dry, and then dissolve the precipitate with 10-20 μL of DEPC water.

[0084] (8) Use Nanodrop 2000 to measure the concentration of RNA solution and the purity of RNA for subsequent experiments or store at -80°C.

[0085] 4. qRT-PCR

[0086] (1) Removal of DNA from RNA

[0087] According to the Takara reagent instructions, prepare the following system. (Take 20μL system and 1μgRNA as an example)

[0088] Table 3: DNA removal reaction system

[0089] Reagents Reaction volume (μL) 5×gDNAEraser Buffer 2 gDNA Eraser 1 Total RNA 1μg / measured RNA concentration RNase Free H2O Fill up to 10

[0090] Reaction conditions: 42℃ for 2 minutes, permanent 4℃

[0091] (2) RNA reverse transcription into cDNA

[0092] According to the Takara reagent instructions, configure the following system. (Take 20μL system as an example)

[0093] Table 4: Reverse transcription reaction system

[0094] Reagents Reaction volume (μL) PrimeScript RT Enzyme Mix I 1 RT Primer Mix 1 5×PrimeScript Buffer 2 4 RNase Free H2O 4 Total 10

[0095] Gently mix the prepared 10μL with the 10μL system used to remove DNA from RNA in the first step, and perform the following reaction in a PCR instrument. The reaction conditions are 37℃ for 15 minutes, 85℃ for 5 seconds, and 4℃ permanently.

[0096] (3) qPCR reaction

[0097] According to the Takara reagent instructions, configure the following system. (Take 20μL system as an example)

[0098] Table 5: qPCR reaction system table

[0099] Reagents Reaction volume (μL) TB Green Premix Taq TM 5 ROX Reference Dye II 0.2 Forward primer 0.2 Reverse primer 0.2 cDNA 1 ddH2O 3.4 Total 10

[0100] The reaction conditions were: 95°C for 10 seconds, [95°C × 5 seconds + 60°C × 30 seconds] × 40 cycles

[0101] Data processing: Three replica wells were set for each sample. After amplification, the melting curve of each sample was confirmed to be normal. The Ct value of each well was derived. If the difference in Ct values ​​between replica wells was less than 0.5, it was considered that the repeatability within the group was good. The average value was taken as the Ct value of the sample. GAPDH was used as the internal reference and 2 -ΔΔCt The relative expression level of the target gene was calculated by this method.

[0102] Table 6: Detection fragment primer sequences

[0103]

[0104] 5. Lentiviral transfection

[0105] (1) Lentivirus packaging: Prepare two 1.5 ml EP tubes, add 500 μL OPTI-MEM + 36 μL PEI to one tube, and add 500 μL OPTI-MEM + 4.4 μg PSPA + 1.8 μg PMD2.G + 5.8 μg sh-SEMA3D-1 or shSEMA3D-2 to the other tube. After standing for 5 minutes, mix the two and stand for another 15 minutes. Transfect the mixture into adherent 293T cells. After 48 hours of transfection, collect the supernatant and filter.

[0106] (2) A2780-M cells were inoculated in a culture dish. After the cells adhered to the wall, the culture medium containing 20% ​​serum was replaced, 2 ml of the packaged virus solution was added, and 8 μl of 10 μg / μl ploybrene was added to promote viral integration. After 24 hours of infection, the culture medium was replaced with 10% serum.

[0107] (3) 48 h after infection, cells were screened using complete medium containing 2 μg / ml puromycin, and the medium was changed daily.

[0108] (4) After cell screening, qRT-PCR was used to detect the shRNA transfection efficiency. The results were as follows: Figure 4 The knockdown efficiency was greater than 50%.

[0109] The sequence of the transfected shRNA (an RNA sequence with a tight hairpin loop) is as follows:

[0110] Table 7: Sequence Listing of shRNA

[0111] Gene name sequence SEMA3D shRNA-1 5'-3':GCTGCTTTCAAATAGCTGTAT(SEQ ID NO.5) SEMA3D shRNA-2 5'-3': GCTCTCGATATGCTCCACTT(SEQ ID NO.6)

[0112] 6. ELISA

[0113] The supernatant of cells transfected with sh-NC, sh-SEMA3D-1 and sh-SEMA3D-2 was collected and centrifuged at 1000 g at 4°C. The expression of SEMA3D in the supernatant was detected by ELISA using the same method as in Example 1. The results are shown in FIG. Figure 5 The knockdown efficiency was greater than 50%.

[0114] 7. Detection of migration and invasion ability of ovarian cancer cells

[0115] (1) A2780-M cells transfected with sh-SEMA3D-1, sh-SEMA3D-2 or sh-NC were trypsinized and resuspended in serum-free medium to a certain concentration of cell suspension for later use (2.5x10 5 / mL).

[0116] (2) After adding or not adding 200 μL of BD gel diluted with serum-free medium to the upper chamber of the Transwell, add 200 μL of the cell suspension resuspended in the serum-free medium prepared previously, add 500 μL of complete medium to the lower chamber, and carefully place the upper chamber into the matching lower chamber, taking care not to generate bubbles. After the Transwell plate has been placed in the incubator for a certain period of time, take out the chamber.

[0117] (3) Prepare crystal violet dye, discard the liquid in the chamber, place the chamber in a well plate containing crystal violet dye, fix and stain the invaded or migrated cells, rinse with running water, carefully wipe off the cells on the inner side that have not invaded or migrated, and take pictures and count them under a microscope.

[0118] 8. Statistical analysis

[0119] The data results in the study are expressed as Mean ± SD, and statistical analysis was performed using GraphPad Prism 9.0 software. Normally distributed data were analyzed using Student's t-test, and non-normally distributed data were analyzed using Mann-Whitney Utest. * represents p < 0.05, ** represents p < 0.01, *** represents p < 0.001, and **** represents p < 0.0001. All experiments in this study were repeated at least three times independently.

[0120] 9. Results

[0121] Results Figure 6 , indicating that inhibition of SEMA3D can significantly inhibit the migration and invasion of ovarian cancer cells.

[0122] The above embodiments are only used to illustrate the present invention but are not limited thereto. It should be understood that there may be various modifications or replacements without departing from the scope of the present invention.

Claims

1. Use of the SEMA3D gene or a reagent for detecting the expression level of the protein encoded by the SEMA3D gene in the preparation of a product for auxiliary diagnosis of ovarian cancer.

2. The use according to claim 1, characterized in that: The product for auxiliary diagnosis of ovarian cancer includes: a kit for quantitatively detecting the expression level of SEMA3D.

3. The use according to claim 2, characterized in that: The kit detects the expression level of the SEMA3D gene in the sample by real-time quantitative reverse transcription PCR, immunohistochemical staining, enzyme-linked immunosorbent assay or mass spectrometry sequencing.

4. The use according to claim 3, characterized in that: The kit contains specific primers for amplifying the SEMA3D gene or antibodies that specifically bind to the SEMA3D protein.

5. The use according to claim 3, characterized in that: The kit for detecting the expression level of SEMA3D by real-time quantitative reverse transcription PCR includes at least a pair of specific primers, as shown in SEQ ID NO.1 and SEQ ID NO.

2.

6. Use of an inhibitor of SEMA3D gene expression level in the preparation of a drug for treating ovarian cancer and / or a drug for inhibiting ovarian cancer metastasis.

7. The use according to claim 6, characterized in that: The inhibitor includes at least one of shRNA, siRNA, peptide or antibody of SEMA3D.

8. The use according to claim 7, characterized in that: The shRNA of SEMA3D is shown as SEQ ID NO.5 and SEQ ID NO.6.

Images