Biosensor for detecting miR-21 and application thereof

Abstract

The invention belongs to the field of electrochemical biosensors, particularly relates to a biosensor for high-performance detection of miR-21 in a complex sample, and further discloses application of the biosensor. According to the electrochemical biosensor for detecting the miR-21 in the complex sample, a multi-stage signal amplification system is constructed by combining entropy-driven amplification (ESDA), transcription amplification mediated by T7RNA polymerase and side cutting activity of CRISPR-Cas13a, the sensitivity is remarkably enhanced, and ultra-low-concentration miR-21 which is difficult to recognize by a traditional method can be detected.

Description

Technical Field

[0001] The present invention belongs to the field of electrochemical biosensors, and in particular relates to a biosensor for high-performance detection of miR-21 in complex samples, and further discloses its application. Background Art

[0002] MicroRNAs (miRNAs) are key molecules in gene regulation, which can participate in various biological processes such as cell differentiation, proliferation and apoptosis. Among the many miRNAs, miR-21 has attracted much attention due to its abnormally high expression in various cancers such as breast cancer, lung cancer, and colorectal cancer. In particular, its overexpression is closely related to tumor growth, metastasis and poor prognosis. Therefore, how to accurately detect miR-21 at extremely low concentrations is crucial for the early diagnosis, prognosis assessment and treatment monitoring of cancer. However, due to the significant limitations of traditional detection methods (such as qRT-PCR, Northern blotting and microarray analysis), such as cumbersome sample pre-treatment, dependence on expensive instruments, time-consuming and labor-intensive, and insufficient sensitivity, traditional methods are difficult to meet the detection needs of trace miRNA in early cancer diagnosis.

[0003] In recent years, electrochemical biosensors have become a research hotspot for miRNA detection due to their high sensitivity, rapid response and cost-effectiveness. It can achieve quantitative detection by converting biological recognition events into electrical signals, and is particularly suitable for the detection of low-abundance targets (such as miR-21). At the same time, the CRISPR-Cas system (especially CRISPR-Cas13a) provides a new tool for nucleic acid detection by virtue of its programmability, specificity and non-specific RNA cleavage activity after RNA recognition. The "side-cutting" activity of CRISPR-Cas13a can amplify the detection signal, and the detection can be completed without thermal cycling, which significantly simplifies the operation process. In addition, T7 RNA polymerase can quickly generate a large amount of single-stranded RNA due to its efficient isothermal transcription ability, which is further combined with CRISPR-Cas13a to form a multi-stage signal amplification strategy.

[0004] At present, some studies have developed biosensors by integrating T7 RNA polymerase and CRISPR-Cas13a, and used the synergistic effect of transcription amplification and CRISPR signal amplification to improve the detection sensitivity, which has improved the accuracy of detection to a certain extent. However, this type of technology still faces multiple challenges: First, although existing methods can detect low-concentration miRNAs, in clinical early cancer diagnosis, the miRNA concentration may be below the detection limit of existing technologies, resulting in insufficient sensitivity; second, the multi-stage signal amplification process involves complex enzyme reaction steps, which are cumbersome to operate and easy to introduce errors, limiting its application in point-of-care diagnosis (POCT) scenarios; third, the high cost of preparing the CRISPR system and T7 RNA polymerase and the detection process that relies on precision instruments have further increased the technical threshold and usage costs. Therefore, this field expects to develop a better-performing electrochemical biosensor system that can accurately detect miR-21, which has positive significance for early cancer diagnosis and dynamic monitoring. Summary of the invention

[0005] To this end, the technical problem to be solved by the present invention is to provide a biosensor for high-performance detection of miR-21 in complex samples, wherein the biosensor constructs a multi-stage signal amplification system by combining entropy-driven amplification (ESDA), T7 RNA polymerase-mediated transcription amplification and the side-cutting activity of CRISPR / Cas13a, and realizes high-sensitivity detection through electrochemical signal output, thereby realizing ultra-sensitive detection of miR-21;

[0006] The second technical problem to be solved by the present invention is to provide the application of the above-mentioned biosensor for detecting miR-21.

[0007] The third technical problem to be solved by the present invention is to provide an electrochemical method for detecting miR-21 based on the biosensor, wherein the method has the advantages of high sensitivity and good specificity.

[0008] To solve the above technical problems, a biosensor for detecting miR-21 described in the present invention includes a hairpin probe amplification system, an entropy-driven cyclic amplification system, a T7 RNA polymerase transcription system, a CRISPR / Cas13a amplification system, and an electrode system.

[0009] Specifically, the biosensor for detecting miR-21, the hairpin probe amplification system includes a hairpin probe HP, Klenow enzyme, Nb.BbvCI, dNTPs, and an amplification buffer;

[0010] Preferably, the sequence of the hairpin probe HP is as follows: TCAACATCAGTCTGATAAGCTAGCTGAGGACGTTAGTAGCTTATCAGA CTGAATCTAACGT.

[0011] As a specific scheme that can be implemented, in the biosensor of the present invention, the hairpin probe HP forms a stable secondary structure by gradually cooling the single-stranded DNA from 90±5°C to room temperature. Subsequently, 50±0.2μL miR-21, 10±0.2μL 1±0.2μM HP, 2±0.2μL 150±5U / mL Klenow fragment, 3±0.2μL 100±10U / mL Nb.BbvCI, 25±0.2μL 2.5±0.2mM dNTPs and 10±0.2μL 10×NEB buffer are mixed to form a reaction system.

[0012] Specifically, the biosensor for detecting miR-21, the entropy-driven cyclic amplification system includes a Blocker, a T7 promoter, a Scaffold, and a Fuel chain;

[0013] Preferably, the sequence of the Blocker is as follows: CGCCATTGTCCAATGAAT;

[0014] Preferably, the sequence of the T7 promoter is as follows: GTCTGATAAGCTAGCTAATACGACTCACTATAGGG;

[0015] Preferably, the sequence of the Scaffold is as follows: ATTCATTGGACAATGGCGCGTATTAGCTAGCTTATCAGACTGATGTTGA;

[0016] Preferably, the sequence of the Fuel chain is as follows: ATAAGCTAGCTAATACGCGCCATTGTCCAATGAAT.

[0017] As a specific scheme that can be implemented, in the biosensor described in the present invention, in the entropy-driven cyclic amplification system, equal volumes of Blocker, T7 promoter and Scaffold are dissolved in PBS (0.1±0.2M, pH=7.4), heated to 95±5°C for incubation, and the above solution and Fuel chain are continuously added to the reaction system for entropy-driven cyclic amplification reaction for 1 hour to generate a large number of T7 promoters.

[0018] Specifically, the biosensor for detecting miR-21, the T7 RNA polymerase transcription system includes NTPs, T7 RNA polymerase, DNA template, RNase inhibitor, RNAPol reaction buffer;

[0019] Preferably, the sequence of the DNA template is as follows: CTACCTGCACTGTAAGCACTTTG CCCTATAGTGAGTCGTATTAGCTAGC TTATCAGAC.

[0020] As a specific scheme that can be implemented, in the biosensor described in the present invention, in the T7 RNA polymerase transcription system, in a 100 μL amplification reaction system, the system contains 40±0.2 μM NTPs, 30±0.2U T7 RNA polymerase, 1±0.2 μM DNA template, 20±0.2U RNase inhibitor and 2±0.2 μL 10×RNAPol reaction buffer.

[0021] Specifically, the biosensor for detecting miR-21, the CRISPR / Cas13a reaction system includes Cas13a protein, crRNA, and Cas13a reaction buffer;

[0022] Preferably, the sequence of the Cas13a protein is as follows: CAAAGUGCUUACAGUGCAGGUAG;

[0023] Preferably, the sequence of the crRNA is as follows: GACCACCCCAAAAAUGAAGGGGACUAAAACCUACCUGCACUGUAAGCACUUUG.

[0024] As a specific scheme that can be implemented, in the biosensor described in the present invention, the CRISPR / Cas13a reaction system includes 10±0.2nM Cas13a protein, 15±0.2nM crRNA, and 1×NEBuffer.

[0025] Specifically, the biosensor for detecting miR-21, the electrode system includes a working electrode, a counter electrode and a reference electrode;

[0026] Preferably, the working electrode comprises a gold electrode; more preferably comprises a gold electrode with a DNA1 probe anchored on the surface;

[0027] Preferably, the counter electrode comprises a platinum counter electrode;

[0028] Preferably, the reference electrode comprises an Ag / AgCl reference electrode;

[0029] Preferably, the sequence of the DNA1 probe is as follows: SH-TTGGATGGATATTGT-rUrU-CATATTCCATCCAA.

[0030] The present invention also discloses a method for constructing the biosensor for detecting miR-21, comprising the steps of respectively preparing the hairpin probe amplification system, the entropy-driven cyclic amplification system, the T7 RNA polymerase transcription system, and the CRISPR / Cas13a reaction system, and the step of constructing the electrode system;

[0031] Preferably, the step of preparing the hairpin probe amplification system further comprises the step of forming a hairpin probe HP with a stable secondary structure by cooling the single-stranded DNA from 85-95° C. (preferably 90° C.) to room temperature;

[0032] Preferably, the step of constructing the electrode system includes the step of anchoring the DNA1 probe on the surface of the gold working electrode, specifically including the step of immersing the electrode in a solution containing the DNA1 for incubation and fixation.

[0033] The invention also discloses the application of the biosensor for detecting miR-21 in the field of miR-21 detection.

[0034] The present invention also discloses a method for detecting miR-21 by electrochemical method, comprising the steps of detecting using the biosensor for detecting miR-21;

[0035] Preferably, the electrochemical method for detecting miR-21 comprises the following steps:

[0036] (1) preparing the hairpin probe amplification system according to a selected ratio, mixing it with miR-21 of different concentrations, and performing a first incubation; after the reaction is completed, inactivating the enzyme and terminating the reaction to obtain miR-21 amplification products of different concentrations, i.e., intermediate DNA;

[0037] (2) Dissolving the Blocker, T7 promoter and Scaffold in PBS according to the selected ratio and performing a second incubation to form a three-chain complex; continuing to add the amplification product of step (1) and the Fuel chain to mix and perform an entropy-driven cyclic amplification reaction to generate a large amount of T7 promoter;

[0038] (3) preparing the T7 RNA polymerase transcription system according to the selected ratio, adding the amplified product in step (2) and mixing, and performing a third incubation to perform transcription amplification;

[0039] (4) preparing the CRISPR / Cas13a reaction system according to the selected ratio, adding the amplified product of step (3), and performing a fourth incubation to activate the CRISPR / Cas13a system and target cleavage of the transcribed RNA to obtain an activation solution;

[0040] (5) Using the electrode system to detect the signal, the result is obtained.

[0041] Specifically, the electrochemical method for detecting miR-21 is:

[0042] In step (1), the temperature of the first incubation step is 35-40° C., and the incubation time is 1-3 hours; and / or,

[0043] In step (2), the temperature of the second incubation step is 90-98° C., and the incubation time is 3-8 minutes; and / or,

[0044] In step (2), the entropy-driven cyclic amplification reaction is carried out for 0.5-2 hours; and / or,

[0045] In step (3), the temperature of the third incubation step is 35-40° C., and the incubation time is 30-60 minutes; and / or,

[0046] In the step (4), the temperature of the fourth incubation step is 20-30° C., and the incubation time is 10-30 minutes.

[0047] The electrochemical biosensor for detecting miR-21 in complex samples of the present invention constructs a multi-stage signal amplification system by combining entropy-driven amplification (ESDA), T7 RNA polymerase-mediated transcription amplification and the side-cutting activity of CRISPR-Cas13a, which significantly enhances the sensitivity. The sensor significantly improves the sensitivity through the cascade amplification mechanism, and can detect ultra-low concentrations of miR-21 that are difficult to identify by traditional methods; the optimized reaction process greatly shortens the detection time, and does not require complex instruments, which is suitable for bedside rapid diagnosis; in particular, by integrating a variety of efficient enzymatic reactions, simplifying the operating steps and reducing the reagent cost, it provides feasibility for large-scale clinical applications.

[0048] The electrochemical biosensor for detecting miR-21 in complex samples of the present invention first triggers entropy-driven amplification to generate an intermediate DNA template through the target miR-21, and then T7 RNA polymerase efficiently transcribes to produce a large amount of RNA products, which ultimately activates the side-cutting activity of CRISPR-Cas13a, and achieves high-sensitivity detection through electrochemical signal output. The sensor not only overcomes the inherent defects of existing methods in terms of sensitivity, operational complexity and cost-effectiveness, but also provides a more efficient, convenient and economical solution for early diagnosis and dynamic monitoring of cancer, and has important clinical transformation potential.

[0049] The electrochemical biosensor for detecting miR-21 in complex samples described in the present invention optimizes existing methods, and these parameters are critical to achieving the highest performance of electrochemical biosensors. By systematically changing each parameter and monitoring the SWV signal, the optimal conditions for maximizing sensitivity and specificity can be determined for the detection of miR-21. The results showed that the optimized conditions (150U / mL of Klenow fragment, 1 hour of entropy-driven cyclic amplification time, 40 minutes of T7 RNA polymerase reaction time, and 10nM CRISPR-Cas13a concentration) produced the highest SWV signal intensity for the biosensor, reflecting successful targeted miRNA detection. These conditions are critical to ensuring the reliable and sensitive performance of the biosensor, making it very suitable for early disease diagnosis and continuous patient monitoring.

[0050] The electrochemical biosensor for detecting miR-21 in complex samples described in the present invention can detect miR-21 with high specificity at extremely low concentrations (detection limit of 0.735fM), overcoming the limitations of traditional methods (such as qRT-PCR and microarray analysis) that usually require cumbersome sample preparation and complex instruments, and has an extremely low detection limit and high specificity.

[0051] The electrochemical biosensor for detecting miR-21 in complex samples of the present invention has a high adaptability and practicality, and its versatility allows it to be adapted to detect other biomarkers, expanding its potential application range, from cancer to diversified diagnostic applications of infectious diseases. At the same time, the sensor operates effectively in complex biological matrices, demonstrating its robustness and applicability in real clinical settings.

[0052] The electrochemical biosensor for detecting miR-21 in complex samples described in the present invention has the advantage of simplified process and is very suitable for clinical use. The biosensor provides a transformational method for the early detection of miR-21, which is expected to improve early diagnosis, personalized treatment, and ultimately improve patient treatment outcomes. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0054] Figure 1 is a schematic diagram of the construction principle of the biosensor;

[0055] Figure 2 Optimizing experimental conditions for miR-21 detection for the biosensor;

[0056] Figure 3The sensitivity analysis results of the biosensor for detecting miR-21;

[0057] Figure 4 This is the specificity evaluation result of the biosensor for miR-21 detection. DETAILED DESCRIPTION

[0058] In the following embodiments of the present invention, the biosensor is a biosensor based on CRISPR-Cas13a and entropy driven amplification (ESDA) to detect miR-21. The sensor uses entropy driven amplification (ESDA) reaction to detect miR-21. The schematic diagram of its construction is shown in the attached figure. Figure 1 shown.

[0059] As attached Figure 1 As shown in (A), the hairpin probe (HP) binds to miR-21, initiates polymerization and generates intermediate DNA. The process begins with the hairpin probe (HP) containing primer and template regions, both of which are necessary for initiating the reaction. The template region of HP is critical for selective recognition and binding of miR-21. After miR-21 binds, the hairpin loop structure changes, allowing HP to form a new conformation - essentially a primer for an extension reaction.

[0060] As attached Figure 1 As shown in (B), entropy-driven T7 amplification and CRISPR-Cas13a cleavage enhance signal detection, achieving high-sensitivity detection of miR-21.

[0061] In the following examples of the present invention, the probe sequences involved are shown in Table 1 below.

[0062] Table 1 Probe sequences

[0063]

[0064] In the following embodiments of the present invention, the materials and reagents involved include:

[0065] DNA oligonucleotides were synthesized by Genscript Biotechnology Ltd (Nanjing, China) and dissolved in 1X phosphate-buffered saline (PBS);

[0066] Other reagents such as deoxynucleoside triphosphates (dNTPs), Klenow enzyme of DNA polymerase I, nicking enzyme Nb.BbvCI, and chemical reagents such as KH2PO4, Na2HPO4, NaCl, KCl, and MgCl2 were purchased from the corresponding suppliers;

[0067] All solutions were prepared using Milli-Q ultrapure water (18.2 MΩ cm) to ensure high purity and consistency in the experiments.

[0068] Example 1

[0069] The preparation method and detection method of the ECL biosensor described in this embodiment include the following steps.

[0070] Hairpin probe amplification

[0071] The hairpin probe HP forms a stable secondary structure by gradually cooling the single-stranded DNA from 90°C to room temperature. Subsequently, 50 μL miR-21 (as shown in Table 1), 10 μL 1 μM HP, 2 μL 150U / mL Klenow fragment, 3 μL 100U / mL Nb.BbvCI, 25 μL 2.5mM dNTPs and 10 μL 10×NEB buffer were mixed to form a reaction system. The mixture was incubated at 37°C for 2 hours, during which the Klenow enzyme extended the primer to synthesize complementary DNA, while Nb.BbvCI improved the amplification efficiency by nicking. After the reaction was completed, the enzyme was inactivated by heating at 80°C for 20 minutes to terminate the reaction. Finally, miR-21 amplification products of different concentrations (intermediate DNA, as shown in Table 1) were obtained and stored for subsequent experiments.

[0072] Entropy-driven cyclic amplification

[0073] Dissolve equal volumes of Blocker, T7 promoter and Scaffold in PBS (0.1M, pH=7.4), heat to 95°C for 5 minutes, and then cool to room temperature to form a three-chain complex. Add the above solution and Fuel chain to the reaction system for entropy-driven cyclic amplification reaction for 1 hour to generate a large number of T7 promoters. This step ensures efficient generation of the promoter by precisely controlling the concentration and incubation time.

[0074] T7 RNA polymerase-mediated transcription amplification

[0075] Add 50 μL of the above product to a 100 μL amplification reaction system containing 40 μM NTPs, 30 U T7 RNA polymerase, 1 μM DNA template (as shown in Table 1), 20 U RNase inhibitor, and 2 μL 10× RNAPol reaction buffer. Incubate at 37°C for 40 minutes for transcription amplification to generate a large amount of RNA. This step significantly enhances the signal intensity and provides sufficient RNA template for subsequent detection.

[0076] CRISPR-Cas13a reaction

[0077] After transcription is completed, the above solution is incubated with a final concentration of 10 nM Cas13a protein and 15 nM crRNA in a sufficient amount of 1×NEBuffer at room temperature for 20 minutes to activate the CRISPR / Cas13a system and target cleave the transcribed RNA to obtain an activation solution.

[0078] Electrochemical detection

[0079] In this embodiment, the gold electrode (surface area 0.07cm 2 ) The modification process first cleans the gold electrode to remove surface impurities and improve material adhesion. It is then ultrasonically treated with ethanol and deionized water in sequence and dried with nitrogen to ensure surface cleanliness. During probe fixation, the gold electrode is immersed in a 1 μM DNA1 solution and incubated to allow DNA1 to bind to the electrode surface and achieve specific anchoring.

[0080] In this embodiment, electrochemical detection uses a three-electrode system (gold working electrode, platinum counter electrode and Ag / AgCl reference electrode) to detect signals by square wave voltammetry (SWV). The electrode system is immersed in an activated CRISPR / Cas13a solution for 20 minutes to ensure full interaction.

[0081] In this embodiment, the working electrode has a surface area of ​​0.07 cm 2 The excellent conductivity and biocompatibility of the gold electrode ensure efficient electron transfer and interaction with the signal molecule. During the detection process, the signal molecule interacts efficiently with the electrode surface to achieve accurate quantification of the target miRNA. The specificity of the signal is verified by control experiments, and the stability and reproducibility of the sensor are demonstrated by repeated experiments.

[0082] Example 2

[0083] The preparation method and detection method of the ECL biosensor described in this embodiment include the following steps.

[0084] Hairpin probe amplification

[0085] The hairpin probe HP forms a stable secondary structure by gradually cooling the single-stranded DNA from 90°C to room temperature. Subsequently, 49.8μL miR-21, 9.8μL 1μM HP, 1.8μL 150U / mL Klenow fragment, 2.8μL 100U / mLNb.BbvCI, 24.8μL 2.3mM dNTPs and 9.8μL 10×NEB buffer were mixed to form a reaction system. The mixture was incubated at 37°C for 2 hours, during which the Klenow fragment extended the primer to synthesize complementary DNA, and Nb.BbvCI improved the amplification efficiency by nicking. After the reaction was completed, the enzyme was inactivated by heating at 80°C for 20 minutes to terminate the reaction. Finally, miR-21 amplification products (intermediate DNA) of different concentrations were obtained and stored for subsequent experiments.

[0086] Entropy-driven cyclic amplification

[0087] Dissolve equal volumes of Blocker, T7 promoter and Scaffold in PBS (0.1M, pH=7.4), heat to 95°C for 5 minutes, and then cool to room temperature to form a three-chain complex. Add the above solution and Fuel chain to the reaction system for entropy-driven cyclic amplification reaction for 1 hour to generate a large number of T7 promoters. This step ensures efficient generation of the promoter by precisely controlling the concentration and incubation time.

[0088] T7 RNA polymerase-mediated transcription amplification

[0089] Add 50 μL of the above product to a 100 μL amplification reaction system containing 39.8 μM NTPs, 29.8 U T7 RNA polymerase, 0.98 μM DNA template, 19.8 U RNase inhibitor, and 1.8 μL 10× RNAPol reaction buffer. Incubate at 37°C for 40 minutes for transcription amplification to generate a large amount of RNA. This step significantly enhances the signal intensity and provides sufficient RNA template for subsequent detection.

[0090] CRISPR-Cas13a reaction

[0091] After transcription is completed, the above solution is incubated with a final concentration of 9.8 nM Cas13a protein and 14.8 nM crRNA in a sufficient amount of 1× NEBuffer at room temperature for 20 minutes to activate the CRISPR / Cas13a system and target cleave the transcribed RNA to obtain an activation solution.

[0092] Electrochemical detection

[0093] In this embodiment, the gold electrode (surface area 0.07cm 2) The modification process first cleans the gold electrode to remove surface impurities and improve material adhesion. It is then ultrasonically treated with ethanol and deionized water in sequence and dried with nitrogen to ensure surface cleanliness. During probe fixation, the gold electrode is immersed in a 1 μM DNA1 solution and incubated to allow DNA1 to bind to the electrode surface and achieve specific anchoring.

[0094] In this embodiment, electrochemical detection uses a three-electrode system (gold working electrode, platinum counter electrode and Ag / AgCl reference electrode) to detect signals by square wave voltammetry (SWV). The electrode system is immersed in an activated CRISPR / Cas13a solution for 20 minutes to ensure full interaction.

[0095] In this embodiment, the working electrode has a surface area of ​​0.07 cm 2 The excellent conductivity and biocompatibility of the gold electrode ensure efficient electron transfer and interaction with the signal molecule. During the detection process, the signal molecule interacts efficiently with the electrode surface to achieve accurate quantification of the target miRNA. The specificity of the signal is verified by control experiments, and the stability and reproducibility of the sensor are demonstrated by repeated experiments.

[0096] Example 3

[0097] The preparation method and detection method of the ECL biosensor described in this embodiment include the following steps.

[0098] Hairpin probe amplification

[0099] The hairpin probe HP forms a stable secondary structure by gradually cooling the single-stranded DNA from 90°C to room temperature. Subsequently, 50.2μL miR-21, 10.2μL 1μM HP, 2.2μL 150U / mL Klenow fragment, 3.2μL 100U / mLNb.BbvCI, 25.2μL 2.7mM dNTPs and 10.2μL 10×NEB buffer were mixed to form a reaction system. The mixture was incubated at 37°C for 2 hours, during which the Klenow fragment extended the primer to synthesize complementary DNA, and Nb.BbvCI improved the amplification efficiency by nicking. After the reaction was completed, the enzyme was inactivated by heating at 80°C for 20 minutes to terminate the reaction. Finally, miR-21 amplification products (intermediate DNA) of different concentrations were obtained and stored for subsequent experiments.

[0100] Entropy-driven cyclic amplification

[0101] Dissolve equal volumes of Blocker, T7 promoter and Scaffold in PBS (0.1M, pH=7.4), heat to 95°C for 5 minutes, and then cool to room temperature to form a three-chain complex. Add the above solution and Fuel chain to the reaction system for entropy-driven cyclic amplification reaction for 1 hour to generate a large number of T7 promoters. This step ensures efficient generation of the promoter by precisely controlling the concentration and incubation time.

[0102] T7 RNA polymerase-mediated transcription amplification

[0103] Add 50 μL of the above product to a 100 μL amplification reaction system containing 40.2 μM NTPs, 30.2 U T7 RNA polymerase, 1.2 μM DNA template, 20.2 U RNase inhibitor, and 2.2 μL 10× RNAPol reaction buffer. Incubate at 37°C for 40 minutes for transcription amplification to generate a large amount of RNA. This step significantly enhances the signal intensity and provides sufficient RNA template for subsequent detection.

[0104] CRISPR-Cas13a reaction

[0105] After transcription is completed, the above solution is incubated with a final concentration of 10.2 nM Cas13a protein and 15.2 nM crRNA in a sufficient amount of 1×NEBuffer at room temperature for 20 minutes to activate the CRISPR / Cas13a system and target cleave the transcribed RNA to obtain an activation solution.

[0106] Electrochemical detection

[0107] In this embodiment, the gold electrode (surface area 0.07cm 2 ) The modification process first cleans the gold electrode to remove surface impurities and improve material adhesion. It is then ultrasonically treated with ethanol and deionized water in sequence and dried with nitrogen to ensure surface cleanliness. During probe fixation, the gold electrode is immersed in a 1 μM DNA1 solution and incubated to allow DNA1 to bind to the electrode surface and achieve specific anchoring.

[0108] In this embodiment, electrochemical detection uses a three-electrode system (gold working electrode, platinum counter electrode and Ag / AgCl reference electrode) to detect signals by square wave voltammetry (SWV). The electrode system is immersed in an activated CRISPR / Cas13a solution for 20 minutes to ensure full interaction.

[0109] In this embodiment, the working electrode has a surface area of ​​0.07 cm 2The excellent conductivity and biocompatibility of the gold electrode ensure efficient electron transfer and interaction with the signal molecule. During the detection process, the signal molecule interacts efficiently with the electrode surface to achieve accurate quantification of the target miRNA. The specificity of the signal is verified by control experiments, and the stability and reproducibility of the sensor are demonstrated by repeated experiments.

[0110] Example 4

[0111] This example is based on the optimization detection of the experimental conditions of the biosensor in the above-mentioned Example 1.

[0112] In this embodiment, the experimental conditions for miR-21 detection were optimized based on the CRISPR / Cas13a biosensor. The SWV signal output was measured under different conditions to determine the optimal parameters for maximum signal intensity.

[0113] 1. Klenow fragment concentration optimization

[0114] This example tests the gradual change of Klenow fragment concentration from low to high.

[0115] like Figure 2 The results in (A) show the effect of Klenow fragment concentration on SWV signal. It can be determined that the optimal concentration is 150 U / mL, which provides the maximum signal intensity while avoiding excessive background noise.

[0116] 2. Entropy-driven cycle amplification time

[0117] This example tests the effects of reaction times ranging from 30 minutes to 2 hours.

[0118] like Figure 2 The results shown in (B) show the effect of entropy-driven cyclic amplification time, where 60 minutes provided the best amplification efficiency. Therefore, 1 hour was determined to be the optimal amplification time to effectively form the T7 promoter complex. There was no additional benefit beyond this time.

[0119] 3. T7 RNA polymerase reaction time

[0120] In this embodiment, the reaction time ranges from 20 minutes to 60 minutes.

[0121] like Figure 2 The results shown in (C) show that the optimization of the T7 RNA polymerase reaction time shows that 40 minutes is the best time for efficient RNA production. Therefore, 40 minutes was determined as the optimal reaction time, which can produce RNA efficiently without unnecessarily prolonging the experimental time.

[0122] 4. CRISPR-Cas13a concentration optimization

[0123] In this embodiment, the concentration of Cas13a was adjusted from 5nM to 20nM in sequence.

[0124] like Figure 2 The results shown in (D) show the effect of CRISPR-Cas13a concentration. It was found that 10nM is the optimal concentration to achieve the highest specificity and signal intensity, balancing efficient targeted cutting and specificity.

[0125] In this embodiment, the crRNA concentration is set to 15nM at the same time to ensure effective complex formation with Cas13a.

[0126] This example systematically determines the conditions for maximizing the sensitivity and specificity of miR-21 detection. The above-screened optimized parameters ensure the high sensitivity and reliability of the biosensor in miR-21 detection, achieving the highest performance of the biosensor in early disease diagnosis and continuous patient monitoring.

[0127] Example 5

[0128] This example is based on the biosensor scheme in the aforementioned Example 1, and analyzes the sensitivity of miR-21 detection using a CRISPR-Cas13a-based biosensor.

[0129] In this example, the detection ability of the biosensor for different concentrations of miR-21 was evaluated. The miR-21 was diluted to different concentrations, and the miR-21 solutions of different concentrations were added to the biosensor to measure the corresponding ECL signal intensity. Figure 3 The results shown in (A) show that the SWV signal responds to different miR-21 concentrations, ranging from 0 fM (a) to 1×10 fM (p). The tested concentrations include 0, 1, 5, 10, 50, 100, 500, 1000, 2000, 10,000, 100,000, 1,000,000, 5,000,000, 1×10 and 1×10 fM, showing that as the concentration of miR-21 increases, the signal intensity also increases.

[0130] like Figure 3 The results shown in (B) show a logarithmic relationship between miR-21 concentration and SWV signal intensity, showing a strong correlation over a wide concentration range. The results show that the detection limit is 0.735fM, indicating the high sensitivity of the biosensor, which is crucial for early disease diagnosis and monitoring.

[0131] Example 6

[0132] This example is based on the biosensor scheme in the aforementioned Example 1, and the specificity of miR-21 detection is evaluated by a CRISPR-Cas13a-based biosensor.

[0133] This example evaluates the specificity of miR-21 detection based on CRISPR / Cas13a biosensor. The SWV intensity of perfectly matched miR-21, single-base mismatched miRNA (SM), triple-base mismatched miRNA (TM), random miRNA (RM), miR-205, miR-221 and a control sample was measured.

[0134] like Figure 4 As can be seen in the results, the signal of the perfectly matched miR-21 was significantly higher compared to other miRNAs and control samples, showing the high selectivity of the biosensor. The reduced SWV intensity for SM, TM, RM, miR-205, and miR-221 highlights the ability of the biosensor to effectively distinguish similar but non-target sequences, ensuring high specificity of miRNA detection.

[0135] Example 7

[0136] This embodiment is based on the biosensor solution in the aforementioned embodiment 1 to detect data of complex samples.

[0137] In order to evaluate the practical applicability of the developed biosensor for detecting miR-21 in complex biological matrices, the present embodiment used the MCF-7 cell lysate with spiked-in to conduct the experiment. The MCF-7 lysate was diluted tenfold to simulate the real biological conditions, and different concentrations of miR-21 (10pM, 100pM, 1000pM and 10000pM) were added to the sample. The SWV signal corresponding to each miR-21 concentration was recorded, and the obtained data was compared with the standard calibration curve, and the SWV reading was converted into the molar concentration of miR-21. This method allows the determination of the recovery rate and verifies the accuracy of the biosensor in detecting miR-21 in complex cell lysate.

[0138] The performance results of the biosensors in these spiked biological samples are shown in Table 2 below.

[0139] Table 2 Performance of biosensor in spiked MCF-7 cell lysate

[0140] Sample concentration (pM) Detection concentration (pM) Recovery rate (%) RSD(%) 10 9.85 98.5 5.12 100 102.34 102.34 4.89 1000 1015.67 101.57 5.47 10000 10321.45 103.21 6.34

[0141] As can be seen, the sensor exhibited high accuracy at all tested concentrations, with relative standard deviations (RSDs) ranging from 4.89% to 6.94%, demonstrating its reproducibility in complex sample environments. In addition, the recovery rates ranged from 98.5% to 103.21%, highlighting the accuracy of the biosensor in quantifying miR-21, even in cell lysates where interfering substances may be present.

[0142] In summary, the biosensor of the present invention has ideal robustness and applicability for practical applications in clinical diagnosis. The high recovery rate indicates that the sensor can accurately measure miR-21 levels in real-world biological samples, such as cell extracts, which is crucial for cancer diagnosis and monitoring. Given that miR-21 is an important biomarker for a variety of cancers, it is crucial to be able to detect it so precisely and accurately in a complex matrix.

[0143] Furthermore, the minimal variance (low RSD values) observed in repeated testing highlights the potential of the biosensor for reliable use in routine diagnostics. By maintaining high sensitivity and specificity, even in the presence of diverse proteins and enzymes typically present in biological samples, this SWV-based biosensor provides a powerful tool for miRNA detection in clinical and research settings. It achieves accurate quantification with minimal sample preparation, further enhancing its utility in high-throughput screening applications in clinical field diagnostics and biomedical research.

[0144] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A biosensor for detecting miR-21, characterized in that: It includes a hairpin probe amplification system, an entropy-driven cyclic amplification system, a T7 RNA polymerase transcription system, a CRISPR / Cas13a amplification system, and an electrode system.

2. The biosensor for detecting miR-21 according to claim 1, characterized in that: The hairpin probe amplification system comprises a hairpin probe HP, Klenow enzyme, Nb.BbvCI, dNTPs, and an amplification buffer; Preferably, the sequence of the hairpin probe HP is as follows: TCAACATCAGTCTGATAAGCTAGCTGAGGACGTTAGTAGCTTATCAGA CTGAATCTAACGT.

3. The biosensor for detecting miR-21 according to claim 1 or 2, characterized in that: The entropy-driven cyclic amplification system includes a Blocker, a T7 promoter, a Scaffold, and a Fuel chain; Preferably, the sequence of the Blocker is as follows: CGCCATTGTCCAATGAAT; Preferably, the sequence of the T7 promoter is as follows: GTCTGATAAGCTAGCTAATACGACTCACTATAGGG; Preferably, the sequence of the Scaffold is as follows: ATTCATTGGACAATGGCGCGTATTAGCTAGCTTATCAGACTGATGTTGA; Preferably, the sequence of the Fuel chain is as follows: ATAAGCTAGCTAATACGCGCCATTGTCCAATGAAT.

4. The biosensor for detecting miR-21 according to any one of claims 1 to 3, characterized in that: The T7 RNA polymerase transcription system includes NTPs, T7 RNA polymerase, DNA template, RNase inhibitor, and RNAPol reaction buffer; Preferably, the sequence of the DNA template is as follows: CTACCTGCACTGTAAGCACTTTG CCCTATAGTGAGTCGTATTAGCTAGC TTATCAGAC.

5. The biosensor for detecting miR-21 according to any one of claims 1 to 4, characterized in that: The CRISPR / Cas13a reaction system includes Cas13a protein, crRNA, and Cas13a reaction buffer; Preferably, the sequence of the Cas13a protein is as follows: CAAAGUGCUUACAGUGCAGGUAG; Preferably, the sequence of the crRNA is as follows: GACCACCCCAAAAAUGAAGGGGACUAAAACCUACCUGCACUGUAAGCACUUUG.

6. The biosensor for detecting miR-21 according to any one of claims 1 to 5, characterized in that: The electrode system includes a working electrode, a counter electrode and a reference electrode; Preferably, the working electrode comprises a gold electrode; more preferably comprises a gold electrode with a DNA1 probe anchored on the surface; Preferably, the counter electrode comprises a platinum counter electrode; Preferably, the reference electrode comprises an Ag / AgCl reference electrode; Preferably, the sequence of the DNA1 probe is as follows: SH-TTGGATGGATATTGT-rUrU-CATATTCCATCCAA.

7. A method for constructing a biosensor for detecting miR-21 according to any one of claims 1 to 6, characterized in that: The method comprises the steps of respectively preparing the hairpin probe amplification system, the entropy-driven cyclic amplification system, the T7 RNA polymerase transcription system, and the CRISPR / Cas13a reaction system, and constructing the electrode system; Preferably, the step of preparing the hairpin probe amplification system further comprises the step of forming a hairpin probe HP with a stable secondary structure by cooling the single-stranded DNA from 85-95° C. to room temperature; Preferably, the step of constructing the electrode system includes the step of anchoring the DNA1 probe on the surface of the gold working electrode, specifically including the step of immersing the electrode in a solution containing the DNA1 for incubation and fixation.

8. Use of the biosensor for detecting miR-21 according to any one of claims 1 to 6 in the field of miR-21 detection.

9. A method for detecting miR-21 by electrochemical method, characterized in that: The method comprises the steps of using the biosensor for detecting miR-21 according to any one of claims 1 to 6 for detection; Preferably, the electrochemical method for detecting miR-21 comprises the following steps: (1) preparing the hairpin probe amplification system according to a selected ratio, mixing it with miR-21 of different concentrations, and performing a first incubation; after the reaction is completed, inactivating the enzyme and terminating the reaction to obtain miR-21 amplification products of different concentrations, i.e., intermediate DNA; (2) Dissolving the Blocker, T7 promoter and Scaffold in PBS according to the selected ratio and performing a second incubation to form a three-chain complex; continuing to add the amplification product of step (1) and the Fuel chain to mix and perform an entropy-driven cyclic amplification reaction to generate a large amount of T7 promoter; (3) preparing the T7 RNA polymerase transcription system according to the selected ratio, adding the amplified product in step (2) and mixing, and performing a third incubation to perform transcription amplification; (4) preparing the CRISPR / Cas13a reaction system according to the selected ratio, adding the amplified product of step (3), and performing a fourth incubation to activate the CRISPR / Cas13a system and target cleavage of the transcribed RNA to obtain an activation solution; (5) Using the electrode system to detect the signal, the result is obtained.

10. The method for detecting miR-21 by electrochemical method according to claim 9, characterized in that: In step (1), the temperature of the first incubation step is 35-40° C., and the incubation time is 1-3 hours; and / or, In step (2), the temperature of the second incubation step is 90-98° C., and the incubation time is 3-8 minutes; and / or, In step (2), the entropy-driven cyclic amplification reaction is carried out for 0.5-2 hours; and / or, In step (3), the temperature of the third incubation step is 35-40° C., and the incubation time is 30-60 minutes; and / or, In the step (4), the temperature of the fourth incubation step is 20-30° C., and the incubation time is 10-30 minutes.

Images