Detection primer, probe and detection method for albendazole resistance of haemonchus contortus

Abstract

The invention provides a haemonchus contortus albendazole drug resistance detection primer, a probe and a detection method. The primer for detecting the haemonchus contortus I type beta tubulin gene comprises nucleotide sequences SEQ ID NO: 2 and SEQ ID NO: 3; the probe comprises nucleotide sequences SEQ ID NO: 4 and SEQ ID NO: 5. The method for detecting the albendazole drug resistance of haemonchus contortus is a dual real-time fluorescent quantitative PCR (Polymerase Chain Reaction) detection method. According to the haemonchus contortus albendazole drug resistance detection primers and probes, one pair of primers and two probes are designed for haemonchus contortus I type beta tubulin gene sequences 198 and 200 sites, the specificity is good, the primer and probe matching is good, and an amplification curve can be smoothly drawn out.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and particularly relates to a drug resistance detection primer and a detection method. Background Art

[0002] Haemonchus contortus belongs to the family Trichostrongylidae and the genus Haemonchus. It mainly parasitizes in the fourth stomach, i.e., the abomasum, of ruminants such as cattle, sheep, and camels, and is occasionally found in the small intestine. Among the common digestive nematodes that infect cattle and sheep, Haemonchus contortus has a high infection rate and pathogenicity, with the highest incidence and mortality rates in lambs and young sheep. Haemonchus contortus is one of the most fertile and most commonly infected nematodes in the family Trichostrongylidae. Female worms can produce thousands of eggs every day, which leads to rapid contamination of pasture grass by larvae, resulting in the outbreak of Haemonchus contortus disease, which can cause chronic wasting symptoms such as emaciation and anemia in the host. Severe infection can even cause death, bringing huge economic losses to my country's breeding industry. At present, Haemonchus contortus disease is distributed all over the world. There are reports from all over the country, especially in some pastoral areas where the disease is prevalent in sheep flocks, with an infection rate of more than 70%-80%.

[0003] In the past 50 years, the control strategy of livestock digestive tract nematodes has mainly relied on the use of anthelmintics. With the widespread use of anthelmintics, almost all parasites that can cause economic losses have become increasingly resistant to common anthelmintics on the market. Since the first report of the resistance of Haemonchus twister to thiabendazole in 1964, researchers around the world have successively discovered the resistance of other nematodes, such as the annular nematode, Osterlalia and Trichostrongylus colubriformis, but the most serious resistance is Haemonchus twister. The development of drug resistance is not limited to a certain region, but a common problem faced by the world. The emergence of drug resistance not only weakens the therapeutic effect of drugs, making the prevention and control of Haemonchus twister disease more difficult, but may also lead to a series of adverse consequences, such as drug residues, environmental pollution and food safety issues. However, there is still a lack of accurate and efficient means of drug resistance detection. In practice, blind deworming is often carried out without the basis for drug resistance detection, and the deworming effect is difficult to guarantee, making parasitic diseases more and more serious. Therefore, the establishment of a method for detecting drug resistance of Haemonchus contortus is urgent and of great significance. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention provides a primer and a probe for detecting albendazole resistance of Haemonchus contortus, which are used for detecting albendazole resistance of Haemonchus contortus.

[0005] The second purpose of the present invention is to propose a method for detecting albendazole resistance of Haemonchus contortus, providing a faster and more sensitive detection method.

[0006] The technical solution for achieving the above-mentioned purpose of the present invention is:

[0007] A primer for detecting albendazole resistance of Haemonchus contortus, for detecting the type I β-tubulin gene of Haemonchus contortus, the primer comprising: nucleotide sequences CGTCCATCAACTGGTAGAG and CCATAGGTTGGATTTGTGAG (SEQ ID NO: 2, SEQ ID NO: 3, respectively);

[0008] The detection probes include: CGATGAAACATTCTGT and CGATGCAACATACTGT (SEQ ID NO: 4, SEQ ID NO: 5, respectively).

[0009] Furthermore, the nucleotide sequences of the double-stranded DNA fragments used to detect the completely resistant (rr), 200 resistant (200r), completely sensitive (ss), and 198 resistant (198r) of the type I β-tubulin gene of the contorted nematode are shown in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, respectively.

[0010] A method for detecting albendazole resistance of Haemonchus contortus, using a multiplex quantitative real-time PCR (multiplex qPCR) detection method, comprising the steps of:

[0011] S1: Genomic DNA extraction: Extract genomic DNA of Haemonchus contortus or its eggs in fecal samples;

[0012] S2: After extracting DNA, qPCR amplification is performed, and the qPCR amplification uses the primers of SEQ ID NO: 2, 3 and the probes of SEQ ID NO: 4 and SEQ ID NO: 5.

[0013] S3 result determination: judging whether there is Haemonchus contortus in the sample to be tested according to the qPCR amplification curve, and judging whether the tested Haemonchus contortus is resistant to albendazole; using the probe as described above, and constructing a control using the gene (sequence NO: 6-9); if a sensitive strain signal is detected in the sample, it is determined that there is albendazole-sensitive strain of Haemonchus contortus in the sample; if a resistant strain signal is detected in the sample, it is determined that there is albendazole-resistant strain of Haemonchus contortus in the sample;

[0014] Among them, 0.6 μL of each probe was added, and 1 μL of each primer was added.

[0015] The qPCR amplification reaction conditions in step S2 are: pre-denaturation at 95°C for 30s; 95°C for 5s, 60°C for 30s, and 40 cycles.

[0016] Among them, the control template includes a 198-site mutation template of Haemonchus contortus, a sensitive insect strain template, a 200-site mutation resistance template and a completely resistant insect strain template, wherein the 198-site mutation template is obtained by extracting DNA from the 198 resistant insect strain, and obtaining competent cells through amplification, cloning and transformation; the completely resistant insect strain template, the 200-site mutation resistance template and the sensitive insect strain template are obtained by the nucleotide sequences SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 through customized synthesis and construction into a pUC vector.

[0017] A preferred technical solution of the present invention is that the preparation of the target gene plasmid used as a positive control template includes preparing the 198-site mutation template, comprising the following steps:

[0018] 1) Genomic DNA extraction: DNA was extracted from 198 drug-resistant insect strains.

[0019] 2) The extracted type I β-tubulin gene was amplified by PCR. The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1.5 min, 35 cycles; and extension at 72°C for 10 min.

[0020] 3) PCR product recovery: recover the type I β-tubulin gene PCR product and connect the PCR recovered product to the linearized vector;

[0021] 4) Transformation of recombinant plasmid: The ligation product is transformed into competent cells for culture, a single colony is picked, inoculated into LB medium and cultured overnight, and the plasmid is extracted as a template for molecular detection of 198-site mutation-resistant insect strains.

[0022] More preferably, at least one of the fully sensitive and drug-resistant genes (fully resistant, 200 resistant and 198 resistant) among the genes is used to construct a positive control template.

[0023] Another preferred technical solution of the present invention is that the method for obtaining a control template includes synthesizing a recombinant plasmid to transform competent cells: adopting a method of customized synthesis and construction into a pUC plasmid vector, using completely resistant, 200 resistant, and completely sensitive DNA double-stranded fragments to construct twist-resistant and sensitive insect strain plasmid vectors, taking the synthesized plasmid to transform competent cells, and then culturing them on solid LB culture medium to construct a recombinant standard plasmid.

[0024] After constructing the recombinant standard plasmid, the plasmid concentration is also tested and the copy number is calculated.

[0025] Specifically, the obtained plasmid concentration can be detected using a NanoDrop nucleic acid concentration meter.

[0026] Calculate the copy number according to the formula:

[0027] Copy number = (6.02 × 10 23 × concentration × 10 -9 ) / [(cloning vector length + product size) × 660]

[0028] The unit was converted to copies / μL and the initial concentration of the four plasmids was adjusted to 1×10 9 copies / μL.

[0029] In step 4), the ligation product is transformed into competent cells, spread on solid LB medium containing antibiotics, and cultured at 37°C overnight; then a single colony is picked and inoculated into liquid LB medium containing antibiotics and cultured overnight; the antibiotic is ampicillin (Amp).

[0030] In constructing the recombinant standard plasmid, 5 μL of each synthesized plasmid (pUC-ss, pUC-rr and pUC-200r) was added to 50 μL of competent cells melted in an ice bath, spread on solid LB medium containing antibiotics and cultured at 37°C overnight to construct the recombinant standard plasmid.

[0031] The construction of the standard plasmid used in the method for detecting albendazole resistance of Haemonchus contortus also includes: performing gene sequencing on the recombinant cloned bacteria and the recombinant standard plasmid cultured in step 4).

[0032] The beneficial effects of the present invention are:

[0033] The primers and probes for detecting albendazole resistance of Haemonchus contortus proposed by the present invention are a pair of primers and two probes designed for sites 198 and 200 of the type I beta tubulin gene sequence of Haemonchus contortus, have good specificity, good primer-probe matching, and can smoothly run an amplification curve.

[0034] The present invention establishes a qPCR detection method for Haemonchus contortus, which has high sensitivity and can meet the requirements of clinical sample detection. The application of the qPCR detection method for Haemonchus contortus of the present invention in the process of detecting Haemonchus contortus infection in livestock can diagnose albendazole-sensitive strains and drug-resistant strains of Haemonchus contortus, and the method has high specificity, sensitivity and good repeatability. The dual fluorescence quantitative PCR identification time is shorter and more convenient and faster than ordinary PCR. Ordinary PCR identification of drug resistance includes several steps of PCR amplification, electrophoresis detection, gene sequencing and sequence analysis, which usually takes 5-7 days. The dual fluorescence quantitative PCR identification time of the present invention can be shortened to 1-2 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the amplification curve of Example 1. Among them, ss-3, rr-3, 198r-3 and 200r-3 did not run the amplification curve.

[0036] Figure 2 The PCR amplification electrophoresis diagram of pUC-ss, pUC-rr, pUC-200r and pMD-198r PCR in Example 3 of the present invention; wherein, M is DNA Marker DL500; 1 is pUC-ss; 2 is pUC-rr; 3 is pUC-200r; and 4 is pMD-198r.

[0037] Figure 3 The PCR product sequencing diagrams of pUC-ss, pUC-rr, pUC-200r and pMD-198r genes in Example 3 are shown in Figure 1. 1 is pUC-ss; 2 is pMD-198r; 3 is pUC-rr; and 4 is pUC-200r.

[0038] Figure 4 This is a graph showing the optimization results of qPCR primer concentrations in Example 3; wherein 1 is PUC-ss; and 2 is PUC-rr.

[0039] Figure 5 This is a graph showing the optimization results of qPCR probe concentration in Example 3; wherein 1 is pUC-ss; 2 is pUC-rr.

[0040] Figure 6 The results of establishing the standard curve in Example 3; wherein 1 is pUC-ss; 2 is pUC-rr; 3 is pUC-200r; and 4 is pMD-198r.

[0041] Figure 7 The results of the sensitivity experiment in Example 3 of the present invention; wherein 1 is pUC-ss; 2 is pMD-198r; 3 is pUC-200r; and 4 is pUC-rr.

[0042] Figure 8 The results of the repeatability experiment in Example 3; wherein 1 is pUC-ss; 2 is pMD-198r; 3 is pUC-200r; and 4 is pUC-rr.

[0043] Fig. 9 The specificity test results in Example 3 of the present invention; wherein 1 is pUC-ss, 2 is pUC-rr; 3-6 are control templates of Pasteurella, Mycoplasma, Streptococcus, and Salmonella.

[0044] Fig.10 This is a diagram showing the optimization results of the dual qPCR primers and probes in Example 2. Fig.10 The blue line is the sensitive probe, and the yellow line is the resistant probe.

[0045] Fig.11 The results of establishing the dual qPCR standard curve in Example 4.

[0046] Fig.12 The results of the dual qPCR sensitivity experiment in Example 4.

[0047] Fig.13 The results of the dual qPCR repeatability experiment in Example 4.

[0048] Fig.14 The results of the dual qPCR specificity experiment in Example 4. Among them, 1 is a mixed template of pUC-ss and pUC-rr, and 2-6 are Salmonella, Pasteurella, Streptococcus, Mycoplasma and ddH2O, respectively.

[0049] Fig.15 The results of the ordinary PCR of the sensitive strain of Haemonchus contortus in the comparative example are shown in FIG. 1 , where M is DL500Maker, 1-8 are 1×10 8 ~1×10 1 copies / μL.

[0050] Fig.16 The results of the conventional PCR of the drug-resistant strain of Haemonchus contortus in the comparative example are shown in FIG. 1 , where M is DL500Maker, 1-8 are 1×10 8 ~1×10 1 copies / μL. DETAILED DESCRIPTION

[0051] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0052] Unless otherwise specified, the technical means used in the specification are all known in the art. All raw materials used can be purchased commercially.

[0053] Example 1 Design and screening of primers and probes

[0054] This technology detects drug resistance by detecting genes. The gene loci involved in drug resistance are reported to be 167, 198 and 200. Our laboratory found that the domestic samples mainly had changes in loci 198 and 200, and designed primers and probes based on this.

[0055] According to the type I β-tubulin gene sequence, primer probes were designed using Primer Express 3.0.1, with the amplified fragment set to 80-200 bp, the probe length to 13-21 bp, the primer length to 18-25 bp, the sequence GC content to 40%-60%, and the probe Tm value to be about 10°C higher than the primer Tm value. The primer probe sequences were derived, and the specificity was analyzed using the BLAST tool. Primer sequences with better specificity and three pairs of probes were selected for synthesis (Qingke Biotechnology Co., Ltd.). The sequences of primers and probes are shown in Table 1.

[0056] Table 1 Primer and probe sequences of type I β-tubulin gene

[0057]

[0058] Through the optimization of qPCR reaction conditions, it was determined that the first two pairs of primers and probes matched well, and the third pair of probes did not run the amplification curve. The results are shown in Figure 1 A pair of primers and two probes were screened according to the qPCR reaction results. The sequences of the screened primers and probes were SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively, as shown in Table 2.

[0059] Table 2 Primer and probe sequences of type I β-tubulin gene

[0060]

[0061] Compared with the common PCR method, the real-time fluorescence PCR method is more convenient and faster, and is conducive to application in production practice. The establishment of the qPCR detection method was subsequently tested.

[0062] Example 2 Establishment of a single-plex qPCR detection method for albendazole resistance in Haemonchus contortus

[0063] Previous studies in our laboratory have shown that β-tubulin is the target of benzimidazole drugs, and the mechanism of benzimidazole resistance is related to three mutation sites in the β-tubulin gene, namely F167Y (TTC-TAC), E198A (GAA-GCA), and F200Y (TTC-TAC). Since the mutation sites of domestic resistant strains mainly occur at E198A (GAA-GCA) and F200Y (TTC-TAC), this study designed and optimized a pair of primers and two probes for the 198 and 200 sites of the type I β-tubulin gene sequence of Haemonchus contortus, and detected them by qPCR. At the same time, the DNA double-stranded fragments of Haemonchus contortus that were completely sensitive (ss), completely resistant (rr), and 200 resistant (200r) were synthesized, and the 198 resistant strain (198r) (the 198 resistant strain was provided by the Preventive Veterinary Laboratory of the College of Veterinary Medicine, Inner Mongolia Agricultural University) was used as a positive control.

[0064] This example also includes the preparation of a control plasmid template:

[0065] 1) Genomic DNA extraction: follow the Maxygen nucleic acid extraction kit steps to extract the genomic DNA of the albendazole-resistant strain of Haemonchus contortus (prepared with the target gene plasmid used as a positive control template); the extracted type I β-tubulin gene sequence is SEQ ID NO: 9. (Sequence 1 is the full sequence).

[0066] 2) PCR amplification of type I β-tubulin gene: PCR amplification was performed after DNA extraction. The PCR amplification reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1.5 min, 35 cycles; and extension at 72°C for 10 min.

[0067] 3) PCR product recovery: Follow the instructions of the Axygen PCR product recovery kit to recover the type I β-tubulin gene PCR product. Connect the PCR recovery product with the pMD19-TSimple vector: Take a 200μL centrifuge tube, add 1μL pMD19-T Simple Vector, 4μL PCR recovery product and 5μL SolutionⅠ, centrifuge and mix, and connect at 16℃ overnight.

[0068] 4) Transformation of recombinant plasmid: Use Trans1-T1 competent cells of Beijing Quanshijin Biotechnology Co., Ltd. to transform the ligation product into Trans1-T1 competent cells, spread on solid LB medium containing antibiotics (Amp), and culture at 37°C overnight. Pick positive colonies, inoculate them into liquid LB medium containing antibiotics (Amp) and culture overnight, and use the culture for PCR amplification identification.

[0069] The recombinant clones that were positive by PCR were subjected to bidirectional sequencing (Beijing BGI Corporation). Analysis of the sequencing results showed that the cloned gene was a 198-unit drug resistance gene.

[0070] The cloned strain with correct sequencing was inoculated into LB medium and cultured overnight, and the plasmid was extracted as a template for mutation of site 198.

[0071] 5) Synthesize recombinant plasmid to transform competent cells

[0072] The standard template of the albendazole-sensitive strain of Haemonchus contortus, the 200-site mutation-resistant template, and the completely resistant strain template were obtained by custom synthesis and constructed into pUC vectors. Take 5 μL of the synthetic plasmids (pUC-ss, pUC-rr, pUC-200r), add 50 μL of Trans1-T1 competent cells melted in an ice bath, spread on solid LB medium containing antibiotics and culture at 37°C overnight, construct three template plasmids to transform recombinant bacteria, and the template sequences are shown in SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8.

[0073] Identification of recombinant bacteria: The constructed recombinant bacteria (pUC-ss, pUC-rr, pUC-200r) were identified by PCR, and the recombinant bacteria that were positive by PCR were subjected to bidirectional sequencing (Beijing BGI Corporation).

[0074] Detection of plasmid concentration: The plasmid concentration was detected using the NanoDrop nucleic acid concentration meter.

[0075] Calculate the copy number. According to the formula:

[0076] Copy number = (6.02 × 10 23 × concentration × 10 -9 ) / [(cloning vector length + product size) × 660]

[0077] The unit was converted to copies / μL and the initial concentration of the four plasmids was adjusted to 1×10 9 copies / μL.

[0078] In this example, 198 mutation standard plasmid templates were constructed by amplifying the β-tubulin gene from laboratory-stored insect bodies; together with another 3 custom-synthesized plasmids (200 sites, sensitive, and double-site mutation resistance), 4 template standard plasmids were used to set controls in actual testing.

[0079] Example 3 Optimization of single-plex qPCR reaction conditions

[0080] This example adopts the same operation steps as Example 2, and changes different operation parameters to find the optimal qPCR reaction conditions. Specifically:

[0081] The primers and probes of SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 were diluted to a working concentration of 10 μmol / L as required. The reaction system was prepared according to the instructions of Premix EX Taq (Probe qPCR) for the first reaction. 12.5 μL Premix EX Taq (Probe qPCR), 0.5 μL of upstream and downstream primers, 2 μL of DNA template, 1 μL of probe, and 8.5 μL of sterile water were added to the 25 μL reaction system. The reaction program was set as the first step at 95°C for 30 s, the second step at 95°C for 5 s, and 60°C for 30 s, and the number of cycles was set to 40. After confirming that the primers and probes matched well and the amplification curve could be run, the subsequent reaction system optimization was performed.

[0082] Keep the annealing temperature at 60℃ and the amount of primers and probes added unchanged. Dilute the primers and probes at 1:10, 1:20, 1:30, 1:40, and 1:50 on the basis of 10μmol / L. Use the chessboard method to optimize the reaction system. After selecting the best primer and probe dilution, set the amount of primers and probes added to 0.2μL, 0.4μL, 0.6μL, 0.8μL, and 1μL to optimize the reaction system again. Finally, find the amount of primers and probes added that has the lowest Ct value and the fastest reaction curve to the plateau under the same concentration of positive template.

[0083] Establishment of standard curve:

[0084] The concentration of the recombinant plasmid was adjusted to 1×10 9 copies / μL, and diluted to 1×10 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 The recombinant plasmid was used as a template, and 3 replicates were performed for each dilution factor. The sample type was set to Standard, and the initial dilution concentration was set to 1.00E+06. qPCR amplification was performed with the optimized reaction system to obtain the qPCR amplification curve.

[0085] Sensitivity experiment: 4 recombinant plasmids were added from 1×10 5 copies / μL to 1×10 1The recombinant plasmid was used as a template for 10-fold dilution. Multiple replicate wells were set for each concentration gradient of qPCR reaction. Sterile water was used as the template for the negative control group to evaluate the sensitivity of the four qPCR reactions.

[0086] Repeatability experiment: 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 The concentration of 100 copies / μL was used as the positive template. The optimized single-plex reaction conditions were used to perform multiple replicate groups for each template concentration. The experiment was repeated after replacing different batches of Premix Ex Taq (Probe qPCR). The coefficient of variation of Ct values ​​within and between groups was calculated to evaluate the repeatability of single-plex qPCR.

[0087] Specificity experiment: The qPCR reaction conditions optimized in this example were used with pUC-ss and pUC-rr plasmid DNA as positive control templates, genomic DNA extracted from Pasteurella, Mycoplasma, Streptococcus and Salmonella as reaction group templates, and sterile water as negative control group template to observe whether an amplification curve was generated and evaluate the specificity of the detection method.

[0088] Experimental Results

[0089] Target gene amplification: pUC-ss, pUC-rr, pUC-200r and pMD-198r were amplified by 1% agarose gel electrophoresis. The results showed that pUC-ss, pUC-rr, pUC-200r and pMD-198r all had 105bp bands, which were consistent with the expected target band size. Figure 2 .

[0090] Target gene sequencing: After PCR amplification, the target gene was detected by 1% agarose gel electrophoresis and sent to Beijing BGI for sequencing. The target gene was obtained in all four recombinant plasmids. Figure 3 .

[0091] Optimization results of single-plex qPCR reaction conditions: When the primer concentration in the qPCR reaction was fixed at 10 μmol / L, the amount of primer added was optimized, and the best amplification curve was obtained when the primer concentration was 0.6 μL. The optimization results are shown in Figure 4 When the probe concentration was 10 μmol / L, the amount of fixed primer added was 0.6 μL. The two amplification curves showed that the amplification curve was best when the probe addition amount was 1 μL. The probe optimization results are shown in Figure 5 .

[0092] Results of the standard curve establishment: 1×10 8 copies / μL, 1×10 7copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 The recombinant plasmids pMD-198r, pUC-ss, pUC-rr, and pUC-200r with 100 copies / μL were used as templates, and the qPCR standard curve was constructed under the optimized reaction conditions. The amplification efficiency of the pUC-ss standard curve was 105.26%, and R 2 The amplification efficiency of the pUC-rr standard curve was 107.3%, and R 2 The amplification efficiency of the pMD-198r standard curve was 109.85%, R 2 The amplification efficiency of pUC-200r was 102.58%, R 2 is 0.9983, which is within the effective range and can be used for subsequent quantitative detection. The results of the standard curve construction are shown in Figure 6 .

[0093] Sensitivity test results: The amplification curve showed that 5 -10 1 When the number of copies / μL is 10, the amplification curves are generated in duplicate wells. 1 When the number of copies was 10, valid results were obtained in three parallel wells; pUC-ss was 5 copies / μL-10 1 copies / μL can detect effective results; pMD-198r, pUC-rr, pUC-200r in the template 10 1 When the number of copies / μL is 10, two of the duplicate wells have valid results. The sensitivity of the four qPCR reactions can reach 10 copies / μL. The sensitivity amplification curves of the four types are shown in Figure 7 .

[0094] Repeatability test results: 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 The recombinant plasmid with 1000 copies / μL was used as a template, and the experiment was repeated using different batches of qPCR enzyme. The results showed that the coefficient of variation CV% between groups of single-plex qPCR was less than 0.70%, and the coefficient of variation within the group was less than 0.75%, indicating high repeatability. The amplification curve is shown in Figure 8 The repeatability test data of SS are shown in Table 3, and the repeatability test data of RR, 198R, and 200R are shown in Table 4, Table 5, and Table 6.

[0095] Table 3 Results of intra-group and inter-group repeatability tests of ss

[0096]

[0097] Table 4rr Results of intra-group and inter-group repeatability tests

[0098]

[0099] Table 5 Results of intra-group and inter-group repeatability tests of 198r

[0100]

[0101] Table 6 Results of the 200r intra-group and inter-group repeatability test

[0102]

[0103] Specificity test results: qPCR amplification was performed using pUC-ss and pUC-rr recombinant plasmids and common strains of Pasteurella, Salmonella, Mycoplasma, and Streptococcus DNA as templates. The results showed that pUC-ss and pUC-rr produced positive amplification curves when used as templates for amplification, and there was no amplification curve in the negative control group. The two probes had no cross-reaction with Pasteurella, Salmonella, Mycoplasma, and Streptococcus. The specificity test results are shown in Fig. 9 .

[0104] Example 4 Establishment of a dual qPCR detection method for drug resistance of Haemonchus contortus

[0105] Examples 2 and 3 have confirmed that the four genes have good reaction effects when used alone with primer probes. This example intends to optimize the dual qPCR reaction system to reduce the interference effect between primer probes, in order to obtain a stable and reliable dual qPCR identification (fluorescence quantitative PCR) detection method, in order to achieve the detection of drug resistance of Haemonchus contortus by single-tube qPCR. The basic steps are the same as those in Example 2, except that single-plex qPCR requires two tubes of testing for one sample when performing practical sample testing, and can only detect one result (sensitive or resistant), while dual qPCR can detect drug resistance, sensitivity, and mixed infection of sensitivity and resistance through one tube.

[0106] Experimental methods

[0107] Optimization of dual qPCR reaction conditions: The chessboard method was also used to optimize the reaction system. 12.5 μL Premix ExTaq (Probe qPCR) was added. The amount of primers (sequences 2 and 3) added was adjusted in a gradient from 0.2 to 1 μL (0.2 μL, 0.4 μL, 0.6 μL, 0.8 μL, 1.0 μL). The amount of two probes (sequences 4 and 5) added was adjusted in a gradient from 0.1 to 1 μL (0.2 μL, 0.4 μL, 0.6 μL, 0.8 μL, 1.0 μL). The amount of upstream and downstream primers and probes added to the pUC-ss and pUC-rr dual qPCR reaction systems was adjusted respectively. The annealing temperature was kept constant at 60°C without adjustment.

[0108] Establish a standard curve: adjust the concentration of each recombinant plasmid to 1×10 9 copies / μL were mixed in equal proportions, and then diluted 10 times in equal proportions to obtain 1×10 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 The mixed standard recombinant plasmid of 100 copies / μL was used, and the double mixed plasmid was used as the template. 2μL was added to each well. ddH2O (double deionized water) was used as the negative control group. Three replicate wells were made for each concentration. The instrument reaction well sample type was set to Standard. The target fragment was amplified and the fluorescence signal was detected with the optimized reaction system and reaction procedure to obtain the double qPCR amplification standard curve.

[0109] Sensitivity test: 1×10 9 The standard positive recombinant plasmids were mixed in equal proportions and diluted 10-fold to 1×10 9 ~1×10 1 A total of 9 concentrations of double mixed standard positive plasmid were selected, and 1×10 5 ~1×10 1 The mixed recombinant plasmids with 5 different concentrations of 10 copies / μL were used as templates, and a negative control group with ddH2O as template was added to test the sensitivity of this method.

[0110] Repeatability experiment: Select 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4Three equal-proportion mixed plasmids of 100 copies / μL were used as templates, and multiple replicate wells were made for each concentration. The experiment was repeated again after 10 days, and the experiment was repeated after 20 days with different batches of Premix Ex Taq (Probe qPCR) to evaluate the repeatability of this method.

[0111] Specificity experiment: Two standard positive mixed plasmids were used as positive control groups, ddH2O as negative control group, pUC-ss, pUC-rr and extracted genomic DNA of Pasteurella, Salmonella, Mycoplasma and Streptococcus were used as templates, and three replicate wells were made for each template to evaluate the specificity and identification effect of the established dual TaqMan qPCR.

[0112] Experimental Results

[0113] Optimization results of the dual qPCR reaction system: The amount of primers and probes added was optimized using the chessboard method. The dual amplification curves showed that when 0.6 μL of pUC-ss and pUC-rr double recombinant probes were added and 1 μL of primers were added, both amplification curves showed a plateau phase and the Ct value was the smallest, and the best amplification curve was obtained. The optimization results of the dual qPCR reaction conditions are shown in Fig.10 .

[0114] The results of establishing the double qPCR standard curve: The double qPCR standard curve was obtained by repeatability test using the optimized reaction system and two mixed plasmids of different concentrations as templates. Fig.11 The results of the standard curve construction showed that the amplification efficiencies of the two standard curves of pUC-ss and pUC-rr were 109.89% and 105.59%, respectively. 2 They are 0.9984 and 0.9958 respectively. The results of the duplicate well experiment have a high degree of fitting and a good linear relationship, which can be used for quantitative analysis of samples.

[0115] Results of dual qPCR sensitivity experiment: The detection concentration was 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 The sensitivity of dual qPCR was evaluated by mixing recombinant plasmids with 100 copies / μL. The amplification curves are shown in Fig.12 According to the experimental results, the sensitivity of the drug-resistant probe can reach 10 1 copies / μL, while the sensitivity of the sensitive probe is 1×10 3At least one of the fully sensitive and drug-resistant genes was used to construct a positive control template. When performing single-plex qPCR experiments, the results of each group of plasmids were ideal. Therefore, two plasmid mixed templates of fully sensitive (ss) and fully resistant (rr) can be selected for dual qPCR. The dual qPCR detection method established in this experiment has high sensitivity and can meet the requirements of clinical sample detection.

[0116] Dual qPCR reproducibility test results: 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 The mixed recombinant plasmid with 1000 copies / μL was used as a template. The intra-group repeat test was carried out. The amplification curve is shown in Fig.13 . And repeated tests with different batches of reaction enzymes were performed. The experimental results showed that the coefficient of variation of the Ct value within the group was less than or equal to 1%, and the coefficient of variation of the Ct value between the groups was less than or equal to 1%, indicating that the double qPCR method established in this study has good repeatability. The results are shown in Table 7.

[0117] Table 7 Dual qPCR intra-group and inter-group repeatability test results

[0118]

[0119] Results of dual qPCR specificity experiments: Dual qPCR detection was performed using pUC-ss and pUC-rr mixed plasmids as templates, and nucleic acids of Pasteurella, Salmonella, Mycoplasma, Streptococcus and ddH2O as control group templates. The results showed that there were no amplification curves in the Pasteurella, Salmonella, Mycoplasma, Streptococcus and ddH2O control groups, and two amplification curves appeared in the mixed recombinant plasmid positive control group. The dual qPCR amplification curves were shown in Figure 2. Fig.14 .

[0120] It can be seen that the qPCR detection method established in the present invention can identify the drug resistance or sensitivity of Haemonchus contortus to benzimidazole drugs (albendazole), and the method has good repeatability and high specificity and sensitivity.

[0121] Example 5 Dual qPCR detection of drug resistance of Haemonchus contortus

[0122] S1: Genomic DNA extraction: Use Axygen nucleic acid extraction kit to extract genes from the tested Haemonchus contortus or eggs in fecal samples.

[0123] S2 Type I β-tubulin gene qPCR detection: qPCR detection was performed after DNA extraction.

[0124] The primer and probe sequences used were SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The primers and probes were diluted to a working concentration of 10 μmol / L as required, and the reaction system was prepared according to the instructions of Premix EX Taq (ProbeqPCR), 12.5 μL Premix EX Taq (ProbeqPCR), 1 μL of upstream and downstream primers, 2 μL of DNA template (the test sample, positive control and negative control were set at the same time, the positive control was a mixture of fully sensitive and fully resistant plasmids constructed in Example 2, and the negative control was ddH2O.), 0.6 μL of each of the two probes, and 7.3 μL of sterile water. The reaction program was set as the first step at 95°C for 30s, the second step at 95°C for 5s, and 60°C for 30s, and the number of cycles was set to 40.

[0125] S3 Result determination: Determine whether there is Haemonchus contortus in the sample according to the qPCR amplification curve, and whether the Haemonchus contortus detected is resistant to albendazole. Figure 1 If the blue amplification curve is detected, it is judged that the sample contains albendazole-sensitive strains of Haemonchus contortus; if the signal of resistant strains is detected (such as Figure 1 If a yellow amplification curve is shown, it is determined that albendazole-resistant strains of Haemonchus contortus are present in the sample.

[0126] The comparative example was detected by ordinary PCR method

[0127] Use existing common PCR to detect the drug resistance of drug-resistant strains of Haemonchus contortus. This includes determining gene changes through sequencing and checking the results through electrophoresis. The electrophoresis results are shown in Fig.15 and Fig.16 .

[0128] The dual qPCR test only takes 1-2 hours, which is significantly shorter than the 5-7 days required for conventional PCR testing. The sensitivity and convenience are significantly improved. Moreover, the drug resistance test of Haemonchus contortus can be achieved through a single tube qPCR. The conventional PCR test takes 5-7 days, so dual qPCR is more convenient. The sensitivity of conventional PCR in detecting sensitive and resistant strains of Haemonchus contortus is 10 3 copies / μL, while the sensitivity of qPCR for sensitive and resistant strains was 10 1 copies / μL.

[0129] Although the present invention has been described above through embodiments, those skilled in the art should understand that without departing from the spirit and substance of the present invention, all improvements and modifications made to the present invention should fall within the protection scope of the present invention.

Claims

1. A primer and probe for detecting albendazole resistance of Haemonchus contortus, characterized in that: The primers for detecting the type I β-tubulin gene of Haemonchus contortus include the nucleotide sequences CGTCCATCAACTGGTAGAG and CCATAGGTTGGATTTGTGAG; The probes detected include: CGATGAAACATTCTGT and CGATGCAACATACTGT.

2. The primer for detecting albendazole resistance of Haemonchus contortus according to claim 1, characterized in that: The DNA double-stranded fragments used to detect the completely drug-resistant, 200 drug-resistant, completely sensitive, and 198 drug-resistant type I β-tubulin gene of the contorted nematode have nucleotide sequences as shown in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, respectively.

3. A method for detecting albendazole resistance of Haemonchus contortus, characterized in that: The double real-time fluorescence quantitative PCR detection method is adopted, including the steps: S1: Genomic DNA extraction: Extract genomic DNA of Haemonchus contortus or its eggs in fecal samples; S2: extracting DNA and performing qPCR amplification, wherein the qPCR amplification uses the primers of SEQ ID NO: 2, 3 and the probes of SEQ ID NO: 4, 5 as described in claim 1; S3 result determination: judging whether there is Haemonchus contortus in the sample tested according to the qPCR amplification curve, and whether the tested Haemonchus contortus is resistant to albendazole; using the gene control template described in claim 2 and ddH2O as positive and negative controls; If the sensitive insect strain signal is detected in the sample, it is determined that the albendazole-sensitive insect strain of Haemonchus contortus is present in the sample; If the signal of drug-resistant strains is detected in the sample, it is determined that albendazole-resistant strains of Haemonchus contortus are present in the sample.

4. The method for detecting albendazole resistance of Haemonchus contortus according to claim 3, characterized in that: 1 μL of each primer was added, and 0.6 μL of each probe was added.

5. The method for detecting albendazole resistance of Haemonchus contortus according to claim 3, characterized in that: The qPCR amplification reaction conditions in step S2 are: pre-denaturation at 95°C for 30s; 95°C for 5s, 60°C for 30s, and 40 cycles.

6. The method for detecting albendazole resistance of Haemonchus contortus according to claim 3, characterized in that: The control templates include a 198-site mutation template of Haemonchus contortus, a sensitive insect strain template, a 200-site mutation resistant template and a completely resistant insect strain template, wherein the 198-site mutation template is obtained by extracting DNA from the 198 resistant insect strain, and obtaining competent cells through amplification, cloning and transformation; the completely resistant insect strain template, the 200-site mutation resistant template and the sensitive insect strain template are obtained by custom synthesis and construction into a pUC vector using the nucleotide sequences SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO:

8.

7. The method for detecting albendazole resistance of Haemonchus contortus according to claim 6, characterized in that: The preparation of the target gene plasmid used as a positive control template includes preparing the 198-site mutation template, including the following steps: 1) Genomic DNA extraction: DNA was extracted from 198 drug-resistant insect strains. 2) The extracted type I β-tubulin gene was amplified by PCR. The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1.5 min, 35 cycles; and extension at 72°C for 10 min. 3) PCR product recovery: recover the type I β-tubulin gene PCR product and connect the PCR recovery product to the linearized vector; 4) Transformation of recombinant plasmid: The ligation product is transformed into competent cells for culture, a single colony is picked, inoculated into LB medium and cultured overnight, and the plasmid is extracted as a template for molecular detection of 198-site mutation-resistant insect strains.

8. The method for detecting albendazole resistance of Haemonchus contortus according to any one of claims 3 to 7, characterized in that: A positive control template is constructed using at least one of the fully sensitive and resistant genes among the genes described in claim 26.

9. The method for detecting albendazole resistance of Haemonchus contortus according to claim 6, characterized in that: The method for obtaining the control template includes synthesizing a recombinant plasmid and transforming competent cells: using a method of custom synthesis and construction into a pUC plasmid vector, using completely resistant, 200 resistant, and completely sensitive DNA double-stranded fragments to construct resistant and sensitive insect strain plasmid vectors, taking the synthesized plasmid to transform competent cells, and culturing them on solid LB culture medium to construct a recombinant standard plasmid.

10. The method for detecting albendazole resistance of Haemonchus contortus according to claim 9, characterized in that: Take 5 μL of each synthesized plasmid, add it to 50 μL of competent cells melted in an ice bath, spread it on solid LB medium containing antibiotics and culture it at 37°C overnight to construct a recombinant standard plasmid.

Images