A molecular marker for identifying the genetic sex of bullfrogs, an identification primer and a method for applying the same
By designing primers and using PCR methods to identify the genetic sex of bullfrogs and tadpoles, the problem of inaccurate identification in existing technologies was solved, and 100% accuracy was achieved, providing a foundation for cultivating all-male populations for bullfrog farming and improving economic benefits.
Patent Information
- Application Number
- CN202510074328.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-17
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2045-01-17
AI Technical Summary
Existing technologies are unable to accurately identify the genetic sex of bullfrogs, especially in the early tadpole stage of development, which affects the cultivation of all-male populations and the improvement of economic benefits.
A pair of primers was designed, and the differential segments of the male and female genomes were determined by genome resequencing. The genetic sex of bullfrogs and tadpoles was identified using PCR and molecular marker identification technology.
The accurate identification of the sex of bullfrogs and tadpoles was achieved with 100% accuracy, laying a technical foundation for the selection and breeding of single-sex groups in production and improving economic benefits.
Smart Images

Figure CN119876415B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker for identifying the genetic sex of bullfrogs, an identification primer and an application method thereof. Background Art
[0002] As a high-quality aquaculture species, the bullfrog (Rana catesbeiana) has been widely cultivated and developed worldwide in recent years, particularly in China, the United States, and several Asian countries. Its strong adaptability and rapid growth rate allow it to be successfully cultivated in a wide range of climates. Bullfrogs are primarily favored for their delicious meat, rich protein, and high nutritional value. Rich in amino acids, vitamins, and minerals, they are widely used in mid- to high-end catering, with high consumer demand particularly in Asia, Europe, and the United States. The global economic benefits and potential of bullfrog farming cannot be ignored. With growing market demand and continuous technological advancements, bullfrog farming is expected to continue to be a key component of the aquaculture industry, playing a significant role in improving the global food supply chain, promoting agricultural modernization, and boosting local economic development. Bullfrog farming not only enjoys high market demand but also offers strong economic benefits, making it a key source of income for many farmers and businesses.
[0003] At present, bullfrog breeding has some new development prospects. Bullfrog males have a fast growth rate in the early stage and can better adapt to market demand. They also have a higher meat yield than female bullfrogs and are more popular in the market. Cultivating all-male populations is conducive to improving economic benefits. However, there are no reports on the research on the sex determination mechanism, sex differentiation and all-male population production of bullfrogs. Although the sex of bullfrogs can be determined by external morphological observation in production, there is no way to determine the genetic sex of bullfrogs (bullfrogs are easily induced to sex reversal by environmental factors such as temperature in the early stages of development), and the sex of tadpoles cannot be identified by external morphological observation. In order to obtain the purpose of all-male bullfrog breeding, bullfrogs need to be treated with estrogen induction during design, and then pseudo-female bullfrogs (XY, ♀) with male genetic sex are selected as parents by the identification of genetic sex, and mated with male male bullfrogs (XY, ♂) with male genetic sex, and super-male bullfrogs (YY, ♂) are screened out in the offspring. Then, all-male offspring are obtained by mating with female female bullfrogs (XX, ♀) with female genetic sex. This process lacks the use of molecular markers to identify the genetic sex of bullfrogs.
[0004] Therefore, the practical value of studying the sex determination and sexual differentiation of bullfrogs is to produce monosex populations. Monosex breeding has many advantages, such as faster growth rate, better meat quality, more uniform individual size, and higher reproductive value.
[0005] Prior art CN111593128A discloses a molecular marker for identifying the genetic sex of the Northeast Forest Rana. Its main features include extracting the genome of the Northeast Forest Rana's toe tissue, using the extracted genomic DNA as a template, and performing a PCR amplification reaction with a primer pair containing the sequences shown in SEQ ID NO:1 and SEQ ID NO:2. The PCR amplification product is electrophoresed on a 14% polyacrylamide gel. The results indicate that individuals with a band corresponding to the nucleotide sequence shown in SEQ ID NO:3 (222 bp) are genetically male Northeast Forest Rana, while individuals lacking the band corresponding to SEQ ID NO:3 are genetically female Northeast Forest Rana.
[0006] Prior art CN110964798A discloses the extraction of the genome of the toe tissue of the Northeast Forest Rana, using the extracted genomic DNA as a template and a primer pair containing the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 to perform a PCR amplification reaction. The PCR amplification product was subjected to electrophoresis detection by 14% polyacrylamide gel. The individual with the corresponding band of the nucleotide sequence shown in SEQ ID NO: 3 (261bp) in the amplification result was a genetic male Northeast Forest Rana, and the individual lacking the corresponding band of the nucleotide sequence shown in SEQ ID NO: 3 was a genetic female Northeast Forest Rana. This invention can identify pseudo-male individuals, that is, individuals that are physiologically male but genetically female. By mating pseudo-male individuals with female individuals, the proportion of physiological females in the offspring produced is as high as more than 90%. It can achieve gender control of the Northeast Forest Rana breeding population and improve the economic benefits of Northeast Forest Rana breeding.
[0007] However, none of the above existing technologies involve sex identification of bullfrogs. The successful development of the marker of the present invention can accurately identify the sex of tadpoles and can accurately identify the sex of adult frogs, laying a key technical foundation for the single-sex group breeding strategy in production. Summary of the Invention
[0008] The present invention aims to overcome the deficiencies in the prior art. The present invention first provides a molecular marker for identifying the genetic sex of bullfrogs, wherein the molecular marker comprises SEQ ID NO: 2 and / or SEQ ID NO: 4.
[0009] In certain embodiments, the molecular marker consists of SEQ ID NO: 2 and / or SEQ ID NO: 4.
[0010] In certain embodiments, the molecular marker is SEQ ID NO: 1 and / or SEQ ID NO: 3.
[0011] The present invention also provides the use of the above-mentioned molecular marker for identifying the genetic sex of bullfrogs in the preparation of a product for identifying the genetic sex of bullfrogs.
[0012] In certain embodiments, the product is a primer, a probe, or a kit.
[0013] In certain embodiments, the primers comprise SEQ ID NO:4 and SEQ ID NO:5.
[0014] The present invention also provides a primer set for identifying the molecular marker for identifying the genetic sex of bullfrogs as described above, wherein the primers comprise SEQ ID NO: 4 and SEQ ID NO: 5.
[0015] The present invention also provides a kit for identifying the molecular markers for identifying the genetic sex of bullfrogs as described above, wherein the kit comprises the primer set as described above.
[0016] The present invention also provides an application of the primer set or the kit in identifying the genetic sex of bullfrogs.
[0017] The present invention also provides a method for identifying the genetic sex of bullfrogs, which comprises the step of performing PCR amplification using the above primer set or the above kit.
[0018] Compared with the prior art, the present invention has at least the following beneficial effects:
[0019] The present invention has successfully developed a molecular marker that can accurately identify the sex of tadpoles and adult frogs, laying a key technical foundation for single-sex population breeding strategies in production. By collecting bullfrog and tadpole samples and using genome resequencing to identify differential segments in the male and female genomes, the present invention designed a pair of primers that can accurately identify the genetic sex of adult frogs and tadpoles using PCR. The present invention's molecular sex marker can accurately identify the genetic sex of bullfrogs with 100% accuracy. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is a picture of a female sexually mature bullfrog;
[0021] Figure 2 This is a picture of a sexually mature male bullfrog;
[0022] Figure 3 HE staining of tadpole ovary;
[0023] Figure 4 This is the HE staining picture of tadpole testis;
[0024] Figure 5 Molecularly labeled gel maps for bullfrogs and tadpoles. DETAILED DESCRIPTION
[0025] The following is a detailed description of an embodiment of the present invention. It should be noted that this embodiment is descriptive rather than restrictive and should not be used to limit the scope of protection of the present invention.
[0026] Unless otherwise specified, the raw materials used in the present invention are conventional commercial products; the methods used in the present invention are conventional methods in the art unless otherwise specified.
[0027] The partial sequence of the male bullfrog genome is:
[0028] AGATTGACTGGATGTGCTATAGATGTCTTGTATACAATGATGAACCTCTTT
[0029] AATTGGAGTACAGATGGTAGAATACAGCCAACGCATTTTGGGGGACAAG
[0030] AGACTCCCCTTCTTTAGGGCTGCTGTTTGAATATGGATCCCGTTAGGGT
[0031] CTGTTCTGGGACCTGAGAATCAGGTCTGGGAATGTCACAGACAGACAGGT
[0032] CCCAAACAGACCCTAACAGGATCCATATTCAAACAGCAGCCCTGAGGAA
[0033] GGGAAGCCCCTTGTCCCCTGAAACGCATTGGATGTATTCTACCATCTCTA
[0034] CTCCAAATAAAACAGTTTATTTCACAAACTACTGCATTTCGGGCTCTCCTT
[0035] TACATTCACCTGCTTTGATCAATATGGGAGCAACCGCCTGGCCACACCCT
[0036] CAGGTAGCAGCCCATACCTGTAACAGGGTTTACCATCTTCACAAAACAGT
[0037] CAGGCATCAAACTCTGTAAAAAACCTTTCTTACCTTGCCTATTGGAACTCCTACCTACAACCA(SEQID No.1);
[0038] The male bullfrog genome-specific sequence is:
[0039] TTTCTTACCTTGCCTATTGGAACTCCTACCTACAACCA (SEQ ID No. 2); The partial genome sequence of the female bullfrog is:
[0040] AGATTGACTGGATGTGCTATAGATGTCTTGTATACAATGATGAACCTCTTT
[0041] AATTGGAGTACAGATGGTAGAATACAGCCAACGCATTTTGGGGGACAAG
[0042] AGACTCCCCTTCTTTAGGGCTGCTGTTTGAATATGGATCCCGTTAGGGT
[0043] CTGTTCTGGGACCTGAGAATCAGGTCTGGGAATGTCACAGACAGACAGGT
[0044] CCCAAACAGACCCTAACAGGATCCATATTCAAACAGCAGCCCTGAGGAA
[0045] GGGAAGCCCCTTGTCCCCTGAAACGCATTGGATGTATTCTACCATCTCTA
[0046] CTCCAAATAAAACAGTTTATTTCACAAACTACTGCATTTCGGGCTCTCCTT
[0047] TACATTCACCTGCTTTGATCAATATGGGAGCAACCGCCTGGCCACACCCT
[0048] CAGGTAGCAGCCCATACCTGTAACAGGGTTTACCATCTTCACAAAACAGTCAGGCATCAAACTCTGTAAAAAAACCTTTCTTTCAACC (SEQ ID No. 3); the female bullfrog genome-specific sequence is:
[0049] TTTCTTTCAACC (SEQ ID No. 4);
[0050] Example 1
[0051] The application determines the difference fragments of male and female genomes by collecting the materials of bullfrog and tadpole, using genome resequencing, designs a pair of primers, and can accurately identify the genetic sex of adult frog and tadpole by PCR method.
[0052] The specific information of the application patent is as follows:
[0053] The partial sequence of male bullfrog genome is shown as SEQ ID No. 1.
[0054] The partial sequence of female bullfrog genome is shown as SEQ ID No. 2.
[0055] According to the above different sequence parts of male and female, a pair of primers is designed, and the sequence information is as follows:
[0056] NW-510-F: AGATTGACTGGATGTGCTATAG (SEQ ID No. 5);
[0057] NW-510-R: TAGGTAGGAGTTCCAATAGGC (SEQ ID No. 6);
[0058] Then, the above primers are used for PCR reaction.
[0059] We obtained 60 physiological female bullfrogs and 60 physiological male bullfrogs by dissecting bullfrogs to observe the gonads.
[0060] The observation standards are shown in Figure 1 and Figure 2 ;
[0061] In addition, after the tadpoles are tail-free (DNA is collected), paraffin sections are prepared, and the results of HE staining are observed to check the testes and ovaries to determine the physiological male and female tadpoles, so that 20 female tadpoles and 13 female tadpoles are obtained. The observation standards of HE staining sections are shown in Figure 3 and Figure 4 ;
[0062] The bullfrog samples whose gender has been identified are collected, and the DNA of the bullfrog is extracted by a DNA extraction kit to prepare a PCR template, and the specific reaction system is as follows: 2xMasterMix (Nanjing Novozyme Biotech Co., Ltd.) 10.0 μL, upstream primer (NW-510-F) 1.0 μL, downstream primer (NW-510-R) 1.0 μL, DNA template 2.0 μL, ddH2O 6.0 μL, a total of 20.0 μL; the reaction program is as follows: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, 70℃ annealing for 30s, 72℃ extension for 80s, 30 cycles; 72℃ extension for 7min, 4℃ storage.
[0063] After obtaining the PCR product, perform agarose gel electrophoresis. Figure 5 As shown:
[0064] We collected data from all 120 frogs and 30 tadpoles, and the data are shown in Table 1 below:
[0065] Table 1 Test results
[0066]
[0067] In summary, the accuracy of identifying the genetic sex of bullfrogs using the sex molecular markers of the present invention can reach 100%, and has great application prospects in the industry.
[0068] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A molecular marker for identifying the genetic sex of bullfrogs, characterized in that: The molecules are labeled as SEQ ID NO: 1 and SEQ ID NO:
3.
2. A primer set for identifying the molecular marker for identifying the genetic sex of bullfrog according to claim 1, characterized in that: The primers comprise SEQ ID NO:5 and SEQ ID NO:
6.
3. A kit for identifying molecular markers for identifying the genetic sex of bullfrogs according to claim 1, characterized in that: The kit comprises the primer set according to claim 2.
4. Use of the primer set according to claim 2 or the kit according to claim 3 in identifying the genetic sex of bullfrogs.
5. A method for identifying the genetic sex of a bullfrog, characterized in that: The method comprises the step of performing PCR amplification using the primer set according to claim 2 or the kit according to claim 3.
Citation Information
Patent Citations
Method for identifying genetic sex of rana dybowskii by TRAP molecular marker technology
CN110964798A
Molecular marker for identifying genetic sex of rana dybowskii and application method thereof
CN111593128A
Digital PCR detection method for environment DNA of giant spiny frog
CN116814809A
Application of luteolin in bullfrog breeding, bullfrog tadpole metamorphosis development promotion and sex differentiation regulation
CN119074716A