Primer and method for identifying species of sika deer, wapiti and their hybrid individuals based on nuclear DNA sequences

Abstract

The present invention is applicable to the field of biotechnology, and provides primers and a discrimination method for discriminating the species of sika deer, wapiti and their hybrid individuals based on nuclear DNA sequences. The discrimination primers include primer pair (a) containing SEQ ID NO.1 and SEQ ID NO.2 and / or primer pair (b) containing SEQ ID NO.3 and SEQ ID NO.4. Using the discrimination primers to perform PCR amplification on the target genome and detecting the amplification products, one band indicates sika deer, two bands indicate wapiti, and three bands indicate the hybrid individuals of sika deer and wapiti. The present invention has screened out interspecific specific SNP markers between wapiti and sika deer, and established a PCR-RFLP genotyping method based on this. Through designing primers and constructing and optimizing the PCR amplification system, this method realizes the accurate species discrimination of sika deer, wapiti and hybrid individuals, which is rapid, low-cost and suitable for large-scale detection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to primers and an identification method for species identification of sika deer, red deer and their hybrid individuals based on nuclear DNA sequences. Background Art

[0002] Both sika deer and red deer are important members of the Cervidae family. Their antlers, blood, bones, penis, and fetuses all have medicinal value. Deer meat is highly sought after by consumers for its tender texture, delicious flavor, and rich protein, unsaturated fatty acids, and vitamins. Currently, the prices of sika deer antlers, blood, meat, and other products are significantly higher than those of red deer. Furthermore, sika deer are smaller and produce less antler and meat than red deer. This has led to the phenomenon of products from red deer or hybrids of red deer passing themselves off as sika deer. The influx of imported red deer products, in particular, has further exacerbated the market for deer products and seriously impacted the healthy development of the industry. Therefore, it is imperative to establish a rapid and efficient method for identifying red deer and sika deer.

[0003] Currently, methods for distinguishing sika deer from red deer primarily include morphological characteristics, immunological identification based on protein levels, and molecular identification based on DNA. However, morphological identification is limited in scope, as it is only effective for some products that remain in their original state. Protein-based testing, on the other hand, is costly, exhibits poor batch-to-batch stability, and is only applicable to a limited number of deer products. Furthermore, protein-based testing cannot detect interspecies hybrids. DNA molecular markers, due to their environmental resistance, high accuracy, sensitivity, and ease of use, are currently a hot topic in animal and plant species identification and are widely used for species identification of sika deer and red deer. DNA-based species identification methods primarily include species-specific PCR amplification, DNA barcoding, PCR-RFLP, and LAMP amplification. These methods all rely on mitochondrial DNA sequences. However, due to the maternal inheritance of mitochondrial DNA (mitochondria are present only in the mother), these methods are ineffective in identifying hybrid deer. In addition, the species-specific PCR method is complicated to operate, and non-specific amplification is prone to occur, resulting in false positives, due to the high homology of sequences between species; DNA barcoding technology requires sequencing of PCR products, which has the disadvantages of high cost and long cycle time; although LAMP amplification has high sensitivity, it is easily contaminated by environmental DNA and produces false positives. In addition, although the gene chip method based on large-scale SNP markers can effectively detect red deer, sika deer and hybrid individuals, it is costly, time-consuming and requires specialized detection and data analysis platforms, making it difficult to achieve large-scale detection. Therefore, it is very necessary to screen species-specific molecular markers for chromosomal DNA of sika deer and red deer, and to establish a method with low detection cost, easy operation and suitable for large-scale detection. For this reason, the present invention proposes species identification primers and identification methods for sika deer, red deer and their hybrid individuals based on nuclear DNA sequences. Summary of the Invention

[0004] The purpose of the present invention is to provide primers and identification methods for species identification of sika deer, red deer and their hybrid individuals based on nuclear DNA sequences, aiming to solve the problems raised in the above background technology.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] Species identification primers for sika deer, red deer, and their hybrids based on nuclear DNA sequences, wherein the identification primers are as follows (a) and / or (b):

[0007] (a) SRMID1-F, the nucleotide sequence of which is shown in SEQ ID NO. 1, 5'-ATCAAAAGCACCACCCTCAATCT-3';

[0008] SRMID1-R, the nucleotide sequence of which is shown in SEQ ID NO. 2, is 5′-TGCCCTTCTGACCAGTGTGTTTC-3′;

[0009] (b) SRMID2-F, the nucleotide sequence of which is shown in SEQ ID NO. 3, 5'-AAGCAACCAAAAAGGCAAACTAT-3';

[0010] SRMID2-R, the nucleotide sequence of which is shown in SEQ ID NO. 4, is 5'-GAAACAGTCTTACCAAAGAACTGTGTATC-3'.

[0011] Based on the application of the above-mentioned identification primers in identifying the species of sika deer, red deer and their hybrid individuals.

[0012] A method for species identification of sika deer, red deer, and their hybrids based on nuclear DNA sequences comprises performing PCR amplification on the target genome using the identification primers described above, and detecting the amplified products. The presence of one band indicates a sika deer, two bands indicates an red deer, and three bands indicates a hybrid of a sika deer and a red deer.

[0013] Furthermore, the identification primers of (a): the amplified product showed a 530bp band, and the target genome was sika deer; the amplified product showed two bands of 377bp and 153bp, and the target genome was red deer; the amplified product showed three bands of 530bp, 377bp, and 153bp, and the target genome was a hybrid individual.

[0014] Furthermore, the identification primers of (b): the amplified product showed a 490bp band, and the target genome was sika deer; the amplified product showed two bands of 328bp and 162bp, and the target genome was red deer; the amplified product showed three bands of 490bp, 328bp, and 162bp, and the target genome was a hybrid individual.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] Based on whole-genome data from sika deer and red deer, this study screened for species-specific SNP markers between red deer and sika deer, and established a PCR-RFLP genotyping method based on these markers. By designing primers and constructing and optimizing a PCR amplification system, this method enables rapid, low-cost, and scalable species identification of sika deer, red deer, and their hybrids. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1The following are the results of PCR amplification and electrophoresis; A is the 530 bp band amplified by the primer pair SRMID1-F and SRMID1-R, and B is the 490 bp band amplified by the primer pair SRMID2-F and SRMID2-R; M in the figure: DL2000 DNA Marker; 1-4: Siping sika deer; 5-12: hybrid deer; 13-16: Qingyuan red deer.

[0018] Figure 2 The following are the results of enzyme electrophoresis of PCR products; A is the genotype of the individual determined by the size of the enzyme-digested fragment at the SRMID1 locus, and B is the genotype of the individual determined by the size of the enzyme-digested fragment at the SRMID2 locus; M in the figure: DL2000 DNA Marker; 1-4: Siping sika deer; 5-12: hybrid deer; 13-16: Qingyuan red deer.

[0019] Figure 3 These are the sequencing peak graphs of three genotypes at two sites; A is the sequencing peak graph of three genotypes at the SRMID1 site, and B is the sequencing peak graph of three genotypes at the SRMID2 site.

[0020] Figure 4 The following are the population genotyping results; A is the population genotyping result based on the SRMID1 locus, and B is the population genotyping result based on the SRMID1 locus; M in the figure: DL2000 DNA Marker; 1-4: Dongfeng sika deer; 5-8: Shuangyang sika deer; 9-12: Dongda sika deer; 13-16: Tahe red deer; 17-20: Yihe red deer; 21-24: New Zealand red deer; 25-28: hybrid deer. DETAILED DESCRIPTION

[0021] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of implementation of the present invention.

[0022] The specific implementation of the present invention is described in detail below with reference to specific embodiments.

[0023] Example 1: Screening and identification of species-specific SNP markers in sika deer and red deer;

[0024] (1) Screening of species-specific SNP markers;

[0025] Whole-genome resequencing data from red deer and sika deer were filtered using Fastp software to obtain CleanData. CleanData was aligned to the red deer reference genome version mCerEla1.1 (GCF_910594005.1) using BWA software. The results were then aligned and repetitive sequences were marked using Picard software to generate a bam file. SNPs were merged and genotyped using the GATK official website's recommended workflow. Diallel loci located on autosomes were extracted and filtered based on minimum allele frequency (MAF > 0.2) and missingness rate (geno < 0.05) to identify high-quality SNPs. Fst values ​​were calculated for red deer and sika deer populations using vcftools software. Loci with an Fst value of 1 were counted and then screened based on the SNP's genomic location, chromosome number, flanking nucleotide sequence characteristics, and the type of endonuclease at the polymorphic locus. Finally, two loci located on chromosomes 19 and 22 were selected for subsequent analysis and named SRMID1 (Chr19: g. 47535071 T>C) and SRMID2 (Chr22: g.27605668 T>C), respectively. Detailed information is shown in Table 1. Both SNP polymorphisms exist Pst I endonuclease cutting site.

[0026] Table 1 Species-specific SNP information of sika deer and red deer

[0027]

[0028] (2) Primer design and PCR amplification;

[0029] To amplify these two SNP polymorphic sites, 400 bp of flanking DNA sequences on both sides of each site were extracted, and two pairs of primers were designed using Primer Premier 5.0. The primer sequence information and amplification length are shown in Table 2:

[0030] Table 2 PCR amplification primer information

[0031]

[0032] The DNA sequences of the amplified regions and the SNP polymorphism sites are as follows:

[0033] SRMID1:

[0034] ATCAAAAGCACCACCCTCAATCTCAAAGATGTAGTTCCTCTGCAAGTCCAGCTCCCTGAGGTGGCCCAGGCCCTCAAAGATGGACTCATCAAGCCTCATGATGATGTTCCTCGCCAGGGACACGGACTCCAGTGAAGACAGGTTCTGGAGCATCAGAGCCGCCATGTCTTCCGTCAGGGAGTTCCCTGATAAGTCCAGCATGCGCAGAGCGCGCAGGCTGTGGAGGGCGGCCGCCGTCTCCTTGTAGTTCTCAGAGAGGGAGTTGTCAGGCAGCGACAGGCTGCGCAGGTGGGCCTGCTCCTGAAAGGCGACGTGGCCAATGCGCTCCAGGTAGCAGTCGTGCAGACTGAGGCTCTCCAGGAAAGGGTAACGC(T / C)GCAGTGAGTTGTTCCCCAGGGTCTTGAGAGGGTTGGCATCCAGGAGGAGCATCCGGGACGAGGGTGGGAGATCGCTGGGCACTGAAGCAAGGTTCCGCCCTCGACAGTCAGCCACTCCATCAAGCTAGGTCCA GAAACACACTGGTC AGAAGGGCA (as shown in SEQ ID NO.5).

[0035] SRMID2:

[0036] AAGCAACCAAAAAGGCAAACTATATATTTGAAAACACAGTTGTGGTTCATGGTTAATTATTTCATATCTCTAAGAGAATGTTTTAGTTGCACACAAAAGGTAAATTTAATTACCATACAAATGTTTGAAACTCTCTGATATAATAAAATCCCCCAGGATCACATGTCTACTAAACAGACTTCCTTCTCTTTCCAAATACATTATTGATCAGCTTGGCCATGGATTTAGATCCACTGTATCTTCTC TTTTCTTTGAGTTTGAGGTTTGTCAGGATGTCCCTGATAATTCTGATGAACATCATTTCCACCTCCAGAGATTGCTCTGC(T / C)GCAGAGAGTTCACAGAACCGGCAGCGGTTCTCCAGGGCCAGTCTGTGCCCTTCTGTCCAGCCAACCTCTCGCACATGACAGAGATCTTGCTTGTTACCCACCAGAAGCACTGCTGACTCCACAGCTCTGAAACACA GATACACAGTTCTTTGGTAAGACTGTTTC (As shown in SEQ ID NO.6).

[0037] Note: The underlined sequence indicates the primer position; the two alleles of SNP are in brackets.

[0038] In addition to the general basic principles, primer design also takes into account that the enzyme-cleaved fragments of the amplified product should be easy to distinguish by agarose gel electrophoresis. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0039] DNA extraction and PCR amplification were performed on 16 samples, including four Qingyuan red deer, four Siping sika deer, and eight hybrid deer (red deer (♀) crossed with sika deer (♂), or sika deer (♀) crossed with red deer (♂)). The PCR amplification reaction system consisted of 30 µL of the following: 15 µL of 2× PCR Master Mix, 1 µL of DNA template, 0.25 µL of each forward and reverse primer, and 13.5 µL of ddH₂O. PCR amplification conditions were as follows: 95°C pre-denaturation for 3 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; and extension at 72°C for 10 min. PCR products were analyzed by 2.5% agarose gel electrophoresis. The two primer pairs amplified bands of 530 and 490 bp, respectively, which were consistent with the expected values ​​( Figure 1 ).

[0040] (3) Enzyme digestion and genotype determination;

[0041] The PCR products were used Pst I endonuclease digestion, the digestion system is 10 μL: 10× buffer 1 μL, Pst I0.5 µL, 4 µL of PCR product, and ddH2O were added to 10 µL. Enzyme digestion was performed overnight at 37°C. Subsequently, the digestion products were detected by 2.5% agarose gel electrophoresis, and the genotype of the individual was determined based on the size of the digested fragments. At the two SNP polymorphic sites, all red deer (TT) individuals produced two bands, sika deer (CC) individuals produced one band, and hybrid deer (TC) individuals produced three bands ( Figure 2 The information on the sizes of enzyme-digested fragments of different genotypes at the two SNP polymorphic sites is shown in Table 3:

[0042] Table 3 PCR-RFLP restriction fragment information

[0043]

[0044] In order to verify the accuracy of the enzyme digestion results, PCR products of three genotype individuals were selected for first-generation sequencing. The results showed that the DNA sequence of the SNP site was consistent with the expected ( Figure 3 ).

[0045] (4) Group identification analysis;

[0046] To verify the universality of the two SNP loci in this invention, genotyping analysis was performed on three red deer populations (Tahe red deer, Yihe red deer, and New Zealand red deer); three sika deer populations (Dongfeng sika deer, Shuangyang sika deer, and Dongda sika deer); and hybrid deer (F1 hybrid of Qingyuan red deer (♀) and Siping sika deer (♂)). Four individuals from each population, for a total of 28 samples, were included. Gel electrophoresis results showed that all 12 red deer samples produced two bands, all 12 sika deer samples produced one band, and all four hybrid deer samples produced three bands ( Figure 4 This indicates that the two SNPs are common among different subspecies or breeds of red deer and sika deer.

[0047] The above are only preferred embodiments of the present invention. It should be pointed out that for those skilled in the art, several variations and improvements can be made without departing from the concept of the present invention. These should also be regarded as the scope of protection of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. A method for identifying the species of sika deer, red deer and their hybrids based on nuclear DNA sequences, characterized in that: PCR amplification of the target genome was performed using identification primers, and the amplified products were detected. Pst I endonuclease digestion, the emergence of a band is sika deer, two bands are red deer, three bands are hybrid individuals of sika deer and red deer; The identification primers are as follows (a) and / or (b): (a) SRMID1-F, the nucleotide sequence of which is shown in SEQ ID NO. 1, 5'-ATCAAAAGCACCACCCTCAATCT-3'; SRMID1-R, the nucleotide sequence of which is shown in SEQ ID NO. 2, is 5′-TGCCCTTCTGACCAGTGTGTTTC-3′; (b) SRMID2-F, the nucleotide sequence of which is shown in SEQ ID NO. 3, 5'-AAGCAACCAAAAAGGCAAACTAT-3'; SRMID2-R, the nucleotide sequence of which is shown in SEQ ID NO. 4, is 5′-GAAACAGTCTTACCAAAGAACTGTGTATC-3′; Identification primers for (a): If a 530 bp band appears in the amplified product, the target genome is sika deer; if two bands of 377 bp and 153 bp appear in the amplified product, the target genome is red deer; if three bands of 530 bp, 377 bp, and 153 bp appear in the amplified product, the target genome is a hybrid individual; (b) Identification primers: The amplified product showed a 490bp band, and the target genome was sika deer; the amplified product showed two bands of 328bp and 162bp, and the target genome was red deer; the amplified product showed three bands of 490bp, 328bp, and 162bp, and the target genome was a hybrid individual.

Images