SNP molecular marker related to southern rust gene RPPK and application

Abstract

The invention relates to the technical field of molecular biology or agriculture, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to a southern rust gene RPPK and application. The SNP loci, the primers and the detection method capable of resisting southern rust gene RPPK typing are successfully developed, the southern rust gene RPPK can be accurately subjected to genetic typing, and the SNP molecular marker has the characteristics of high throughput, low average cost, high genetic stability, accurate and reliable genetic typing data, easiness in automatic detection and the like; and the method has an extremely high value in commercial breeding.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology or agronomy technology, and in particular to a SNP molecular marker related to a southern rust gene RPPK and an application thereof. Background Art

[0002] Corn (Zea mays L.), the world's largest crop planted for feed, industrial raw materials, food, and energy, is susceptible to various pests and diseases, leading to yield reductions. Southern rust is a parasitic fungal disease caused by Puccinia polysora. The pathogen's spores can be easily spread quickly and over long distances by typhoons and other environmental factors. Breeding corn varieties resistant to southern rust is one of the most direct and effective ways to reduce its impact.

[0003] In the corn breeding process, the disease resistance identification of breeding materials is the key to directly determining whether the material is suitable for further research. Conventional identification is to directly use pathogens for infection, but this method is greatly affected by the environment and region, and the cost is high. In recent years, with the research on southern rust resistance genes, the use of molecular markers can quickly and effectively screen out breeding materials containing disease-resistant genes at the seed stage. Compared with pathogen inoculation, seeds for screening disease-resistant materials can be preliminarily screened in the laboratory, and materials containing resistance genes can be planted in the field, saving various expenses and improving breeding efficiency.

[0004] With the development of technology, some southern rust resistance genes have been gradually cloned or located in corn, including Rpp1–Rpp11 、 RppM, RppK, RppD, RppS, RppQ, RppC However, some genes lose resistance with the evolution of physiological subspecies of southern rust. Over-reliance on the development of a single gene may further reduce disease resistance. Currently, the commonly used tests for southern rust resistance genes are RppM、RppC However, its scope of application cannot include all physiological subspecies or genetic materials of pathogens, so it is imperative to develop new resistance gene detection methods.

[0005] RpK It is one of the key genes for corn resistance to southern rust and was successfully cloned in 2022. The gene is located on the short arm of chromosome 10 of corn and belongs to the NLR (nucleotide-binding leucine-rich repeat) family. RpK It exhibits broad-spectrum and durable resistance to multiple physiological races of the fungus Puccinia multicilinica. Less than 3% of corn germplasm resources carry this gene, highlighting its rarity and breeding value.

[0006] because RpKThe genes have high similarity in resistant materials and susceptible materials. The detection markers developed by the original research team require high-fidelity DNA polymerase for touchdown PCR amplification for detection. This is costly, produces many impurities, has low throughput, and affects the interpretation of results and work efficiency, making it difficult to be widely used in commercial breeding. Summary of the Invention

[0007] In the first aspect, the present invention provides a method for RPPK The related SNP molecular marker is SNP1 or SNP2; the SNP1 molecular marker is located at the 510th position of the nucleotide sequence shown in SEQ ID NO.1, and the SNP2 molecular marker is located at the 491st position of the nucleotide sequence shown in SEQ ID NO.1.

[0008] In a specific implementation process, the base polymorphism of SNP1 is A / T; the base polymorphism of SNP2 is T / C.

[0009] In a specific implementation process, when the genotype of SNP1 is A / A homozygous or A / T heterozygous, the material is a disease-resistant gene type; when the genotype of SNP1 is T / T homozygous, the material is a sensitive gene type; When the genotype of SNP2 is T / T homozygous or T / C heterozygous, the material is a disease-resistant gene type; when the genotype of SNP2 is C / C homozygous, the material is a sensitive gene type.

[0010] In a second aspect, the present invention provides primers for amplifying the SNP molecular marker.

[0011] Preferably, the forward primer for amplifying SNP1 is shown as SEQ ID NO.2 or SEQ ID NO.3, and the reverse primer for amplifying SNP1 is shown as SEQ ID NO.4; the forward primer for amplifying SNP2 is shown as SEQ ID NO.5 or SEQ ID NO.6, and the reverse primer for amplifying SNP2 is shown as SEQ ID NO.7.

[0012] In a third aspect, the present invention provides a southern rust gene RPPK A genotyping kit comprising the primers.

[0013] In a fourth aspect, the present invention provides the SNP molecular marker, the primer, or the kit in the southern rust gene RPPK Applications in genotyping.

[0014] In a fifth aspect, the present invention provides a southern rust gene RPPKThe genotyping method comprises: using the genomic DNA of the material to be tested as a template, performing a PCR amplification reaction using the primers, and quantifying the southern rust gene according to the SNP molecular markers. RPPK Perform genotyping.

[0015] In a specific implementation process, when the genotype of SNP1 is A / A homozygous or A / T heterozygous, the material is a disease-resistant gene type; when the genotype of SNP1 is T / T homozygous, the material is a sensitive gene type; When the genotype of SNP2 is T / T homozygous or T / C heterozygous, the material is a disease-resistant gene type; when the genotype of SNP2 is C / C homozygous, the material is a sensitive gene type.

[0016] In the specific implementation process, the reaction conditions of the PCR amplification reaction when detecting the SNP1 site are: Pre-denaturation at 94°C for 15 minutes; first amplification reaction: denaturation at 94°C for 20 seconds, annealing and extension at 61°C to 55°C for 60 seconds, 10 touch-down cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; second amplification reaction: denaturation at 94°C for 20 seconds, annealing and extension at 55°C for 60 seconds, 32 cycles; The reaction conditions for PCR amplification reaction when detecting SNP2 site are: Pre-denaturation at 94°C for 15 minutes; first amplification reaction: denaturation at 94°C for 20 seconds, annealing and extension at 68°C-62°C for 60 seconds, 10 touch-down cycles, with the annealing and extension temperature decreasing by 0.6°C in each cycle; second amplification reaction: denaturation at 94°C for 20 seconds, annealing and extension at 62°C for 60 seconds, 34 cycles.

[0017] In the specific implementation process, the material is corn material.

[0018] Compared with the prior art, the present invention has the following beneficial effects: The present invention has successfully developed a gene that can resist southern rust RPPK The typing of SNP sites, primers and detection methods can accurately combat southern rust genes RPPK For genotyping, SNP molecular markers have the characteristics of high throughput, low average cost, high genetic stability, accurate and reliable genotyping data, and easy automated detection, and are of extremely high value in commercial breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 These are the results of part of the population material detection using RPPK gene detection markers and methods published by the original author.

[0020] Figure 2The figures are the PCR band phenotypes of 10 representative materials and controls in sequencing primers.

[0021] Figure 3 The genotypes of 10 representative materials and controls were sequenced using sequencing primers.

[0022] Figure 4 This is the typing effect of KASP primer RPPK-1 in 190 materials (including 2 controls); each light spot represents the genotype of a corn material, blue is the AA homozygous resistant type, red is the TT homozygous sensitive type, green is the AT heterozygous resistant type, and black is the water control.

[0023] Figure 5 This is the typing effect of KASP primer RPPK-2 in 190 materials (including 2 controls); each light spot represents the genotype of a corn material, blue is the TT homozygous resistance type, red is the CC homozygous sensitive type, green is the TC heterozygous resistance type, black is the water control, and yellow light spots are samples where amplification failed.

[0024] Figure 6 This is the typing effect of KASP primer RPPK-3 under different PCR conditions in 190 materials (including 2 controls). A is the typing result of condition 1, and B is the typing result of condition 2. Each light spot represents the genotype of a corn material. The blue one is the TT homozygous resistant type, the red one is the CC homozygous sensitive type, the green one is the TC heterozygous resistant type, and the black one is the water control. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below. Obviously, the described embodiments are part of embodiments of the present invention, rather than all embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. In the embodiments provided in this specification, those without specifying specific techniques or conditions are described in accordance with the techniques or conditions described in the literature in this area, or are carried out according to product specifications. Reagents or instruments used are not specified by manufacturer and are conventional products that can be purchased through regular channels.

[0026] The present invention relates to molecular biology experiments. Unless otherwise noted, reference can be made to the book Molecular Cloning (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used reference books for those skilled in the art when conducting molecular biology experiments. Furthermore, depending on the purpose of the experiment, those skilled in the art can perform the corresponding experiments under the guidance of the operating manuals provided with various commercial kits or outsource the experiments to specialized companies, such as those for gene sequencing.

[0027] Example 1. We used 188 samples from our company's corn germplasm resource bank to construct a natural population (hereinafter referred to as the population). We used the CTAB method to extract DNA from fresh seedling leaves. We used the detection markers and detection methods provided by the original author (the research team of Huazhong Agricultural University) to test samples of the population. Based on the results, we analyzed and selected several representative samples. The results are shown in the table. Figure 1 .

[0028] 2. The reference RPPK genomes of the original resistant and susceptible materials K22 and DAN340 were queried using the public databases MaizeGDB and NCBI, and the regions enriched in SNP positions were found. The primers were designed as shown in SEQ ID NO.11 and SEQ ID NO.12.

[0029] RPKC1F: 5'GACATCACGTCCTTGACCAT 3' (SEQ ID NO.11) RPKC1R: 5' CGTCCACCACTGCATCACT 3' (SEQ ID NO.12) 3. PCR amplification was performed on 12 representative samples of the 10 samples selected from the population plus K22 and DAN340 using the above primers. The PCR reaction system was: 0.1ul Accurate Taq DNA Polymerase (5U / ul), 1ul 10× Taq PCR Buffer (Mg 2+plus), 0.9ul dNTP Mix (2.5mM each), 10-20ng DNA, 0.25ul 10μMPrimer F, 0.25ul 10μM Primer R, add water to 10ul; PCR program: 95℃ pre-denaturation for 5 minutes, 95℃ denaturation for 30 seconds, 56℃ annealing for 30 seconds, 72℃ extension for 40 seconds, 35 cycles, 72℃ final extension for 7 minutes. Electrophoresis detection conditions: After amplification, electrophoresis was performed on 2% agarose gel at 140v for 40 minutes. The product fragment size was 442bp. The samples were sent to a sequencing company for sequencing to infer the SNP sites that can be typed within the population. The PCR band phenotypes of 10 representative materials and controls in the sequencing primers are as follows: Figure 2 As shown, 10 representative materials and controls were sequenced in the sequencing primers and genotypes were as follows Figure 3 shown.

[0030] 4. KASP primers were designed and synthesized for three of these sites. The SNP at site 1 (SNP1) is located at position 1017456 of Chr10 (position 510 of the nucleotide sequence set forth in SEQ ID NO. 1). Its resistance base is A, and its sensitivity base is T. The primer was named RPPK-1, as shown in Table 1. The SNP at site 2 (SNP2) is located at position 1017437 of Chr10 (position 491 of the nucleotide sequence set forth in SEQ ID NO. 1). Its resistance base is T, and its sensitivity base is C. The primer was named RPPK-2, as shown in Table 2. The SNP at site 3 (SNP3) is located at position 1017476 of Chr10 (position 530 of the nucleotide sequence set forth in SEQ ID NO. 1). Its resistance base is T, and its sensitivity base is C. The primer was named RPPK-3, as shown in Table 3.

[0031] Table 1

[0032] Table 2

[0033] Table 3

[0034] 5. PCR amplification was performed on all population materials using the three sets of KASP primer pairs described above, and typing was verified using the LGC SNP line system. The specific steps were as follows: the extracted DNA was uniformly diluted to 10 ng / ul, 1.5 ul was aliquoted into a 384-well plate, centrifuged, and dried in a 50°C oven for 5 minutes. The PCR reaction system was aliquoted and mixed into a 384-well plate using the LGC Meridian3 high-throughput sample loading platform, sealed with LGC Kube film, and placed in a 384-well thermal cycler for PCR amplification. After amplification, the plate was read and analyzed using the LGC Omega F. The PCR reaction system consisted of 1.5 ul of dried DNA, 1.5 ul of a mixture of KASP Master mix and KASP Primer mix (100 μM KASP Master mix and 2× KASP Primer mix, volume ratio of 35:1, where the concentrations of primers Primer_FAM, Primer_HEX, and Primer_common in the KASP Primer mix were 0.16 μM and 0.16 μM, respectively). μM and 0.41 μM), and add water to 3 ul.

[0035] The PCR reaction program for primer RPPK-1 was as follows: pre-denaturation at 94°C for 15 minutes; the first amplification step consisted of denaturation at 94°C for 20 seconds, annealing and extension at 61°C–55°C for 60 seconds, and 10 touch-down cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; the second amplification step consisted of denaturation at 94°C for 20 seconds, annealing and extension at 55°C for 60 seconds, for 32 cycles. The PCR reaction program for primer RPPK-2 was as follows: pre-denaturation at 94°C for 15 minutes; the first amplification step consisted of denaturation at 94°C for 20 seconds, annealing and extension at 68°C–62°C for 60 seconds, and 10 touch-down cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; the second amplification step consisted of denaturation at 94°C for 20 seconds, annealing and extension at 62°C for 60 seconds, for 34 cycles. The PCR reaction protocol for primer RPPK-3 used two conditions: Condition 1: 94°C denaturation for 15 minutes; the first amplification step consisted of 94°C denaturation for 20 seconds, annealing and extension at 68°C–62°C for 60 seconds, and 10 touch-down cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; the second amplification step consisted of 94°C denaturation for 20 seconds, annealing and extension at 62°C for 60 seconds, and 34 cycles. Condition 2: 94°C denaturation for 15 minutes; the first amplification step consisted of 94°C denaturation for 20 seconds, annealing and extension at 61°C–55°C for 60 seconds, and 10 touch-down cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; the second amplification step consisted of 94°C denaturation for 20 seconds, annealing and extension at 55°C for 60 seconds, and 34 cycles.

[0036] Test results such as Figures 4 to 6 As shown in the figure, compared with the amplification results of 190 materials given by the original author, the accuracy of KASP primer RPPK-1 reached 100%, the accuracy of RPPK-2 reached 100%, while RPPK-3 could not be successfully typed regardless of the amplification conditions used.

[0037] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. Southern rust gene RPPK The related SNP molecular markers are characterized by: The SNP molecular marker is SNP1 or SNP2; the SNP1 molecular marker is located at position 510 of the nucleotide sequence shown in SEQ ID NO.1, and the SNP2 molecular marker is located at position 491 of the nucleotide sequence shown in SEQ ID NO.

1.

2. The SNP molecular marker according to claim 1, characterized in that The base polymorphism of SNP1 is A / T; the base polymorphism of SNP2 is T / C.

3. The SNP molecular marker according to claim 2, characterized in that When the genotype of SNP1 is A / A homozygous or A / T heterozygous, the material is a disease-resistant gene type; when the genotype of SNP1 is T / T homozygous, the material is a sensitive gene type; When the genotype of SNP2 is T / T homozygous or T / C heterozygous, the material is a disease-resistant gene type; when the genotype of SNP2 is C / C homozygous, the material is a sensitive gene type.

4. Primers for amplifying the SNP molecular marker according to claim 1.

5. The primer according to claim 4, characterized in that The forward primer for amplifying SNP1 is shown as SEQ ID NO.2 or SEQ ID NO.3, and the reverse primer for amplifying SNP1 is shown as SEQ ID NO.4; the forward primer for amplifying SNP2 is shown as SEQ ID NO.5 or SEQ ID NO.6, and the reverse primer for amplifying SNP2 is shown as SEQ ID NO.

7.

6. A southern rust gene RPPK The genotyping kit is characterized in that It contains the primer according to claim 4 or 5.

7. The SNP molecular marker according to any one of claims 1 to 3, the primer according to claim 4 or 5, or the kit according to claim 6 in the southern rust gene RPPK Applications in genotyping.

8. A southern rust gene RPPK The genotyping method is characterized in that include: Using the genomic DNA of the material to be tested as a template, a PCR amplification reaction is performed using the primers described in claim 4 or 5, The SNP molecular marker according to claim 1 is used for the southern rust gene RPPK Perform genotyping.

9. The method according to claim 8, characterized in that When the genotype of SNP1 is A / A homozygous or A / T heterozygous, the material is a disease-resistant gene type; when the genotype of SNP1 is T / T homozygous, the material is a sensitive gene type; When the genotype of SNP2 is T / T homozygous or T / C heterozygous, the material is a disease-resistant gene type; when the genotype of SNP2 is C / C homozygous, the material is a sensitive gene type.

10. The method according to claim 8 or 9, characterized in that The reaction conditions for PCR amplification reaction when detecting SNP1 site are as follows: Pre-denaturation at 94°C for 15 minutes; first amplification reaction: denaturation at 94°C for 20 seconds, annealing and extension at 61°C to 55°C for 60 seconds, 10 touch-down cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; second amplification reaction: denaturation at 94°C for 20 seconds, annealing and extension at 55°C for 60 seconds, 32 cycles; The reaction conditions for PCR amplification reaction when detecting SNP2 site are: Pre-denaturation at 94°C for 15 minutes; first amplification reaction: denaturation at 94°C for 20 seconds, annealing and extension at 68°C-62°C for 60 seconds, 10 touch-down cycles, with the annealing and extension temperature decreasing by 0.6°C in each cycle; second amplification reaction: denaturation at 94°C for 20 seconds, annealing and extension at 62°C for 60 seconds, 34 cycles.

Images