SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of sparus latus and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to growth traits of sparus latus, which is positioned at a 19030066-site basic group of a 13 # chromosome of sparus latus, has a mutation type of C / G, and is named as SNP 13: 19030066; wherein the CC genotype is a preferred genotype. The invention also discloses a primer and a kit for detecting the SNP molecular marker. The invention also discloses application of the SNP molecular marker, the primer and the kit in breeding sparus latus with excellent growth traits.

Description

Technical Field

[0001] The invention belongs to the technical field of aquatic animal molecular markers, and particularly relates to a SNP molecular marker associated with growth traits of yellowfin sea bream and an application thereof. Background Art

[0002] Yellowfin snapper ( Acanthopagrus latus ) belongs to the order Perciformes ( Perciformes )、Sparidae( Sparidae ), Rhynchos ( Sparus ), which is deeply loved by consumers because of its delicious meat and rich nutrition. It is a common fish in the southern coastal areas of my country. It is mainly distributed in Zhejiang, Fujian, Guangdong, Guangxi Zhuang Autonomous Region and Taiwan Province. In Guangdong and Fujian, there are relatively mature breeding techniques. Yellowfin sea bream is a shallow warm water omnivorous bottom-dwelling fish. The growth rate is one of the key factors that determine its production cost and economic benefits in the breeding process. Genetic selection of growth traits has become an important means to improve animal growth traits. The growth process is affected by many factors such as its own genetics and external environment.

[0003] At present, the traditional breeding method is still used for the selection of growth traits of yellowfin sea bream. However, it generally takes 2 years for yellowfin sea bream to grow from juveniles to sexual maturity. It takes more than 5 years to achieve significant genetic progress using traditional selective breeding technology, which is time-consuming. In recent years, through the combination of molecular marker-assisted selective breeding, the breeding method that uses the phenotypic characteristics of fish as the breeding target has gradually become the mainstream and has been widely used in the genetic breeding of excellent traits.

[0004] Molecular markers refer to specific DNA fragments that can reflect certain differences in the genome between biological individuals or populations. Single Nucleotide Polymorphisms (SNP) refer to the presence of two different bases at a specific nucleotide position in the genome. SNP molecular marker-assisted breeding is a breeding method that selects the genetic material of individuals with different traits to find heritable markers related to the traits. Compared with the long cycle of traditional breeding, SNP molecular marker-assisted breeding is fast, effective, accurate and reliable, so this method has been widely studied by many scholars. By analyzing the association between SNP sites and important traits, obtaining molecular markers closely related to the traits for breeding is an important means of modern aquatic animal molecular breeding technology and plays an important role in the genetic breeding of aquatic economic animals. Researching and developing molecular markers for yellowfin sea bream and cultivating new varieties with excellent growth traits such as fast growth and high yield are necessary conditions for the growth and healthy development of the yellowfin sea bream breeding industry. Summary of the invention

[0005] The first object of the present invention is to provide a SNP molecular marker related to the growth traits of yellowfin sea bream.

[0006] The present invention also aims to provide a primer or a kit for detecting the above-mentioned SNP molecular marker.

[0007] The last object of the present invention is to provide the use of the above-mentioned SNP molecular marker primers or kit in breeding yellowfin sea bream with excellent growth traits.

[0008] The above-mentioned first purpose of the present invention can be achieved by the following technical scheme: a SNP molecular marker related to the growth traits of yellowfin sea bream is located at the 19030066 base of chromosome 13 of yellowfin sea bream, and its mutation type is C / G, named SNP 13:19030066.

[0009] Furthermore, the growth traits include body weight and body length. Among them, CC genotype is a preferred genotype, and the growth traits of individuals with this genotype are better than those of CG and GG genotypes.

[0010] The above-mentioned second purpose of the present invention can be achieved by the following technical scheme: a primer for detecting SNP molecular markers related to the growth traits of yellowfin sea bream, comprising an upstream primer and a downstream primer, the sequence of the upstream primer is shown in SEQ ID NO:1, and the sequence of the downstream primer is shown in SEQ ID NO:2.

[0011] Specifically, the sequences of the upstream primer and the downstream primer are as follows:

[0012] Upstream primer: 5′ - TCTGAACTAAACACTGATTGCACA - 3′;

[0013] Downstream primer: 5'-CTCTGTGGCCTTAACCCCTG-3'.

[0014] The present invention also provides a kit for detecting SNP molecular markers related to the growth traits of yellowfin sea bream, and the kit comprises the above-mentioned primers.

[0015] The last object of the present invention can be achieved by the following technical solution: application of the above-mentioned SNP molecular marker or the above-mentioned primer or the above-mentioned kit in breeding yellowfin sea bream with excellent growth traits.

[0016] Furthermore, the present invention also provides a method for breeding yellowfin sea bream with excellent growth traits, comprising the following steps:

[0017] (1) Extracting DNA from the fin rays of individual yellowfin sea bream to be tested;

[0018] (2) performing PCR amplification on the extracted DNA using the primers shown in SEQ ID NO:1 and SEQ ID NO:2 to obtain an amplified product;

[0019] (3) The amplified product is sequenced and analyzed to determine the genotype of the above-mentioned SNP molecular marker (SNP 13:19030066 SNP site), and then analyzed to determine whether the individual has the potential for excellent growth traits.

[0020] Optionally, in step (3), it is determined whether the genotype of the SNP molecular marker (SNP 13:19030066 site) is the CC genotype, which has superior individual growth traits than the CG and GG genotypes.

[0021] The present invention has the following advantages:

[0022] (1) The present invention analyzed the growth traits of a mixed family population of yellowfin sea bream through genome-wide association analysis, and screened out a candidate SNP site associated with individual weight, named SNP 13:19030066; and further verified in another yellowfin sea bream population that the SNP site was associated with growth traits;

[0023] (2) The SNP marker of the present invention can be determined by a pair of primers, the operation is simple and convenient, and the results are accurate and reliable;

[0024] (3) The SNP loci, primers and kit provided by the present invention have application prospects in molecular marker-assisted breeding of yellowfin sea bream. The SNP molecular marker is not affected by factors such as individual age and gender, and can be used for early screening of yellowfin sea bream, which can significantly shorten the breeding time. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.

[0026] Figure 1 This is the Manhattan plot of the growth shape of yellowfin sea bream, where A is the Manhattan plot of body weight and B is the Manhattan plot of body length (the red line in the figure represents the genome-wide significance threshold, and the blue line represents the suggestive threshold).

[0027] Figure 2 This is the QQ graph of the whole genome association analysis of the growth shape of yellowfin sea bream, where A is the body weight QQ graph and B is the body length QQ graph.

[0028] Figure 3 The statistical results of body weight traits of different genotypes of SNP site SNP 13:19030066 in Example 2 are shown. DETAILED DESCRIPTION

[0029] The technical scheme of the present invention is described in detail below in conjunction with specific embodiments, so that those skilled in the art can better understand and implement the technical scheme of the present invention. The following examples and accompanying drawings are only used for exemplary description and cannot be construed as limiting the present invention. The reagents or materials used in the embodiments, if not otherwise specified, are all derived from commercial channels. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0030] To illustrate the present invention in more detail, the following examples are provided. It should be emphasized that the following examples are only for explaining the present invention and are not intended to limit the essential scope or content of the present invention.

[0031] Example 1: Screening of SNP molecular markers associated with growth traits of yellowfin sea bream

[0032] The experimental yellowfin sea bream was raised in Guangdong Haiyuan Agriculture Co., Ltd. and was a mixed family of 18 months old.

[0033] 400 experimental fish were randomly selected, and the growth trait indicators of each fish were measured and recorded. At the same time, the tail fin samples of each fish were collected and stored in 95% alcohol at -20°C for DNA extraction and sequencing. The HiPure Tissue DNA Mini Kit (Magen, China) was used to extract the fin DNA. All DNA was detected by 1.5% agarose gel electrophoresis, and the electrophoresis results were judged by a gel imaging system (Bio-Rad, USA) to ensure the integrity of the genome. The concentration of qualified DNA samples was then measured using Qubit 3.0 and uniformly adjusted to 30 ng / μL. The samples were then constructed according to the standard process, and the qualified library was sequenced using the Il1umina platform. After quality control and processing of the raw sequencing data, all sequencing reads were aligned to the reference genome (GenBank: GCA_904848185.1) using Bowtie version 2.0 (Langmead and Salzberg, 2012) software. SNPs were detected and genotyped using the standard process of samtools software, and a total of 15 high-quality SNP sites were obtained ( Figure 1 The general linear model (GLM) of Tassel software was used to conduct genome-wide association studies (GWAS) analysis on the body weight of yellowfin sea bream individuals. Figure 2 Subsequently, based on the Bonferroni correction, the genome-wide significant SNP marker threshold was set to -log10(Pvalue = 0.05 / 49940) = 1.00 × 10e -4 ,See Figure 1 .

[0034] Association analysis revealed one SNP marker that was extremely significantly associated with growth traits, and 14 SNP markers that were significantly associated with growth traits. The specific data are shown in Table 1.

[0035] Table 1 Information on SNP loci significantly associated with growth traits

[0036] Note: Chr: chromosome; F: degree of freedom; PVE%: explained phenotypic variation; SNP ID is displayed as chromosome / position; "*" indicates that the SNP is extremely significant, and the reference genome for phenotypic explanation rate is GenBank: GCA_904848185.1.

[0037] From the results in Table 1, it can be seen that SNP 13:19030066 is related to the weight and body length of yellowfin sea bream. It is located at the 19030066th base of chromosome 13, that is, the 286th base of the nucleotide sequence shown in SEQ ID NO:3. The mutation type is C / G, named SNP 13:19030066, among which the CC genotype is the preferred genotype with better growth performance.

[0038] Example 2: Verification of SNP molecular markers related to growth traits of yellowfin sea bream

[0039] The verification test selected different yellowfin sea bream populations, and randomly selected 100 experimental fish from them, measured and recorded the weight trait indicators of each fish, and simultaneously collected and preserved the tail fin samples of each fish for DNA extraction. The specific process of DNA extraction was the same as that in Example 1.

[0040] Subsequently, PCR amplification was performed using the above-extracted DNA as a template and SEQ ID NO: 1 and SEQ ID NO: 2 as primers to obtain a gene fragment containing SNP 13: 19030066). The total volume of PCR amplification was 20 μL, and the specific reaction system is shown in Table 2.

[0041] Table 2 PCR amplification reaction system

[0042]

[0043] The specific amplification procedure was as follows: pre-denaturation at 95°C for 5 min; 40 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s; and finally extension at 72°C for 5 min. 2 μL of the reaction product was tested by 1% agarose gel electrophoresis, and qualified samples were used for subsequent sequencing to determine the genotype of each individual sample at SNP 13:19030066.

[0044] Figure 3The results of validating SNP site SNP 13:19030066 are shown.

[0045] Figure 3 The results showed that: in yellowfin sea bream, there were significant differences in body weight among individuals with different genotypes of SNP 13:19030066; among them, CC genotype individuals accounted for a larger proportion in the largest population and a smaller proportion in the smallest population, that is, the number of CC genotype individuals in the largest population was much greater than that in the smallest population; while GG genotype individuals accounted for a smaller proportion in the largest population and a larger proportion in the smallest population.

[0046] In summary, SNP 13:19030066 is significantly associated with the growth traits of yellowfin sea bream, and its genotype can be determined by a pair of primers, which is simple and reliable. This SNP site has application prospects in molecular marker-assisted breeding of yellowfin sea bream.

[0047] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. A SNP molecular marker associated with the growth traits of yellowfin sea bream, characterized in that: Located at base 19030066 of chromosome 13 of yellowfin sea bream, the mutation type is C / G.

2. The SNP molecular marker associated with the growth traits of yellowfin sea bream according to claim 1, characterized in that: The growth traits include body weight and body length; among them, the growth traits of CC genotype individuals are better than those of CG and GG genotypes.

3. A primer for detecting SNP molecular markers related to growth traits of yellowfin sea bream, characterized in that: It comprises an upstream primer and a downstream primer, wherein the sequence of the upstream primer is shown as SEQ ID NO:1, and the sequence of the downstream primer is shown as SEQ ID NO:

2.

4. A kit for detecting the SNP molecular markers associated with the growth traits of yellowfin sea bream according to claim 1 or 2, characterized in that: Comprising the primer described in claim 3.

5. Use of the SNP molecular marker according to claim 1 or 2, the primer according to claim 3 or the kit according to claim 4 in breeding yellowfin sea bream with excellent growth traits.

6. The method for breeding yellowfin sea bream with excellent growth traits according to claim 5, characterized in that: The following steps are involved: (1) Extracting DNA from the fin rays of individual yellowfin sea bream to be tested; (2) performing PCR amplification on the extracted DNA using the primers shown in SEQ ID NO:1 and SEQ ID NO:2 to obtain an amplified product; (3) Sequencing and analyzing the amplified product to determine the genotype of the SNP molecular marker, and then analyzing to determine whether the individual has the potential for excellent growth traits.

Images