Circular multimeric tandem RNA sense strand
By designing a circular multifold tandem RNA sense strand, the problems of poor stability and high immunogenicity of linear siRNA in vivo are solved, and more efficient antisense strand binding and therapeutic effects are achieved.
Patent Information
- Application Number
- PCT/CN2024/077414
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-02-18
- Publication Date
- 2025-08-21
AI Technical Summary
Existing linear siRNAs have poor stability in vivo, are easily degraded, and have off-target effects and immunogenicity, which affects their therapeutic effects.
A circular multifold tandem RNA sense strand is designed, formed by molecular cyclization of linear RNA sense strand transcribed in vitro or in vivo, including a first cyclization element, a target sequence and a second cyclization element, and uses covalent bonds to form a continuous circular structure, combining multiple antisense strand RNAs to improve stability and binding ability.
It enhances the expression and functional stability of circular RNA, reduces immunogenicity, and is easy to manufacture on a large scale, improving the binding efficiency and therapeutic effect of antisense strands.
Smart Images

Figure CN2024077414_21082025_PF_FP_ABST
Abstract
Description
A circular multiple tandem RNA sense strand Technical Field
[0001] The present invention relates to the field of molecular biology, and in particular to the design and application of a circular multiple tandem RNA sense chain. Background Art
[0002] Small interfering RNA (siRNA) is a double-stranded RNA composed of a sense strand and an antisense strand of 21-25 bases. It is characterized by at least two free bases at the 3' end of the antisense strand. German scientist Thomas Tuschl discovered that three free bases at the 3' end of the antisense strand may have a stronger silencing effect than two free bases. After siRNA is recognized by the Argonaute-2 (AGO2) protein, the 5' end of the antisense strand binds to the MID subunit of AGO2. Under the action of the AGO2 N subunit, the siRNA unwinds, and the 3' end of the antisense strand binds to the PAZ subunit of AGO2. The sense and antisense strands separate, and the antisense strand and AGO2 protein form an RNA-induced silencing complex (RISC). The antisense strand guides the target messenger RNA (mRNA) to its complementary pair, thereby utilizing the endonuclease activity of the AGO2 protein to mediate the degradation of the target mRNA.
[0003] Linear siRNA double strands have strong complementary binding capacity, making complete unwinding and separation of the sense and antisense strands relatively difficult. Partially unwound siRNAs may bind to non-target mRNAs with similar sequences, mediating nonspecific mRNA degradation, a phenomenon known as off-target effects. Linear RNAs can also be degraded by various RNases through various pathways. For example, RNase A attacks the phosphodiester bonds within RNA from the 3' end, degrading them into single bases, while RNase R can unwind RNA duplexes with higher-order structures, making them more susceptible to degradation. Furthermore, exogenous linear RNAs exhibit significant immunogenicity. Specifically, linear RNAs with 5' triphosphate modifications are readily recognized by RIG-I, activating antiviral responses and clearing exogenous linear RNAs. Furthermore, in vitro synthesized RNAs lack modified nucleotides, increasing their immunogenicity.
[0004] Circular RNA (circRNA) is a covalently closed single-stranded RNA. Its lack of a 5'-terminal triphosphate modification and a 3'-terminal polyadenylated tail prevents innate immune responses and clearance by exogenous nucleic acid sensors such as retinoic acid-induced gene protein I (RIG-I) and MDA5. Consequently, in vitro synthesized circRNAs are believed to have a long half-life in vivo and exert specific functions. Synthetic biology can be used to create novel circRNA molecules that encode target proteins with therapeutic effects. Covalently closed circRNA molecules may also be beneficial for applications such as the production of antisense RNA, aptamers, ribozymes, or siRNAs.
[0005] Summary of the Invention
[0006] In order to solve at least one of the above technical problems, the present invention discloses a circular multiple tandem RNA sense chain molecule, its preparation method and use. The circular RNA sense chain molecule is produced by the cyclization of a linear RNA sense chain molecule transcribed in vitro or in vivo, and the linear RNA sense chain molecule is derived from an engineered parent DNA template containing all necessary sequences. The circular RNA sense chain molecule or circular RNA for short as described in the present invention is a polyribonucleotide with a continuous circular or near-circular structure formed by a covalent bond, which preferably includes 2 to 8 tandemly repeated sense chain RNA sequences, which can bind to and deliver multiple antisense chain RNAs, while increasing the binding of sense and antisense chains while taking advantage of the stability of circular RNA. The circular RNA of the present invention has improved expression, functional stability and immunogenicity, and is easy to manufacture on a large scale.
[0007] Therefore, in a first aspect of the present invention, a nucleic acid construct is provided, which comprises, in the following order, a first circularization element, optionally at least one first restriction enzyme recognition sequence, at least one target sequence, optionally at least one second restriction enzyme recognition sequence and a second circularization element.
[0008] In some embodiments, the nucleic acid construct comprises two or more target sequences linked in series, for example, 2 to 8, for example, 2, 3, 4, 5, 6, 7, or 8 target sequences. In some embodiments, the nucleic acid construct comprises four target sequences linked in series. In other embodiments, the nucleic acid construct may also comprise more target sequences linked in series, for example, 8 to 16, for example, 8, 9, 10, 11, 12, 13, 114, 15, or 16 target sequences. When comprising two or more target sequences, preferably, these target sequences are identical to each other.
[0009] In some embodiments, the target sequence has a length of 18 to 24 nucleotides, such as 18, 19, 20, 21, 22, 23, 24, preferably 21 nucleotides.
[0010] The first and second circularization elements comprise homology region sequences complementary to a nucleic acid and / or protein-based system capable of RNA ligation, the system being selected from RNA ligating DNA enzymes, CRISPR / dCas9-DNA Ligase, and intron-exon mediated ligation.
[0011] The first and second circularization elements are designed to enable the production of circular positive-sense RNA by different methods, including but not limited to DNAse-mediated RNA circularization, CRISPR-dCas9-ligase-mediated RNA circularization, and self-splicing-mediated RNA circularization.
[0012] The most studied circularization strategy currently is self-splicing-mediated RNA circularization, which utilizes the autocatalytic splicing reaction of intronic ribozymes to construct a PIE (permuted intron-exon) system based on different types of introns to achieve RNA circularization. This system excises and replaces the natural introns and exons to form a new intron-exon construct. The target sequence is inserted into this construct, and after transcription, circular RNA is synthesized through in vitro reverse splicing. In this system, the intron fragment is dropped during self-splicing, and the circularization is completed by connecting the two flanking exon fragments.
[0013] Thus, in some embodiments, the first circularization element comprises, in sequence, a 5' intronic element and a 5' exonic element, and the second circularization element comprises, in sequence, a 3' exonic element and a 3' intronic element.
[0014] In some embodiments, the 5' intron element and the 3' intron element are derived from the same self-splicing intron, such as a naturally occurring self-splicing intron. In some embodiments, the 5' intron element is derived from or contains the 5' terminal portion of a self-splicing intron, and the 3' intron element is thus derived from or contains the 3' terminal portion of a self-splicing intron. In some embodiments, the combination of the 5' intron element and the 3' intron element retains the self-splicing activity of the self-splicing intron.
[0015] In some embodiments, the 5' intron element comprises a first portion from an Anabaena group I intron, particularly an enhanced Anabaena group I intron, and the 3' intron element comprises a second portion from an Anabaena group I intron, particularly an enhanced Anabaena group I intron. In still other embodiments, the 5' intron element comprises a first portion from a T4 phage group I intron, particularly an enhanced T4 phage group I intron, and the 3' intron element comprises a second portion from a T4 phage group I intron, particularly an enhanced T4 phage group I intron.
[0016] In some embodiments, the 5' exon region is derived from the 5' native exon of a group I intron of an Anabaena pre-tRNA-Leu gene. The 5' native exon of the group I intron of the Anabaena pre-tRNA-Leu gene comprises the nucleotide sequence of SEQ ID NO. 5. In some embodiments, the 3' exon region is derived from the 3' native exon of a group I intron of an Anabaena pre-tRNA-Leu gene. The 3' native exon of the group I intron of the Anabaena pre-tRNA-Leu gene comprises the nucleotide sequence of SEQ ID NO. 12.
[0017] In some embodiments, the 5' exon region is derived from the 5' native exon of the group I intron of the td gene of T4 phage. The 5' native exon of the td gene of T4 phage comprises the nucleotide sequence of SEQ ID NO. 52. In some embodiments, the 3' exon region is derived from the 3' native exon of the group I intron of the td gene of T4 phage. The 3' native exon of the td gene of T4 phage comprises the nucleotide sequence of SEQ ID NO. 54.
[0018] In some embodiments, the 5' exon region is derived from the 5' native exon of the group I intron of the pre-tRNA-Ile gene of Azotobacter sp. BH72. The 5' native exon of the pre-tRNA-Ile gene of Azotobacter sp. BH72 comprises the nucleotide sequence of SEQ ID NO. 56. In some embodiments, the 3' exon region is derived from the 3' native exon of the group I intron of the pre-tRNA-Ile gene of Azotobacter sp. BH72. The 3' native exon of the pre-tRNA-Ile gene of Azotobacter sp. BH72 comprises the nucleotide sequence of SEQ ID NO. 58.
[0019] In some embodiments, the 5' intronic element comprises the sequence set forth in SEQ ID NO. 4, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 5' exonic element comprises the sequence set forth in SEQ ID NO. 5, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' intronic element comprises the sequence set forth in SEQ ID NO. 13, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' exonic element comprises the sequence set forth in SEQ ID NO. 12, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto.
[0020] In some embodiments, the 5' intronic element comprises the sequence set forth in SEQ ID NO. 51, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 5' exonic element comprises the sequence set forth in SEQ ID NO. 52, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' intronic element comprises the sequence set forth in SEQ ID NO. 53, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' exonic element comprises the sequence set forth in SEQ ID NO. 54, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto.
[0021] In some embodiments, the 5' intronic element comprises the sequence set forth in SEQ ID NO. 55, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 5' exonic element comprises the sequence set forth in SEQ ID NO. 56, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' intronic element comprises the sequence set forth in SEQ ID NO. 57, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto. In some embodiments, the 3' exonic element comprises the sequence set forth in SEQ ID NO. 58, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto.
[0022] The first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence can be the same or different. In some embodiments, the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence are different.
[0023] In some embodiments, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence is selected from the recognition sequences of the following restriction endonucleases: SpeⅠ, AgeⅠ, HindIII, Bgl II, KpnI, XhoI, SacII, NotI, BamHI, and XbaI.
[0024] In some embodiments, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence comprises a sequence selected from the group consisting of: A↓CTAGT (SEQ ID NO.14 (Spe I)), A↓CCGGT (SEQ ID NO.15 (Age I)), A↓AGCTT (SEQ ID NO.39 (Hind III)), A↓GATCT (SEQ ID NO.40 (Bgl II)), GGTAC↓C (SEQ ID NO.41 (Kpn I)), C↓TCGAG (SEQ ID NO.42 (Xho I)), CCGC↓GG (SEQ ID NO.43 (Sac II)), GC↓GGCCGC (SEQ ID NO.44 (Not I)), G↓GATCC (SEQ ID NO.45 (Bam HI)), and T↓CTAGA (SEQ ID NO.46 (Xba I)), wherein ↓ represents an enzyme cleavage site.
[0025] Inserting the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence into the nucleic acid construct allows for easy replacement of the at least one target sequence with any desired target sequence, such as a DNA polynucleotide sequence corresponding to a therapeutic RNA, siRNA or miRNA.
[0026] As used herein, the term "spacer" or "spacer sequence" refers to a non-functional sequence that physically separates two functional sequences from each other. In some embodiments, the nucleic acid construct further comprises at least one spacer sequence. In other embodiments, the nucleic acid construct comprises two or more spacer sequences. In some embodiments, when the nucleic acid construct comprises more than two target sequences, any two adjacent target sequences are separated by at least one spacer sequence.
[0027] In some embodiments, the spacer sequence has a length of 2 to 40 nucleotides, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.
[0028] In some embodiments, the spacer sequence is a polyAC sequence. In one embodiment, the spacer sequence comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% polyAC content. In one embodiment, the spacer sequence comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% polypyrimidine (C / T or C / U) content. As used herein, "polyAC" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing adenine or cytosine.
[0029] In some embodiments, the spacer sequence comprises any one of the following sequences or a combination thereof: a sequence shown in SEQ ID NOs. 7 to 11, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.
[0030] In some embodiments, the target sequence comprises a sequence as shown in SEQ ID NO. 2 or SEQ ID NO. 6, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.
[0031] In a second aspect of the present invention, an expression vector is provided, comprising at least one RNA polymerase promoter and a nucleic acid construct according to the first aspect of the present invention.
[0032] The at least one RNA polymerase promoter is derived from a virus and is selected from the group consisting of a T7 RNA polymerase promoter, an SP6 RNA polymerase promoter, a T3 RNA polymerase promoter, a T6 RNA polymerase promoter, a T4 RNA polymerase promoter, and a K11 RNA polymerase promoter.
[0033] In some embodiments, the expression vector is a plasmid expression vector, preferably an Escherichia coli plasmid expression vector, such as pET-28a, pET-32a, pGEX4T-1, or pUC57 plasmid expression vector.
[0034] In a third aspect of the present invention, a linear RNA polynucleotide is provided, which is transcribed from the nucleic acid construct according to the first aspect of the present invention.
[0035] The linear RNA polynucleotide can be unmodified, partially modified or fully modified. In some embodiments, the linear RNA comprises at least one nucleotide modification. In some embodiments, up to 100% of the nucleotides of the linear RNA are modified. In some embodiments, the at least one nucleotide modification is a cytidine modification, a uridine modification or an adenosine modification. In some embodiments, the at least one nucleotide modification is selected from 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ) and 5-methoxyuridine (5moU). In some embodiments, the circular RNA comprises less than 100%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1% of a specific nucleotide modification. As used herein, the percentage of a specific nucleotide modification refers to the ratio of the nucleotides that have undergone the specific modification to the nucleotides that can undergo the specific modification in the sequence. In some embodiments, the circular RNA is unmodified. In some embodiments, the circular RNA does not comprise nucleotide modifications.
[0036] In some embodiments, the linear RNA polynucleotide undergoes self-splicing mediated by guanosine triphosphate (GTP) to form a circular or substantially circular structure.
[0037] In a fourth aspect of the present invention, a circular RNA is provided, comprising at least one RNA sense strand sequence and at least one spacer sequence.
[0038] In some embodiments, the circular RNA comprises more than two sense strand sequences connected in series, for example, 2 to 8, for example, 2, 3, 4, 5, 6, 7, or 8 sense strand sequences. In some embodiments, the circular RNA comprises four sense strand sequences connected in series. In other embodiments, the circular RNA may also comprise more sense strand sequences connected in series, for example, 8 to 16, for example, 8, 9, 10, 11, 12, 13, 114, 15, or 16 sense strand sequences. In the case of comprising more than two sense strand sequences, preferably, these sense strand sequences are identical to each other, and / or any two adjacent sense strand sequences are separated by at least one spacer sequence.
[0039] In some embodiments, the spacer sequence has a length of 2 to 40 nucleotides, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.
[0040] In some embodiments, the spacer sequence is a polyAC sequence. In one embodiment, the spacer sequence comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% polyAC content. In one embodiment, the spacer sequence comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% polypyrimidine (C / T or C / U) content. As used herein, "polyAC" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing adenine or cytosine.
[0041] In some embodiments, the spacer sequence comprises any one of the following sequences or a combination thereof: a sequence shown in SEQ ID NOs. 7 to 11, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.
[0042] In some embodiments, the circular RNA further comprises a 5' exonic element and a 3' exonic element, wherein the 5' exonic element and the 3' exonic element are derived from natural exons of the same self-splicing intron, preferably, the self-splicing intron is selected from Anabaena group I introns, T4 phage group I introns or Azotobacter sp. BH72 group I introns.
[0043] In some embodiments, the 5' exon element and the 3' exon element are covalently linked. In some embodiments, the 5' end of the 5' exon element is covalently linked to the 3' end of the 3' exon element. In some embodiments, the sense strand sequence has a length of 18 to 24 nucleotides, such as 18, 19, 20, 21, 22, 23, 24, and preferably 21 nucleotides.
[0044] In some embodiments, the positive strand sequence comprises an RNA sequence identical to the sequence shown in SEQ ID NO. 2 or SEQ ID NO. 6, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.
[0045] In some embodiments, the circular RNA anneals to at least one linear antisense strand to form a circular siRNA. In some embodiments, the linear antisense strand has a length of 21 to 27 nucleotides, such as 21, 22, 23, 24, 25, 26, 27, preferably 24 nucleotides.
[0046] In some embodiments, the number of antisense strand sequences in the circular siRNA is the same as the number of sense strand sequences. In other embodiments, the number of antisense strand sequences in the circular siRNA is different from the number of sense strand sequences, for example, less than the number of sense strand sequences.
[0047] In some embodiments, the antisense strand sequence comprises an RNA sequence identical to the sequence shown in SEQ ID NO.1 or SEQ ID NO.36, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.
[0048] In some embodiments, the circular RNA and / or the at least one linear antisense strand is unmodified, partially modified, or fully modified.
[0049] In some embodiments, the circular RNA and / or the at least one linear antisense strand comprises at least one nucleotide modification. In some embodiments, the at least one nucleotide modification is a cytidine modification, a uridine modification, or an adenosine modification. In some embodiments, the at least one nucleotide modification is selected from 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5-methoxyuridine (5moU).
[0050] In some embodiments, the circular RNA and / or the at least one linear antisense strand further comprises at least one chemical modification. The chemical modification may comprise an internucleoside linkage modification, a nucleobase modification, a sugar modification, or a combination thereof.
[0051] In some embodiments, the chemical modification is selected from LNA, ENA, HNA, CeNA, 2'-O-methoxyalkyl (e.g., 2'-O-methoxymethyl, 2'-O-methoxyethyl, or 2'-O-2-methoxypropyl), 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-ON-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP), 2'-ara-F, L-nucleoside modifications (e.g., 2'-modified L-nucleosides, such as 2'-deoxy-L-nucleosides), BNA racemose, racemic cyclic alkyl, and open chain alkyl, and combinations thereof.
[0052] In some embodiments, the chemical modification is a 2'-modification selected from 2'-O-methyl, 2'-deoxy, 2'-fluoro, and combinations thereof.
[0053] In some embodiments, about 100%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35% or 30% of all nucleotides are modified, i.e., the above proportions of all nucleotides present in the circular siRNA contain modifications as described herein.
[0054] In some embodiments, all nucleotides in the sense strand are modified. In some embodiments, each nucleotide in the sense strand is independently modified with a 2'-modification selected from 2'-O-methyl, 2'-deoxy, 2'-fluoro, and combinations thereof. In some embodiments, all nucleotides in the antisense strand are modified. In some embodiments, each nucleotide in the antisense strand is independently modified with a 2'-modification selected from 2'-O-methyl, 2'-deoxy, 2'-fluoro, and combinations thereof.
[0055] In some embodiments, at least 50% of the nucleotides in the circular siRNA are independently modified with 2'-O-methyl, 2'-O-allyl, 2'-deoxy, or 2'-fluoro.
[0056] In some embodiments, the circular RNA includes, in sequence, a 5' exonic element, optionally a first spacer sequence, optionally a first restriction enzyme recognition sequence, at least one RNA sense strand sequence, optionally a second restriction enzyme recognition sequence, optionally a second spacer sequence, and a 3' exonic element.
[0057] In a fifth aspect of the present invention, a pharmaceutical composition is provided, comprising the circular RNA according to the fourth aspect of the present invention, a nanoparticle and, optionally, a targeting moiety operably linked to the nanoparticle.
[0058] In some embodiments, the nanoparticle is a lipid nanoparticle (LNP), a core-shell nanoparticle, a biodegradable nanoparticle, a biodegradable lipid nanoparticle, a polymer nanoparticle, a polyplex, or a biodegradable polymer nanoparticle. In some embodiments, the nanoparticle comprises one or more cationic lipids, ionizable lipids, or poly-β-amino esters. In some embodiments, the nanoparticle comprises one or more neutral lipids. In some embodiments, the nanoparticle comprises one or more PEG-modified lipids, polyglutamic acid lipids, or hyaluronic acid lipids. In some embodiments, the nanoparticle comprises cholesterol. In some embodiments, the nanoparticle comprises arachidonic acid, leukotrienes, or oleic acid. In some embodiments, the LNP, in addition to the circular RNA of the present invention, further comprises (i) at least one ionizable lipid; (ii) a neutral lipid; (iii) cholesterol; and (iv) a PEG-lipid in a molar ratio of approximately 20-60% ionizable lipid: 5-25% neutral lipid; 25-55% sterol; and 0.5-15% PEG-lipid. In some embodiments, the ionizable lipid is selected from ALC-0315, N,N-dioleoyl-N,N-dimethylammonium chloride (DODAC), N,N-distearoyl-N,N-dimethylammonium bromide (DDAB), or 1,2-dioleoyltrimethylammonium chloride propane (DOTAP). In some embodiments, the ionizable lipid is ALC-0315. In some embodiments, the neutral lipid is selected from distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), or dimyristoylphosphatidylethanolamine (DMPE). In some embodiments, the PEG-modified lipid is DSPE-PEG, DMG-PEG or PEG-1. In some embodiments, the PEG-modified lipid is DSPE-PEG (2Q00). In some embodiments, the nanoparticles comprise about 0.5% to about 4% PEG-lipid by molar ratio. In some embodiments, the molar ratio of ionizable lipid:cholesterol:DSPC:DMG-PEG is 50:38:10:1.5.
[0059] In some embodiments, the circular RNA anneals to at least one linear antisense strand. In some embodiments, the molar ratio of the linear antisense strand to the circular RNA in the composition is selected from 1 to 8, such as 1, 2, 3, 4, 5, 6, 7 or 8, preferably 4.
[0060] In a sixth aspect of the present invention, a disease treatment method is provided, comprising administering a therapeutically effective amount of the circular RNA according to the fourth aspect of the present invention, or the pharmaceutical composition according to the fifth aspect of the present invention to a subject in need thereof.
[0061] The disease is associated with the target sequence. In some embodiments, the drug mediates the degradation of mRNA of a disease-related protein, and preferably, the disease-related protein is selected from PCSK9, ATN1 protein, ataxia protein, huntingtin protein, and BACE1.
[0062] In one embodiment, the subject can obtain health benefits from the downward regulation of PCSK9 expression.The subject for example suffers from metabolic disease.The metabolic disease is selected from hypertriglyceridemia, severe hypertriglyceridemia, hypercholesterolemia, familial hypercholesterolemia, the cholesterol elevation caused by genetic condition, fatty liver disease, non-alcoholic fatty liver disease (NFLD), non-alcoholic steatohepatitis (NASH), dyslipidemia, mixed dyslipidemia, type I hyperlipoproteinemia (it can include 3 kinds of hypotypes: type Ia, also known as Berg-Grutz syndrome or familial hyperchylomicronemia; type Ib, also known as familial apolipoprotein CII deficiency, and type Ic), type V hyperlipoproteinemia, atherosclerosis, coronary heart disease, type II diabetes, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, metabolic syndrome or cardiovascular disease.
[0063] In one embodiment, the disease is selected from a neurodegenerative disease.
[0064] In a seventh aspect of the present invention, a cell comprising the expression vector according to the second aspect of the present invention or the circular RNA according to the fourth aspect of the present invention is provided.
[0065] In some embodiments, the cells are selected from Escherichia coli (E. Coli) cells, particularly BL21 (DE3) competent cells.
[0066] In an eighth aspect of the present invention, a method for producing circular RNA is provided, comprising at least the following steps:
[0067] a. transforming a host cell using the expression vector according to the second aspect of the present invention; b. subjecting the obtained recombinant host cell to incubation under growth conditions to allow replication of the expression vector; c. adding an inducer to induce expression of the circular RNA; and optionally, d. purifying the obtained circular RNA.
[0068] In some embodiments, the host cell is selected from Escherichia coli cells, particularly BL21 (DE3) competent cells.
[0069] In some embodiments, the method further comprises a step of amplifying the recombinant host cell. In some embodiments, the amplification comprises a step of amplifying the recombinant host cell from 50 ml of bacterial solution to 1 L of bacterial solution, theoretically amplifying the circRNA by 20 times.
[0070] In some embodiments, the inducing agent is selected from isopropylthiogalactoside (IPTG).
[0071] In some embodiments, the step of adding an inducing agent for induction is carried out at 18°C for about 12 to 24 hours, for example, about 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours or any value therebetween, preferably about 18 hours. The inventors have found that long-term induction at 18°C, such as overnight induction, can produce more circular RNA than induction at a higher temperature (such as 37°C) for a short time (such as 3 hours). In some embodiments, induction at 18°C for 18 hours produces at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times or more circular RNA than induction at 37°C for 3 hours. Beneficial effects
[0072] High in vitro cyclization efficiency: By designing rearranged (PIE) class I intron and its exon sequences at both ends of the linear RNA, the intron can be cleaved and cyclized under the mediation of GTP. This process does not require the consumption of T4 RNA ligase and is short in time (only 15 minutes), making it more economical, rapid, and more conducive to the expansion of the in vitro transcription system.
[0073] High yield: The present invention transforms the plasmid expressing circRNA into Escherichia coli and increases the copy number and expression scale of the circRNA template by adding the amplification system of Escherichia coli, thereby greatly improving the yield of circRNA.
[0074] High antisense strand loading rate: The present invention prepares a circRNA sponge with four repeated sense strand sequences in series, so that it can bind more antisense strands while maintaining the stability of circRNA and exert a better RNA silencing function in vivo.
[0075] Low immunogenicity: The circular siRNA prepared by the present invention has low immunogenicity. BRIEF DESCRIPTION OF THE DRAWINGS
[0076] FIG1 exemplarily illustrates the design principle of the positive-strand RNA of circular 4×siRNA.
[0077] Figure 2 shows that after adding IPTG to 50 ml of bacterial solution, the circular RNA expression level was higher when induced at 18°C for 18 hours than when induced at 18°C for 3 hours, 37°C for 3 hours, and 37°C for 18 hours, suggesting that induced at 18°C for 18 hours is most effective in increasing circular RNA production.
[0078] FIG3 shows that after the circular 4× siRNA was treated with DNase I, RNase R and gel extraction, a significant band was enriched at the 200 nt position.
[0079] FIG4 shows that the 5' exon and the 3' exon were successfully linked.
[0080] FIG5 shows the bands of the circular 4× sense strand RNA combined with the linear antisense strand. As the circular sense strand increases, the charge carried by the double-stranded siRNA increases, and the migration distance of the band gradually increases.
[0081] FIG6 shows the qRT-PCR results, which show that circular 4×siCopGFP reduced the expression level of CopGFP mRNA compared with linear siCopGFP, circular and linear negative control siRNAs, and the control group.
[0082] FIG7 shows that under a fluorescence microscope, circular 4×siCopGFP reduced the green fluorescence density of CopGFP compared with linear siCopGFP, circular and linear negative control siRNA, and the control group.
[0083] FIG8 shows the results of qRT-PCR, which shows the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on IL-6, TNF, IFNB1, and RIG-I mRNA.
[0084] Figure 9 shows qRT-PCR results showing the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on PCSK9 mRNA on days 3 (A) and 7 (B) of transfection, as well as in the absence and combination with high-strength atorvastatin (C).
[0085] Figure 10 shows Western blot results, showing the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on LDLR, PCSK9, and GAPDH on day 3 (A) and day 7 (B) of transfection, as well as the effects on LDLR, PCSK9, and GAPDH in the absence of atorvastatin and in combination with high-intensity atorvastatin (C).
[0086] Figure 11 shows the qRT-PCR results, showing the effects of control, AS-siPCSK9, L-1×-siCopGFP, L-1×-siPCSK9, C-4×-siCopGFP, and C-4×-siPCSK9 on IL-6, TNF, IFNB1, and RGIG-I mRNA on days 3 and 7 of transfection.
[0087] FIG12 shows the qRT-PCR results, which show the effects of no atorvastatin and high-strength atorvastatin combined with control, AS-siPCSK9, L-1×-siPCSK9, and C-4×-siPCSK9 on IL-6, TNF, IFNB1, and RGIG-I mRNA.
[0088] FIG13 shows the inhibitory effect of circular siPCSK9 with different numbers of sense chains in series on PCSK9 mRNA.
[0089] FIG14 shows the changes in PCSK9 and LDL-C over time after injection of PBS, cyclic C-4×-siPCSK9, and LNP-encapsulated cyclic C-4×-siPCSK9 into C57BL6 mice.
[0090] FIG15 shows the serum ALT and creatinine levels of C57BL6 mice 12 weeks after injection of PBS, cyclic C-4×-siPCSK9, and LNP-encapsulated cyclic C-4×-siPCSK9. DETAILED DESCRIPTION
[0091] To make the objectives, technical solutions, and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the following examples. The specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention in any way. In addition, in the following description, descriptions of known structures and technologies are omitted to avoid unnecessary confusion about the concepts of the present disclosure. Such structures and technologies are also described in many publications.
[0092] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.
[0093] As used herein, the articles "a," "an," and "an" include plural referents unless the context clearly dictates otherwise.
[0094] As used herein, the terms "include," "comprising," "having," "may," "containing," and variations thereof are generally intended to be open transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The term "consisting of" generally indicates that no other components (or, similarly, features, integers, steps, etc.) can be present.
[0095] As used herein, the term "about" can be used to encompass variations of ±10% or less, ±5% or less, ±1% or less, ±0.5% or less, or ±0.1% or less from a particular value.
[0096] The term "nucleic acid" refers to any DNA or RNA molecule.
[0097] As used herein, the terms "ribonucleic acid," "RNA," and "polyribonucleotide" mean a polymer composed of ribonucleotides.
[0098] The terms "cyclic polyribonucleotide," "circRNA," and "circular RNA" are used interchangeably throughout this patent.
[0099] The terms "deoxyribonucleic acid," "DNA," and "polydeoxyribonucleotide" refer to polymers composed of deoxyribonucleotides.
[0100] The term "oligonucleotide" refers to a single-stranded or double-stranded nucleotide polymer ranging in length from about 2 to up to about 200 nucleotides. Suitable oligonucleotides can be prepared by chemical methods, such as the phosphoramidite method, or enzymatic methods.
[0101] The term "polynucleotide" refers to a single- or double-stranded polymer composed of nucleotide monomers.
[0102] The term "transcription unit" is used interchangeably with "nucleic acid construct" which, when introduced into a cell, results in the transcription and / or translation of an RNA or polypeptide.
[0103] In some embodiments, the transcription unit comprises a terminator or termination sequence operably linked to the open reading frame.
[0104] In some embodiments, the transcription unit comprises at least one synthetic or non-natural promoter, at least one synthetic or non-natural coding sequence, and at least one synthetic or non-natural terminator.
[0105] The term "codon optimized" refers to changing the codons in the open reading frame of a nucleic acid sequence to reflect the typical codon usage of a selected organism without changing the polypeptide encoded by the sequence. The optimization includes replacing at least one, or more than one, or a significant number of codons with one or more codons that are more frequently used in the genes of the selected organism.
[0106] A nucleic acid sequence is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
[0107] As used herein, the term "antisense strand" refers to an oligomeric compound that is substantially or 100% complementary to a target nucleic acid or target sequence. In some embodiments, the antisense strand comprises a length of at least two nucleotides. In some embodiments, the antisense strand comprises a length of at least 40 nucleotides. In some embodiments, each of the antisense strands has a length of about 18 to about 28 nucleotides. The antisense strand sequence can be predicted by consulting previous literature or importing the mRNA sequence of the target protein into the RNAi Designer website (http: / / rnaidesigner.thermofisher.com / rnaiexpress / ). The target protein can be a protein associated with a specific disease.
[0108] The linear RNA polynucleotides provided herein are capable of self-splicing to form covalently linked closed circular RNA molecules under the action of a cyclization element. The cyclization element comprises a self-splicing intron. The term "self-splicing intron" refers to an intron that has self-splicing ribozyme activity and is capable of self-excision and ligation of two flanking exons. In some embodiments, the splicing is autocatalytic splicing.
[0109] As used herein, "self-splicing introns" include, but are not limited to, class I introns and class II introns. Class I introns include 14 subgroups, and most class I introns belong to the IC3 subgroup. For example, class I introns may be class I introns from Anabaena belonging to the IC3 subgroup, or class I introns from T4 phage belonging to the IA2 subgroup, or class I introns from Azotobacter BH72 belonging to the IC3 subgroup. Other examples of self-splicing introns that can be used in the present invention include, but are not limited to, self-splicing introns derived from the following organisms: Anabaena PCC7120, bacteriophage Twort, bacteriophage SPO1, bacteriophage S3b, Synechococcus elongatus PCC 6301, Enterobacteriophage T4, Bacillus anthracis, Clostridium botulinum, Tetrahymena thermophila, Dunaliella parva, Pneumocystis carinii, Physarum polycephalum, Scytonema hofmanni, Agrobacterium tumefaciens, Synechocystis PCC 6803, and the like.
[0110] As used herein, an "exonic element" is a sequence that is derived from a native exon (ie, an exon flanking a self-splicing intron) and that is capable of being recognized and / or spliced by the self-splicing intron and is therefore required for circularization.
[0111] In some embodiments, the 5' exonic element is derived from the native 5' exon of the self-splicing intron (the exon flanking (or downstream) the 5' end of the self-splicing intron) or a contiguous segment thereof starting from the 3' terminal nucleotide.
[0112] In some embodiments, the 5' exonic element is the entire native 5' exon of the self-splicing intron, or has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity thereto, or has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the entire native 5' exon of the self-splicing intron.
[0113] In some embodiments, the 5' exon element is a continuous segment starting from the 3' terminal nucleotide of the native 5' exon. In some embodiments, the 5' exon element has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99% or at least 99% sequence identity with the continuous segment starting from the 3' terminal nucleotide of the native 5' exon. In some embodiments, the 5' exon element has 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleotide substitutions, deletions or additions compared to the continuous segment starting from the 3' terminal nucleotide of the native 5' exon.
[0114] In some embodiments, the continuous segment starting from the 3' terminal nucleotide of the native 5' exon comprises or consists of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of the nucleotides of the native 5' exon. In some embodiments, the continuous segment starting from the 3' terminal nucleotide of the native 5' exon is at least 1 nucleotide in length, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15 nucleotides, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50 or more nucleotides. In some embodiments, the length of the contiguous segment starting from the 3'-terminal nucleotide of the native 5' exon is 1 nucleotide or up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50 nucleotides, or the total length of the native 5' exon.
[0115] In some embodiments, the 3' exonic element is derived from the native 3' exon of the self-splicing intron (the exon flanking (or downstream) the 3' end of the self-splicing intron) or a contiguous segment thereof starting from the 5' terminal nucleotide.
[0116] In some embodiments, the 3' exonic element is the entire native 3' exon of the self-splicing intron, or has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity thereto, or has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the entire native 3' exon of the self-splicing intron.
[0117] In some embodiments, the 3' exon element is a continuous segment starting from the 5' terminal nucleotide of the native 3' exon. In some embodiments, the 3' exon element has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity with the continuous segment starting from the 5' terminal nucleotide of the native 3' exon. In some embodiments, the 3' exon element has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotide substitutions, deletions, or additions compared to the continuous segment starting from the 5' terminal nucleotide of the native 3' exon.
[0118] In some embodiments, the continuous segment starting from the 5' terminal nucleotide of the native 3' exon comprises or consists of at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of the nucleotides of the native 3' exon. In some embodiments, the continuous segment starting from the 5' terminal nucleotide of the native 3' exon is at least 1 nucleotide in length, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15 nucleotides, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50 or more nucleotides. In some embodiments, the length of the contiguous segment starting from the 5'-terminal nucleotide of the native 3' exon is 1 nucleotide or up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50 nucleotides, or the total length of the native 3' exon.
[0119] As used herein, "host" means an individual and may include domestic animals such as cats and dogs; livestock such as cows, horses, pigs, sheep and goats; laboratory animals such as mice, rabbits, rats and guinea pigs; mammals such as humans, non-human primates and primates; and other animals such as rodents, birds, reptiles, amphibians and fish.
[0120] As used herein, "gene silencing" of a small interfering RNA molecule refers to a reduction in the mRNA level of a target gene in a cell by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, up to and including 100%. In a preferred embodiment, the mRNA level is reduced by at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, up to and including 100%.
[0121] The term "lipid nanoparticle" is not limited to any particular morphology and includes any morphology produced when a cationic lipid and, optionally, one or more other lipids are combined, for example, in an aqueous environment and / or in the presence of RNA. For example, liposomes, lipid complexes, emulsions, micelles, lipid nanocapsules, nanosuspensions, and the like are all within the scope of lipid nanoparticles. In some embodiments, the LNP comprises (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, such as cholesterol; and (iv) a PEG-lipid in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid; 25-55% sterol; and 0.5-15% PEG-lipid.
[0122] The following examples and accompanying drawings are provided to facilitate understanding of the present invention. However, it should be understood that these examples and accompanying drawings are intended to illustrate the present invention only and are not intended to limit the present invention in any way. The actual scope of protection of the present invention is set forth in the claims. It should be understood that any modifications and variations may be made without departing from the spirit of the present invention.
[0123] Example
[0124] The names and sources of the experimental reagents used in the examples of this disclosure are shown in Table 1:
[0125] Table 1: Reagents used in the experiment
[0126] Example 1 Construction of circular 4×siRNA vector
[0127] 1.1. Sequence design of circular 4× siRNA
[0128] Circular 4× siRNA consists of a circular 4× sense RNA and a linear 1× antisense RNA. The antisense sequence was predicted by consulting previous literature or importing the target protein mRNA sequence into the RNAi Designer website (http: / / rnaidesigner.thermofisher.com / rnaiexpress / ).
[0129] The antisense and sense strands in circular siRNA are 24 and 21 bases long, respectively, and are monophosphate-modified at the 5' end. Taking CopGFP as an example, the antisense strand sequence is 5'GCTCTTCATCTTGTTGGTCATGCG 3' (SEQ ID NO. 1), and the sense strand sequence is 5'ATGACCAACAAGATGAAGAGC 3' (SEQ ID NO. 2). Circular 4x sense strand RNA is composed of four RNA elements: a T7 promoter, an Anabaena class I intron and exon, and a 4x sense strand tandem sequence, with spacer sequences of a certain length between the elements (Figure 1). For example, the template DNA sequence corresponding to the sense strand of circular 4x siCopGFP is composed of the sequences shown in Table 2 linked in sequence. Those skilled in the art will appreciate that the sense strand sequence of CopGFP can be replaced by any desired target sequence.
[0130] Table 2: Exemplary DNA template sequences
[0131] The T7 promoter, recognized by T7 RNA polymerase, initiates in vitro transcription of circular 4×siCopGFP sense-strand RNA. The group I introns and exons at either end of the RNA are cleaved by a ribozyme derived from Anabaena, which undergoes GTP-mediated self-splicing, excising the introns and simultaneously ligating the exons. The 4× sense-strand RNA pairs complementary with the antisense strand, binding the antisense strand to the circular RNA. SpeⅠ (5'A↓CTAGT 3' (SEQ ID NO. 14)) and AgeⅠ (5'A↓CCGGT 3' (SEQ ID NO. 15)) are added to the ends and center of the 4× sense strand, respectively, to facilitate the replacement of sense-strand repeats of varying lengths. The sense-strand repeats can be increased to four or more, depending on the desired number of antisense strands.
[0132] 1.2 Similarly, design a non-functional negative control siRNA
[0133] The 21 nt sense strand sequence of the control siRNA is: 5'-GCAACGATCATGGTTGCACAA-3' (SEQ ID NO. 16), and the 24 nt antisense strand sequence is: 5'-GTGCAACCATGATCGTTGCGGCAG-3' (SEQ ID NO. 17).
[0134] 1.3 Add EcoRI and BamHI sequences to both ends of the circular 4× positive-strand RNA template DNA sequence, and clone it into the corresponding restriction endonuclease sites of the pUC57 vector through EcoRI and BamHI restriction endonuclease digestion and homologous recombination.
[0135] 1.4 Transform the recombinant product into 100 μl of DH5α competent cells and place on ice for 30 minutes. Heat shock the cells in a 45°C water bath for 45 seconds, then add 1 ml of LB medium and incubate at 37°C, 200 rpm, for 1 hour. Centrifuge the cells at 6000 rpm for 3 minutes, resuspend the cells in 50 μl of LB medium, and spread the suspension onto ampicillin-resistant LB agar plates. After incubating the cells overnight at 37°C, use an inoculating loop to pick a single colony and dissolve it in 1.5 ml of ampicillin-resistant LB liquid medium. Incubate the cells at 37°C, 200 rpm, until the suspension becomes turbid. Retain 20 μl of the suspension and perform a small amount of plasmid extraction from the remaining suspension. Perform colony PCR on a 1% agarose gel in 1× TAE buffer at 110 V for 30 minutes to determine the consistency of band size. The bacterial solution transformed with the circular 4× positive chain RNA template vector that has successfully undergone homologous recombination was inoculated into 250 ml of LB liquid medium and incubated at 37°C and 200 rpm until the bacterial solution became turbid. A large amount of plasmid was extracted using a plasmid extraction kit.
[0136] Example 2 In vitro transcription of circular 4× positive strand RNA
[0137] 2.1. Linearization of template DNA
[0138] Prepare 250 μl of the digestion system by adding 25 μl of 10× digestion buffer and 10 μl of Sma I restriction endonuclease to 65 μg of pUC57 plasmid containing circular 4× positive-strand RNA. Incubate overnight at 37°C, 1000 rpm. Precipitate the DNA with 1.25 ml of isopropanol and recover 200 μl of plasmid DNA via column purification.
[0139] 2.2. PCR amplification of template DNA
[0140] A 3.2 ml PCR system [3 μg / ml plasmid DNA, 5× reaction buffer, 200 μM dNTPs, 0.5 μM universal forward primer (5'AAACGACGGCCAGTGAATTCTAATACGAC 3' (SEQ ID NO. 18)) and back primer (5'ACGGGCCCGGGATCC 3' (SEQ ID NO. 19))] was prepared and subjected to 35 cycles of unwinding at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 3 minutes. The mixture was then cooled from 72°C to 4°C for 5 minutes and stored at 4°C.
[0141] In vitro transcription
[0142] Transcribe 200 μl of linearized plasmid (or 3.2 ml of PCR product) with 10 μl of T7 RNA polymerase in a 5 mM ATP, CTP, GTP, and UTP system at 37°C and 1000 rpm for 2 hours. Add 5 μl of DNase I and incubate for 30 minutes. Inactivate the DNase at 65°C for 3 minutes, then immediately place on ice for 5 minutes. Circulation is then performed at 55°C for 15 minutes using 10x cyclization buffer and 2 mM GTP. Add 2 μl of RNase R to digest the linear RNA precursor. Add 100 μl of a phenol:RNA-assisted extraction reagent:isoamyl alcohol (25:24:1) solution and mix thoroughly. Centrifuge at 20,000 rpm for 5 minutes, and carefully extract the supernatant. Precipitate with 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol. Add the supernatant to a 2 ml 8-layer nucleic acid purification column and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat the centrifugation until all the solution has passed through the column. Add 600 μl of 80% ethanol and centrifuge at 12,000 rpm for 1 minute to wash the precipitate from the purification column. Repeat twice. Centrifuge at 12,000 rpm for 3 minutes to thoroughly remove the ethanol. Add 120 μl of 1× TE buffer to thoroughly wet the purification column and let it stand for 5 minutes. Centrifuge at 12,000 rpm for 1 minute to recover the filtrate and store at -80°C.
[0143] After digestion of the template DNA with DNase I, digestion of the linear precursor RNA with RNase R, and gel excision and recovery, a prominent band of circular 4× positive-sense RNA was enriched at the 200 nt position (Figure 3).
[0144] Example 3 Amplification and Extraction of Circular 4× Sense Strand RNA from Escherichia coli
[0145] 3.1 Chemical transformation in E. coli
[0146] Transform 100 μl of BL21(DE3) competent cells with the pUC57 vector containing the T7 promoter and a circular 4x positive-strand RNA template sequence. Place on ice for 30 minutes. Heat shock in a 42°C water bath for 45 seconds, then add 1 ml of LB broth and amplify at 37°C, 200 rpm, for 1 hour. Centrifuge at 6000 rpm for 3 minutes, discard the majority of the supernatant, resuspend the bacterial pellet in approximately 50 μl of culture medium, spread the bacterial suspension on ampicillin-resistant LB agar plates, and incubate overnight at 37°C, 5% CO2 in a humidified incubator.
[0147] 3.2 E. coli amplification and induction
[0148] The next day, use a sterile inoculating loop to pick a single colony from the plate and resuspend it in 50 ml of LB liquid medium containing 0.1% ampicillin. Incubate at 37°C and 200 rpm for 3 hours until the culture becomes turbid. Then transfer the culture to 250 ml to 1000 ml of LB liquid medium and incubate at 37°C and 200 rpm for 3 hours until the culture becomes turbid. Take 800 μl of the culture and add 200 μl of glycerol, then store at -30°C. Add 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and induce the culture at 18°C and 200 rpm for 18 hours.
[0149] 3.3 RNA extraction and recovery
[0150] The next day, collect the bacterial pellet (usually approximately 5 ml) by centrifugation at 4000 rpm for 20 minutes. Resuspend the bacteria in 5 ml of bacterial lysis buffer (50 mM NaCl, 250 mM Tris-HCl, pH 8.0). Add 2 ml of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly to lyse the cells. Centrifuge at 12000 rpm for 10 minutes. Collect the supernatant (usually approximately 7.5 ml). Add 300 μl of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12000 rpm for 10 minutes to precipitate the protein. Collect the supernatant and add 0.1 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol to precipitate the supernatant. Transfer 800 μl of the suspension to a 2 ml nucleic acid purification column. Centrifuge at 12000 rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μl of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 200 μl of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and collect the filtrate.
[0151] To 200 μl of the filtrate, add 50 μl of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12,000 rpm for 10 minutes. Collect the supernatant and add 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol to the supernatant for precipitation. Transfer the supernatant to a 2 ml nucleic acid purification column. Centrifuge at 12,000 rpm for 1 minute and discard the filtrate. Rinse the column by adding 500 μl of 80% ethanol and centrifuging at 12,000 rpm for 1 minute. Discard the filtrate and repeat this twice. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 120 μl of 1× TE buffer to the column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate.
[0152] In a 50 ml bacterial solution, a comparison was made between induction at 18°C for 3 hours, induction at 18°C for 18 hours, induction at 37°C for 3 hours, and induction at 37°C for 18 hours after the addition of IPTG. It was found that the expression level of circular RNA was highest at induction at 18°C for 18 hours ( Figure 2 ).
[0153] Example 4 In vitro transcription of linear siRNA antisense and sense strands
[0154] A T7 promoter sequence (SEQ ID NO. 3) was added to the 5' end of both the sense and antisense strands, and two short, reverse-complementary single-stranded DNAs were synthesized. After unwinding at 95°C for 5 minutes, the mixture was gradually cooled and annealed to room temperature to form a double-stranded template DNA. To 400 μl of 500 ng / μl double-stranded template DNA, 25 μl of a transcription reagent (0.5 M HEPES-K pH 7.9, 60 mM MgCl2, 150 mM DTT, and 10 mM spermidine) and 100 μg of T7 RNA polymerase were added. Transcription was performed overnight at 37°C and 1000 rpm. The DNA template was then removed by adding 10 U of DNase I and incubating at 37°C and 1000 rpm for 30 minutes. Add 50 μl of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 20,000 rpm for 5 minutes and carefully extract the supernatant. Add 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol to precipitate the sample. Then, apply the sample to a 2 ml 8-layer nucleic acid purification column and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat the centrifugation until all the solution has passed through the column. Add 600 μl of 80% ethanol and centrifuge at 12,000 rpm for 1 minute to wash the column precipitate. Repeat this process twice. Centrifuge at 12,000 rpm for 3 minutes to thoroughly remove the ethanol. Add 120 μl of 1× TE buffer to thoroughly wet the column and let it stand for 5 minutes. Centrifuge at 12,000 rpm for 1 minute to recover the filtrate and store at -80°C.
[0155] Example 5 Formation of circular siRNA and linear siRNA
[0156] 5.1 Purification of circular 4× positive-sense RNA and linear positive- and antisense-strand RNA
[0157] To purify circular 4× sense RNA, prepare a 1.5 mm thick 5% urea polyacrylamide gel (13 ml / gel): 8.3 M urea, 0.5× TBE buffer, 5% acrylamide / methylene 19:1, and insert a 10-well sample comb. After freezing at room temperature for 30 minutes, perform pre-electrophoresis in 0.5× TBE buffer at 10 W constant power for 30 minutes. Before electrophoresis, rinse the sample wells clean of urea with a pipette tip.
[0158] To 120 μl of RNA sample, add an equal volume of 2× RNA loading buffer (containing xylene cyanol) and heat at 70°C for 3 minutes. Place on ice for 5 minutes. Rinse the urea from the loading wells with a pipette tip. Load 30 μl of sample into each well and run electrophoresis at 10W constant power until the xylene cyanol reaches the bottom of the urea gel, approximately 35 minutes.
[0159] The urea gel was completely scooped off and placed on a thin layer chromatography silica gel plate covered with transparent plastic wrap. The black band on the upper part of the urea gel was observed under 254 nm ultraviolet light of a handheld ultraviolet analyzer. The gel corresponding to the band was cut off, placed in a 5 ml centrifuge tube and crushed with a pipette tip. 5 ml of sol buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) was added and vortexed to mix. The mixture was placed at room temperature overnight.
[0160] Divide the urea gel suspension into four 1.5ml centrifuge tubes and centrifuge at 12,000 rpm for 1 minute. Collect the supernatant into new 1.5ml centrifuge tubes and discard the gel layer. Add 50 μl of phenol: RNA-assisted extraction reagent: isoamyl alcohol (25:24:1) and mix thoroughly. Centrifuge at 12,000 rpm for 10 minutes to precipitate impurities. Collect the supernatant into a new 5ml centrifuge tube and add 0.1 volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropanol to the supernatant for precipitation. Transfer 800 μl of the suspension to a 2ml nucleic acid purification column. Centrifuge at 12,000 rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μl of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 20 μl of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate. Measure the RNA concentration using a Nanodrop analyzer and store at -80°C.
[0161] 1 μg of circular 4× positive-sense RNA was prepared, and primers were designed at the 5' and 3' ends of the circularization site. 1.25 μM of the forward primer (5'ACCGGTAAAAAGGCGAGACG 3' (SEQ ID NO. 20)) and the back primer (5'CGACCGTTTAAGGTCAACGGATTTT 3' (SEQ ID NO. 21)) were added, along with 1 μl of reverse transcriptase. The product was incubated in a standard PCR instrument at 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. The cDNA product was stored at 4°C. Sanger sequencing was performed to verify the presence of the circularization site. As shown in Figure 4, the circular 4× positive-sense RNA gel was recovered. Using the designed front and back primers for the circularization site, the cDNA fragment was reverse transcribed and subjected to Sanger sequencing. The intron sequence was cleaved and not detected, and the 5' exon and 3' exon were successfully connected.
[0162] In the present disclosure, taking siCopGFP as an example, “circular 4×siCopGFP” is written as “C-4×-siCopGFP”, “linear 1×siCopGFP” is written as “L-1×-siCopGFP”, the positive chain of siCopGFP is written as “S-siCopGFP”, and the antisense chain of siCopGFP is written as “AS-siCopGFP”.
[0163] 5.2 Binding of Sense and Antisense Strands
[0164] Equal amounts of circular 4× sense and linear antisense strands (e.g., 60 pmol of linear antisense strand mixed with 60 pmol of circular 4× sense strands) or linear sense and linear antisense strands (e.g., 60 pmol of linear antisense strand mixed with 60 pmol of linear sense strands) were mixed and brought to 60 μl with enzyme-free water. The tubes were heated at 95°C for 5 minutes to fully open the RNA higher-order structure. The tubes were then gradually cooled to room temperature to allow for full complementary pairing of the sense and antisense strands. Briefly centrifuge for 10 seconds to collect the liquid at the bottom of the tubes. The tubes were stored at 4°C and used within 24 hours. Non-denaturing agarose gel electrophoresis revealed bands associated with the circular 4× sense and linear antisense strands. With the addition of circular sense strands, the double-stranded siRNA carried an increased charge, and the bands migrated farther, indicating a decrease in free antisense strands (Figure 5).
[0165] Example 6 Evaluation of the effectiveness and immunogenicity of circular 4×siCopGFP
[0166] Inoculate 1 × 10 5HEK293 human embryonic kidney cells (ATCC CRL-1573) were cultured in 500 μl of high-glucose DMEM (DMEM) supplemented with 10% fetal bovine serum for one day at 37°C and 5% CO2. The next day, after the HEK293 cells had adhered, the medium was discarded and the cells were rinsed twice with PBS to remove the serum. 1.25 ml of Opti-MEM was mixed with 25 μl of transfection reagent and incubated at room temperature for 5 minutes. Then, 600 μl of Opti-MEM was mixed with 6 μg of pCDH-CopGFP plasmid and 6 μg of pmCherry-N1 plasmid. Five tubes (100 μl) of Opti-MEM were mixed with 60 pmol of antisense strands in C-4×-siCopGFP, 60 pmol of antisense strands in L-1×-siCopGFP, 60 pmol of antisense strands in AS-siCopGFP, 60 pmol of antisense strands in C-4×-negative control, and 60 pmol of antisense strands in L-1×-negative control. 200 μl of Opti-MEM containing the transfection reagent was mixed with 100 μl of Opti-MEM containing siRNA. A control tube (100 μl of Opti-MEM) was added and incubated for 25 minutes. Add 75 μl of Opti-MEM containing siRNA encapsulated with transfection reagent to each well, then add 25 μl of Opti-MEM containing pCDH-CopGFP plasmid and pmCherry-N1 plasmid, mix gently, add serum-free DMEM high-glucose medium to make up the volume to 500 μl, culture at 37°C for 6 hours, replace the medium with DMEM high-glucose complete medium containing 10% serum, and continue incubation for 24 hours.
[0167] The next day, cells expressing the green fluorescent protein CopGFP were observed under an inverted fluorescence microscope using a green filter, and cells expressing the red fluorescent protein mCherry were observed using a red filter. ImageJ software (National Institutes of Health, V1.8.0) was used to count the areas of green and red fluorescence and calculate the ratio of the two to compare the proportion of green fluorescence in different groups.
[0168] After 48 hours, discard the culture medium and rinse twice with PBS. Add 200μl of total RNA extraction reagent to each well, mix well by pipetting, let stand on ice for 5 minutes, and transfer to an enzyme-free 1.5ml centrifuge tube. Add 40μl of chloroform, carefully cover the 1.5ml centrifuge tube, mix by inverting until the mixture turns light pink, and let stand for 2-3 minutes. Centrifuge at 12000×g and 4℃ for 15 minutes. The liquid will separate from top to bottom into a colorless transparent layer, a milky white precipitate layer, and a pink organic layer. Carefully aspirate the colorless transparent layer into another enzyme-free 1.5ml centrifuge tube, being careful not to aspirate the milky white precipitate layer. Add an equal volume of isopropanol, mix well, and let stand in a 4℃ refrigerator for 10 minutes. Transfer 800μl of the suspension to a 2ml nucleic acid purification column. Centrifuge at 12000rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension is filtered. Add 500 μl of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 15 μl of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate. Measure RNA concentration using a Nanodrop.
[0169] Take 1 μg of total RNA sample, 2 μl of 5×gDNA digestion buffer and 1 μl of gDNA digestion enzyme and add enzyme-free water to make up to 10 μl, incubate at 42°C for 2 minutes. Add 2 μl Ⅱ Buffer plus, 2μl II Enzyme Mix, 1.25 μM random primer N6 and 1.25 μM Oligo(dT) 18 Add enzyme-free water to make up to 20 μl. Incubate in a conventional PCR instrument at 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. Store the cDNA product at 4°C.
[0170] Prepare a 500 μl qPCR reaction system for CopGFP and mCherry: add 200 μl enzyme-free water, 25 μl forward primer, 25 μl back primer, and 250 μl 2×SYBR Green qPCR Mix. Add 9 μl of qPCR reaction system to each of 24 wells of a 384-well plate, and add 1 μl of cDNA product from different samples. Set up two duplicate wells for each sample. Set up a real-time quantitative PCR instrument with 95°C pre-denaturation for 2 minutes, 1 cycle; 95°C denaturation for 10 seconds, 60°C annealing for 20 seconds, 72°C extension for 1 minute, 45 cycles; and melting for 2 minutes. The difference (ΔCt) between the average Ct value of the intervention group samples amplified by the target primers and the average Ct value amplified by the internal reference mCherry primers was calculated by the second-order derivative method. 干预) and the difference between the average Ct value of the control group samples amplified by the target primers and the average CT value amplified by the internal reference mCherry primers (ΔCt 对照 ) is subtracted to obtain the difference (ΔΔCt). (-ΔΔCt) The primers used are shown in Table 3.
[0171] qRT-PCR showed that circular C-4×-siCopGFP reduced the expression level of CopGFP mRNA compared with linear L-1×-siCopGFP, circular C-4×-NC siRNA (circular negative control RNA), and linear L-1×-NC siRNA (linear negative control RNA) in both the linear and control groups (Figure 6). Fluorescence microscopy showed that circular C-4×-siCopGFP significantly reduced the green fluorescence density of CopGFP compared with other groups (Figure 7). 500μl qPCR reaction system of IL-6, TNF, IFNB1 and RIG-Ⅰ was prepared, and 2 replicate wells were set for each sample. In the real-time quantitative PCR instrument, pre-denaturation at 95℃ for 2 minutes, 1 cycle; denaturation at 95℃ for 10 seconds, annealing at 60℃ for 20 seconds, extension at 72℃ for 1 minute, 45 cycles; melting for 2 minutes. (-ΔΔCt) It is the multiple of the change in mRNA level in the intervention group compared with the control group.
[0172] qRT-PCR indicated that transfection of HEK293 cells with circular 4× siCopGFP and linear siCopGFP modified with pseudouridine did not affect the expression levels of intracellular innate immune factors such as interleukin-6 (IL-6), tumor necrosis factor (TNF), interferon β1 (IFNB1), and retinoic acid-inducible gene protein I (RIG-Ⅰ mRNA), and there was no significant difference in immunogenicity (Figure 8).
[0173] Table 3: Primers used in the examples
[0174] Example 7 Preparation of cyclic 4×siPCSK9
[0175] The cyclic 4×siPCSK9 was designed and prepared according to the method of Example 1.
[0176] The 21-base sense strand sequence of PCSK9 is: 5'CCAAGATCCTGCATGTCTTCC 3' (SEQ ID NO. 6). The 24-base antisense strand sequence is: 5'GGAAGACATGCAGGATCTTGGTGA 3' (SEQ ID NO. 36). Spe I (5'A↓CTAGT 3' (SEQ ID NO. 14)) and Age I (5'A↓CCGGT 3' (SEQ ID NO. 15)) were added to either end of the 4× siPCSK9 sense strand and ligated into the pUC57-circRNA expression vector, which had been double-digested with Spe I and Age I, via homologous recombination.
[0177] Circular 4× sense-strand siPCSK9 was then amplified and extracted using E. coli using the method of Example 3, and circular 4× siPCSK9 and the corresponding linear siPCSK9 were prepared using the method of Example 5. Specifically, equal amounts of linear L-1×-AS-siPCSK9 and cyclic C-4×-S-siPCSK9 (e.g., 60 pmol L-1×-AS-siPCSK9 mixed with 60 pmol C-4×-S-siPCSK9) and equal amounts of linear L-1×-AS-siPCSK9 and linear L-1×-S-siPCSK9 (e.g., 60 pmol L-1×-AS-siPCSK9 mixed with 60 pmol L-1×-S-siPCSK9) were mixed, heated at 95°C for 5 minutes, and gradually annealed to room temperature. Controls of linear L-1×-siCopGFP and circular C-4×-siCopGFP were prepared using the same steps as those for linear L-1×-siPCSK9 and circular C-4×-siPCSK9.
[0178] Example 8 Evaluation of the effectiveness and immunogenicity of cyclic 4×siPCSK9
[0179] Inoculate 1 × 10 5HepG2 human hepatoma cell lines were cultured in 500 μl of high-glucose DMEM complete medium supplemented with 10% fetal bovine serum for one day at 37°C and 5% CO2. The next day, after the HepG2 cells had adhered, the medium was discarded and the cells were rinsed twice with PBS to remove the serum. 1.25 ml of Opti-MEM was mixed with 25 μl of transfection reagent and incubated at room temperature for 5 minutes. Five tubes of 200 μl of Opti-MEM were mixed with 60 pmol of antisense strands of C-4×-siPCSK9, 60 pmol of antisense strands of L-1×-siPCSK9, 60 pmol of antisense strands of AS-siPCSK9, 60 pmol of antisense strands of C-4×-siCopGFP, and 60 pmol of antisense strands of L-1×-siCopGFP. Mix 200 μl of Opti-MEM containing transfection reagent with 200 μl of Opti-MEM containing siRNA. Add 200 μl of Opti-MEM to the control group and incubate for 25 minutes. Add 100 μl of Opti-MEM containing transfection reagent-encapsulated siRNA to each well, mix gently, and add serum-free DMEM high-glucose medium to bring the volume to 500 μl. After incubation at 37°C for 6 hours, replace the medium with DMEM high-glucose complete medium supplemented with 10% serum and continue incubation for 72 hours or 168 hours.
[0180] Separately, five tubes of 300 μl of Opti-MEM were mixed with 90 pmol of antisense strands of C-4×-siPCSK9, 90 pmol of antisense strands of L-1×-siPCSK9, and 90 pmol of antisense strands of AS-siPCSK9, respectively. 200 μl of Opti-MEM containing transfection reagent was mixed with 200 μl of Opti-MEM containing siRNA. A control group was treated with 200 μl of Opti-MEM and incubated for 25 minutes. 100 μl of Opti-MEM containing transfection reagent-encapsulated siRNA was added to each well, gently mixed, and the volume was brought to 500 μl with serum-free DMEM high-glucose medium. Three wells in each group were then added with 22 μM atorvastatin calcium and incubated for up to 72 hours.
[0181] After the incubation time is reached, discard the culture medium and rinse twice with PBS. Add 200μl of total RNA extraction reagent to each well, pipette to mix thoroughly, let stand on ice for 5 minutes, and transfer to an enzyme-free 1.5ml centrifuge tube. Add 40μl of chloroform, carefully cover the 1.5ml centrifuge tube, and mix by inverting until the mixture turns light pink. Let stand for 2-3 minutes. Centrifuge at 12000×g at 4°C for 15 minutes. The liquid will separate from top to bottom into a colorless transparent layer, a milky white precipitate layer, and a pink organic layer. Carefully aspirate the colorless transparent layer into another enzyme-free 1.5ml centrifuge tube, and aspirate the pink organic layer into another enzyme-free 1.5ml centrifuge tube, being careful not to aspirate the milky white precipitate layer. Add an equal volume of isopropanol to the colorless transparent layer and mix thoroughly. Let stand in a refrigerator at 4°C for 10 minutes. Transfer 800μl of the suspension to a 2ml nucleic acid purification column. Centrifuge at 12000rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μl of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 15 μl of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate. Measure RNA concentration using a Nanodrop.
[0182] Take 1 μg of total RNA sample, 2 μl of 5×gDNA digestion buffer and 1 μl of gDNA digestion enzyme and add enzyme-free water to make up to 10 μl, incubate at 42°C for 2 minutes. Add 2 μl Ⅱ Buffer plus, 2μl Add II Enzyme Mix, 1.25 μM random primer N6, and 1.25 μM Oligo(dT)18, and make up to 20 μl with enzyme-free water. Incubate in a standard PCR instrument at 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. Store the cDNA product at 4°C.
[0183] A 500 μl qPCR reaction system for PCSK9, LDLR, IL-6, TNF, IFNB1, RIG-I, and ACTB was prepared by adding 200 μl of enzyme-free water, 25 μl of forward primer, 25 μl of back primer, and 250 μl of 2×SYBR Green qPCR Mix. 9 μl of the qPCR reaction system was added to 24 wells of a 384-well plate, and 1 μl of cDNA product from each sample was added. Two replicate wells were set for each sample. The real-time quantitative PCR instrument was set to perform a pre-denaturation cycle at 95°C for 2 minutes, followed by 45 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 20 seconds, and extension at 72°C for 1 minute, followed by a melting step of 2 minutes. The difference (ΔCt) between the mean Ct value of the intervention group samples amplified by the target primers and the mean Ct value amplified by the internal reference ACTB primers was calculated by the second-order derivative method.干预 ) and the difference between the average Ct value of the control group samples amplified by the target primers and the average CT value amplified by the internal reference ACTB primers (ΔCt 对照 ) is subtracted to obtain the difference (ΔΔCt). (-ΔΔCt) The primers used are shown in Table 3.
[0184] Add 1.5 times the volume of isopropanol to the pink organic layer and let it stand on ice for 20 minutes. Centrifuge at 4°C, 12,000 rpm for 15 minutes until a white precipitate is visible. Discard the pink supernatant. Add 200 μl of 0.3 M guanidine hydrochloride in 95% ethanol and let it stand on ice for 10 minutes. Centrifuge at 4°C, 7,500 rpm for 5 minutes and discard the supernatant. Repeat once. Add 200 μl of anhydrous ethanol and let it stand on ice for 10 minutes. Centrifuge at 4°C, 7,500 rpm for 5 minutes and discard the supernatant. Dissolve the protein in 50 μl of 10% SDS solution heated at 99°C for 10 minutes.
[0185] Take 4 μl of each histone solution and dilute it 5-fold with 16 μl of deionized water. Add 200 μl of BCA working solution (solution A:solution B = 50:1). Incubate at 37°C for 30 minutes and measure the absorbance at 562 nm using a multifunctional microplate reader. Fit a linear function curve between the absorbance of the standard and the protein concentration value. The fitting coefficient R 2 ≥0.99, and calculate the protein concentration of each well according to the curve equation. Adjust the concentration of each protein solution to the same volume by adding deionized water. Add 0.25 volumes of 5× SDS loading buffer to each group and mix thoroughly. Heat at 99°C for 10 minutes, centrifuge at 12,000 rpm for 10 minutes, and store at -80°C.
[0186] Prepare ten wells of a 10% SDS-polyacrylamide gel and load 100 μg of protein per well. Electrophoresis was performed at 80 V for 25 minutes in an electrophoresis buffer consisting of 3.03 g / L Tris, 14.40 g / L glycine, and 1.00 g / L SDS. After the protein markers were clearly separated, electrophoresis was continued at 120 V for 80 minutes. In an electrotransfer buffer consisting of 2.42 g / L Tris, 11.52 g / L glycine, and 20% methanol, two outer layers of sponge, two middle layers of filter paper, an inner layer of gel, and a methanol-activated 0.45 μm filter were clamped together. Electrodes were inserted into the correct positions for the electrophoresis direction and the membrane was transferred at a constant current of 230 mA for 160 minutes. The membrane was washed twice with TBST for 10 minutes each. Blocked with protein-free rapid blocking buffer for 30 minutes. The membrane was then washed three times with TBST for 8 minutes each. The filters of the 95kD and above, 55-95kD, and 33-46kD bands were incubated with 1:1000 diluted primary antibodies to LDLR, PCSK9, and GAPDH, respectively, at 4°C overnight.
[0187] The next day, the primary antibody was removed. The membrane was washed three times with TBST (8 minutes each time). The secondary antibody was incubated for 1 hour at a dilution of 1:5000. The membrane was washed three times with TBST (8 minutes each time). The filter membrane treated with chemiluminescent solution was exposed on an imager. Background correction was performed using ImageJ, and the grayscale of the bands was measured. The grayscale ratios of the LDLR, PCSK9, and GAPDH bands in each group were compared.
[0188] On day 3 of HepG2 transfection, qRT-PCR experiments revealed that cyclic C-4×siPCSK9 transfection significantly reduced PCSK9 mRNA levels compared with the linear siPCSK9 group, the negative control groups (L-1×-siCopGFP and C-4×-siCopGFP), and the positive control group (AS-siPCSK9). The reduction in PCSK9 mRNA levels by cyclic C-4×-siPCSK9 transfection persisted until day 7 of transfection. High-intensity atorvastatin increased PCSK9 mRNA levels in HepG2 cells, but only cyclic C-4×-siPCSK9 significantly reduced PCSK9 mRNA levels in HepG2 cells. Neither AS-siPCSK9 nor linear L-1×-siPCSK9 was able to reduce the high-intensity atorvastatin-induced increase in PCSK9 mRNA levels in HepG2 cells (Figure 9). Western blot analysis revealed that on day 3 after transfection with cyclic C-4×-siPCSK9, LDLR protein levels in HepG2 cells were elevated compared with those in other groups, while PCSK9 protein levels were decreased. On day 7 after transfection, LDLR protein levels in HepG2 cells remained elevated compared with those in other groups, while the difference in PCSK9 protein levels between the two groups decreased. High-intensity atorvastatin increased PCSK9 protein levels in HepG2 cells, but the combination of high-intensity atorvastatin with cyclic C-4×-siPCSK9 resulted in lower PCSK9 protein levels than the combination with linear L-1×-siPCSK9 (Figure 10). This suggests that cyclic C-4×-siPCSK9 can reduce PCSK9 protein levels in HepG2 cells on day 3 and increase LDLR levels, with the LDLR elevation effect persisting until day 7. Furthermore, only cyclic C-4×-siPCSK9 can prevent the increase in PCSK9 induced by high-intensity atorvastatin.
[0189] On day 3 of HepG2 transfection, qRT-PCR revealed that cyclic C-4×-siPCSK9 transfection significantly increased IL-6 mRNA levels compared with the linear siPCSK9 group and the negative control group. By day 7 of cyclic C-4×-siPCSK9 transfection, IL-6 mRNA levels had decreased to no significant difference from the control group. On day 3 of transfection, cyclic C-4×-siPCSK9 transfection did not increase TNF, IFNB1, or RIG-I mRNA levels. On day 7 of transfection, cyclic C-4×-siPCSK9 transfection significantly decreased IFNB1 mRNA compared with the cyclic C-4×-negative control siRNA group and the remaining negative control groups, and significantly decreased RIG-I mRNA compared with the cyclic C-4×-negative control siRNA group (Figure 11).
[0190] High-intensity atorvastatin combined with cyclic C-4×-siPCSK9 significantly increased IL-6 levels compared with cyclic C-4×-siPCSK9 alone, and both groups had elevated IL-6 levels compared with the other groups. High-intensity atorvastatin combined with cyclic C-4×-siPCSK9 did not increase TNF, IFNB1, and RIG-I levels compared with the control group. Because cyclic C-4×-siPCSK9 transiently increases IL-6 levels on day 3 of transfection, the elevated IL-6 levels seen with high-intensity atorvastatin combined with cyclic C-4×-siPCSK9 likely returned to normal by day 7. Therefore, the combination of high-intensity atorvastatin and cyclic C-4×-siPCSK9 had little impact on immunogenicity (Figure 12).
[0191] Example 9 Comparison of the inhibition of PCSK9 mRNA levels by circular siPCSK9 with different numbers of sense chains in series
[0192] Inoculate 1 × 10 5HepG2 human hepatoma cell lines were cultured in 500 μl of high-glucose DMEM complete medium supplemented with 10% fetal bovine serum for one day at 37°C and 5% CO2. The next day, after the HepG2 cells had adhered, the medium was discarded and the cells were rinsed twice with PBS to remove the serum. 1.25 ml of Opti-MEM was mixed with 25 μl of transfection reagent and incubated at room temperature for 5 minutes. Five tubes of 200 μl of Opti-MEM were mixed with 60 pmol of linear L-1×-siPCSK9 antisense strand, 60 pmol of circular C-1×-siPCSK9 antisense strand (containing only one sense strand sequence), 60 pmol of circular C-4×-siPCSK9 antisense strand (containing four repeats of the sense strand sequence), 120 pmol of C-4×-siPCSK9 antisense strand, and 60 pmol of C-8×-siPCSK9 antisense strand (containing eight repeats of the sense strand sequence). Mix 200 μl of Opti-MEM containing transfection reagent with 200 μl of Opti-MEM containing siRNA. Add 200 μl of Opti-MEM to the control group and incubate for 25 minutes. Add 100 μl of Opti-MEM containing siRNA encapsulated with transfection reagent to each well, mix gently, and add serum-free DMEM high-glucose medium to bring the volume to 500 μl. After incubation at 37°C for 6 hours, replace the medium with DMEM high-glucose complete medium supplemented with 10% serum and continue incubation for up to 72 hours.
[0193] After the incubation time is reached, discard the culture medium and rinse twice with PBS. Add 200μl of total RNA extraction reagent to each well, pipette to mix thoroughly, let stand on ice for 5 minutes, and transfer to an enzyme-free 1.5ml centrifuge tube. Add 40μl of chloroform, carefully cover the 1.5ml centrifuge tube, and mix by inverting until the mixture turns light pink. Let stand for 2-3 minutes. Centrifuge at 12000×g at 4°C for 15 minutes. The liquid will separate from top to bottom into a colorless transparent layer, a milky white precipitate layer, and a pink organic layer. Carefully aspirate the colorless transparent layer into another enzyme-free 1.5ml centrifuge tube, and aspirate the pink organic layer into another enzyme-free 1.5ml centrifuge tube, being careful not to aspirate the milky white precipitate layer. Add an equal volume of isopropanol to the colorless transparent layer and mix thoroughly. Let stand in a refrigerator at 4°C for 10 minutes. Transfer 800μl of the suspension to a 2ml nucleic acid purification column. Centrifuge at 12000rpm for 1 minute, discard the filtrate, and repeat the centrifugation until all the suspension has been filtered. Add 500 μl of 80% ethanol and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate and repeat twice to rinse the filter column. Centrifuge at 12,000 rpm for 3 minutes to remove the ethanol. Add 15 μl of 1× TE buffer to the filter column and let it stand for 5 minutes to fully dissolve the RNA. Centrifuge at 12,000 rpm for 1 minute and recover the filtrate. Measure RNA concentration using a Nanodrop.
[0194] Take 1 μg of total RNA sample, 2 μl of 5×gDNA digestion buffer and 1 μl of gDNA digestion enzyme and add enzyme-free water to make up to 10 μl, incubate at 42°C for 2 minutes. Add 2 μl Ⅱ Buffer plus, 2μl Add II Enzyme Mix, 1.25 μM random primer N6, and 1.25 μM Oligo(dT)18, and make up to 20 μl with enzyme-free water. Incubate in a standard PCR instrument at 25°C for 5 minutes, 42°C for 30 minutes, and 85°C for 5 minutes. Store the cDNA product at 4°C.
[0195] Prepare 500 μl of PCSK9 and ACTB qPCR reaction system: add 200 μl of enzyme-free water, 25 μl of forward primer, 25 μl of back primer, and 250 μl of 2×SYBR Green qPCR Mix. Add 9 μl of qPCR reaction system to each of 24 wells of a 384-well plate, and add 1 μl of cDNA product of different samples. Set up two duplicate wells for each sample. Set up the real-time quantitative PCR instrument with 95°C pre-denaturation for 2 minutes, 1 cycle; 95°C denaturation for 10 seconds, 60°C annealing for 20 seconds, 72°C extension for 1 minute, 45 cycles; melting for 2 minutes. The difference (ΔCt) between the average Ct value of the intervention group samples amplified by the target primers and the average Ct value amplified by the internal reference ACTB primers was calculated by the second-order derivative method. 干预 ) and the difference between the average Ct value of the control group samples amplified by the target primers and the average CT value amplified by the internal reference ACTB primers (ΔCt 对照 ) is subtracted to obtain the difference (ΔΔCt). (-ΔΔCt) The primers used are shown in Table 3.
[0196] Three days after transfection, cyclic C-4×-siPCSK9 showed the greatest reduction in PCSK9 levels. Using a double dose of cyclic C-4×-siPCSK9 or cyclic C-8×-siPCSK9 did not reduce PCSK9 levels more effectively than a single dose (15 pmol) of cyclic C-4×-siPCSK9. Cyclic C-1×-siPCSK9 failed to inhibit PCSK9 expression (Figure 13). The results indicate that four tandem repeats of the positive sense strand are the most effective in silencing PCSK9.
[0197] Example 10 Delivery of cyclic C-4×-siPCSK9 using lipid nanoparticles
[0198] Nine female C57BL / 6 mice fed a normal diet for 12 weeks were divided into three groups: (1) PBS group (n = 3): 200 μl PBS; (2) naked C-4×-siPCSK9 group (n = 3): 15 μg C-4×-siPCSK9; (3) LNP / C-4×-siPCSK9 group (n = 3): 150 μg LNP + 15 μg C-4×-siPCSK9 (the mass ratio of the circular sense chain to the linear antisense chain was 2:1, and the molar ratio was 1:4). LNP was composed of ALC-0315, cholesterol, DSPC, and DMG-PEG at a molar ratio of 50:38:10:1.5, and then mixed with C-4×-siPCSK9 at a mass ratio of 10:1. The antisense sequence of mouse PCSK9 is 5'GGCCTCAATCCAATCACCACGACG3' (SEQ ID NO.41), and the sense sequence is 5'GTGGTGATTGGATTGAGGCCA3' (SEQ ID NO.42). The injection volume of each mouse was 200 μl. All mice in each group were fed with a normal diet. 50 μl of blood was collected from the eye socket on the day of injection and at weeks 2, 4, 8, and 12 after injection. The blood samples to be processed were centrifuged at 5500 rpm for 15 minutes, and mouse serum was collected and stored at -80°C. Serum PCSK9 levels were measured using a mouse PCSK9 ELISA kit according to the manufacturer's instructions. Serum LDLR was measured using an LDL-C detection kit. Serum ALT and creatinine levels were measured at week 12 using alanine aminotransferase (ALT) and creatinine detection kits.
[0199] After injection of LNP-encapsulated cyclic C-4×-siPCSK9, serum PCSK9 levels in C57BL6 mice continued to decrease over the first four weeks, and by week two, the level was significantly reduced by 52% compared to the naked 15μg C-4×-siPCSK9 group and the PBS group. From week 8 to 12, serum PCSK9 levels in all three groups continued to increase, with no significant differences among the three groups. LDL-C levels in C57BL6 mice continued to decrease after injection of LNP-encapsulated cyclic C-4×-siPCSK9, while LDL-C levels in the other two groups remained unchanged. From week 8 to 12, LDL-C levels in the LNP-encapsulated cyclic C-4×-siPCSK9 group were significantly lower than those in the other two groups, reaching a maximum of 85% (Figure 14). At week 12, serum ALT and creatinine levels in the three groups of mice showed no significant differences (Figure 15). This suggests that LNP-encapsulated cyclic C-4×-siPCSK9 can effectively lower LDL-C levels in C57BL6 mice without significant hepatotoxicity or renal toxicity.
[0200] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.
Claims
1. A nucleic acid construct comprising, in the following order from 5' to 3' direction, a first circularization element, optionally at least one first restriction enzyme recognition sequence, at least one target sequence, optionally at least one second restriction enzyme recognition sequence and a second circularization element.
2. The nucleic acid construct of claim 1, comprising two or more target sequences connected in series, for example, 2 to 8, for example, 2, 3, 4, 5, 6, 7, or 8 target sequences; preferably, the target sequence has a length of 18 to 24 nucleotides, preferably a length of 21 nucleotides.
3. The nucleic acid construct of claim 1 or 2, wherein the first cyclization element comprises, in sequence, a 5' intron element and a 5' exon element, and the second cyclization element comprises, in sequence, a 3' exon element and a 3' intron element; Preferably, the 5' intron element and the 3' intron element are derived from the same self-splicing intron, in particular, the 5' intron element is derived from or contains the 5' terminal part of the self-splicing intron, and the 3' intron element is derived from or contains the 3' terminal part of the self-splicing intron; Also preferably, the 5' intron element comprises a first portion of a group I intron from Anabaena and the 3' intron element comprises a second portion of a group I intron from Anabaena, or The 5' intron element comprises a first portion from a class I intron of bacteriophage T4, and the 3' intron element comprises a second portion from a class I intron of bacteriophage T4, or The 5' intronic element includes a first portion of a group I intron from Azotobacter sp. BH72, and the 3' intronic element includes a second portion of a group I intron from Azotobacter sp. BH72.
4. The nucleic acid construct of claim 3, wherein the 5' intronic element comprises the sequence of SEQ ID NO. 4, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; and / or the 5' exonic element comprises the sequence of SEQ ID NO. 5, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; and / or the 3' intronic element comprises the sequence of SEQ ID NO. 13, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; and / or the 3' exonic element comprises the sequence of SEQ ID NO. 12, or a sequence at least 80%, 85%, 90%, 95%, 98%, or 99% identical thereto; or The 5' intronic element comprises the sequence shown in SEQ ID NO.51, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; and / or the 5' exonic element comprises the sequence shown in SEQ ID NO.52, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; and / or or the 3' intronic element comprises the sequence shown in SEQ ID NO. 53, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; and / or the 3' exonic element comprises the sequence shown in SEQ ID NO. 54, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; or The 5' intronic element comprises the sequence shown in SEQ ID NO.55, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; and / or the 5' exonic element comprises the sequence shown in SEQ ID NO.56, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; and / or the 3' intronic element comprises the sequence shown in SEQ ID NO.57, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto; and / or the 3' exonic element comprises the sequence shown in SEQ ID NO.58, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.
5. The nucleic acid construct of claim 1 , wherein the first restriction enzyme recognition sequence is identical or different from the second restriction enzyme recognition sequence, and at least one of the first and second restriction enzyme recognition sequences is selected from the group consisting of the recognition sequences for the following restriction endonucleases: SpeI, AgeI, Hind III, Bgl II, KpnI, XhoI, SacII, NotI, BamH I, or XbaI; Preferably, at least one of the first restriction enzyme recognition sequence and the second restriction enzyme recognition sequence comprises a sequence selected from the following: ACTAGT (SEQ ID NO.14 (SpeⅠ)), ACCGGT (SEQ ID NO.15 (AgeⅠ)), AAGCTT (SEQ ID NO.43 (Hind III)), AGATCT (SEQ ID NO.44 (Bgl II)), GGTACC (SEQ ID NO.45 (KpnI)), CTCGAG (SEQ ID NO.46 (XhoI)), CCGCGG (SEQ ID NO.47 (SacII)), GCGGCCGC (SEQ ID NO.48 (NotI)), GGATCC (SEQ ID NO.49 (BamH I)), TCTAGA (SEQ ID NO.50 (XbaI)).
6. The nucleic acid construct of claim 1, further comprising at least one spacer sequence; preferably two or more spacer sequences; in particular, when the nucleic acid construct comprises more than two target sequences, any two adjacent target sequences are separated by at least one spacer sequence; Preferably, the spacer sequence has a length of 2 to 40 nucleotides and / or is a polyAC sequence or contains about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% polyAC content.
7. An expression vector comprising at least one RNA polymerase promoter and the nucleic acid construct according to any one of claims 1 to 6; Preferably, the at least one RNA polymerase promoter is derived from a virus and is selected from the group consisting of a T7 RNA polymerase promoter, an SP6 RNA polymerase promoter, a T3 RNA polymerase promoter, a T6 RNA polymerase promoter, a T4 RNA polymerase promoter and a K11 RNA polymerase promoter, and / or The expression vector is a plasmid expression vector, preferably an Escherichia coli plasmid expression vector, such as pET-28a, pET-32a, pGEX4T-1, pUC57 plasmid expression vectors.
8. A linear RNA polynucleotide transcribed from the nucleic acid construct according to any one of claims 1 to 6, for example, by in vitro transcription.
9. The linear RNA polynucleotide of claim 8, which is unmodified, partially modified or fully modified, and / or which is capable of self-splicing to form a circular or substantially circular structure under the mediation of guanosine triphosphate (GTP).
10. A circular RNA comprising at least one sense strand sequence and at least one spacer sequence, preferably, the circular RNA comprises two or more sense strand sequences connected in series, for example, 2 to 8, for example, 2, 3, 4, 5, 6, 7, or 8 sense strand sequences; in particular, when the circular RNA comprises two or more sense strand sequences, any two adjacent sense strand sequences are separated by at least one spacer sequence; Preferably, the sense strand sequence has a length of 18 to 24 nucleotides, preferably a length of 21 nucleotides; Preferably, the spacer sequence has a length of 2 to 40 nucleotides and / or is a polyAC sequence or contains about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% polyAC content.
11. The circular RNA of claim 10, further comprising a 5' exonic element and a 3' exonic element, wherein the 5' exonic element and the 3' exonic element are derived from natural exons of the same self-splicing intron, preferably, the self-splicing intron is selected from Anabaena group I introns, T4 phage group I introns, or Azotobacter sp. BH72 group I introns.
12. The circular RNA of claim 10 or 11, which anneals to at least one linear antisense strand to form a circular siRNA; Preferably, the linear antisense strand has a length of 21 to 27 nucleotides, such as 21, 22, 23, 24, 25, 26, 27, preferably 24 nucleotides; Preferably, the sense strand sequence comprises a sequence as shown in SEQ ID NO. 6, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto, and the antisense strand sequence comprises a sequence as shown in SEQ ID NO. 36, or a sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto.
13. The circular RNA of claim 10 or 11, wherein the number of the linear antisense strands is the same as the number of the sense strand sequences; and / or the circular siRNA further comprises at least one chemical modification. 14 . A pharmaceutical composition comprising the circular RNA according to claim 10 and a drug delivery vehicle; preferably, the drug delivery vehicle is a nanoparticle.
15. Use of the circular RNA according to any one of claims 10 to 13 in the preparation of a medicament for treating a disease in a subject; Preferably, the drug mediates the degradation of mRNA of a disease-related protein. Also preferably, the disease-related protein is selected from PCSK9, APOC3, ANGPTL4, LPA, ATN1 protein, ataxia protein, huntingtin protein, and BACE1.
16. A cell comprising the expression vector of claim 7 or the circular RNA of any one of claims 8 to 10; Preferably, the cells are E. coli cells.
Citation Information
Patent Citations
Method for preparing double-stranded RNA
CN115052987A
Circular RNA and preparation method thereof
WO2023046153A1
Methods of making circular RNA
WO2023222114A1
Cited By
Combinations of antisense agents, pharmaceutical compositions and methods of use
WO2026133250A1
Combinations of antisense agents, pharmaceutical compositions and methods of use
WO2026133251A1
Combinations of antisense agents, pharmaceutical compositions and methods of use
WO2026133253A1