SNP (Single Nucleotide Polymorphism) molecular marker related to character of ear number per plant of wheat and application of SNP molecular marker
By developing SNP molecular markers on chromosome 4A of the wheat genome and performing dCAPS marker detection, the problem of poor repeatability of QTLs for the number of ears per wheat plant in existing technologies has been solved, enabling efficient breeding under different environments and years, and improving the number of ears per wheat plant and yield.
Patent Information
- Application Number
- CN202511288074.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-10
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-09-10
AI Technical Summary
Existing technologies are difficult to effectively utilize QTLs related to the number of ears per wheat plant for genetic improvement, resulting in poor repeatability across different environments and years, making it difficult to increase wheat yield.
A SNP molecular marker located on chromosome 4A of the wheat genome was developed. Specific primer sets were designed for PCR amplification and enzyme digestion analysis. The dCAPS marker was used to detect that the number of spikes per plant in wheat with genotype CC was higher than that in wheat with genotype TT. The correlation between the marker and the number of spikes per plant was verified by association analysis.
This study enabled the effective identification and improvement of the number of ears per wheat plant under different environments and years, providing a new method for molecular marker-assisted selection breeding and improving the efficiency of high-yield wheat breeding.
Smart Images

Figure CN120945104A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker breeding technology, and in particular to a SNP molecular marker related to the number of ears per wheat plant and its application. Background Technology
[0002] Wheat (Triticum aestivum L.) is one of the most important global food crops and a vital source of energy and nutrition for humankind. Increasing wheat yield per unit area is a crucial way to meet the ever-increasing food demand in recent years. The number of ears per plant (Thousand Grain Weight, TGW) is a significant factor in wheat yield and an important indicator of wheat quality. Therefore, exploring superior allelic variations in regulating the number of ears per plant and developing functional markers has significant application value in high-yield wheat breeding.
[0003] In recent years, QTL mapping of the number of ears per plant and related traits in wheat has been a research hotspot for wheat yield traits. It has been reported that Yan Jun et al. (2011) detected two QTL loci controlling the number of ears per plant on wheat chromosome 5B, explaining 44.7% of the total genetic variation. Zhou Miaoping et al. (2006) showed that one QTL locus controlling the number of ears per plant was detected on wheat chromosome 5A, explaining 18.8% of the genetic variation. Ding Anming et al. (2011) detected 15 QTL loci controlling the number of ears per plant in three environments, with the major gene explaining approximately 15% of the phenotypic variation. Wan Jiale et al. (2024) used 135 DH accessions of Anong 859 / Wunong 988 as research materials, measuring the phenotypic value of the number of ears per plant under five environments over two years, and developing CAPS molecular markers based on the 55K microarray data of the DH population for OTL analysis of the number of ears per plant. The results showed that a total of 21 QTLs related to the number of ears per plant were detected on chromosomes 1B, 1D, 2A, 3D, 4A, 4B, 4D, 6A, and 7D. Among them, Qsn-ahau-4B.2 on chromosome 4B was detected in all five environments, with flanking markers AX-95004669-AX-109580651 and a physical interval of 2.65 Mb, which could explain 16.92% to 49.98% of the phenotypic variation.
[0004] Wang Shengxing et al. (2017) detected two QTLs controlling the number of spikes per plant on chromosome 1A and 5D using the backcross population of Anong 0711 / Yannong 19BC1F2, explaining 2.86% and 1.92% of the phenotypic variation, respectively. Yan Jun et al. (2011) detected two QTLs controlling the number of spikes per plant on chromosome 5B using recombinant inbred lines constructed from durum wheat and wild emmer wheat, with a total phenotypic explanation rate of 44.7%. Hu Yangshan (2018) detected 26 QTLs related to the number of spikes per plant in the RIL population constructed by CN18 / T1208, and located cQTN.sicau-2D.2 in the interval of 70.45–81.75 Mb, with a phenotypic explanation rate of 3.91%–13.25%. Naruoka et al. (2011) located the QTn.mst-6B locus controlling the number of spikes per plant in the RIL population constructed by them, explaining 9%–17% of the phenotypic variation. Yan et al. (2009) located the number of ears per plant in the region Xgwm495–Xgwm113 on chromosome 4B, with a phenotypic explanation rate of 34.6%. Shah et al. (1999) used a RIL population to locate a pleiotropic QTL related to the number of ears per plant on chromosome 3A.
[0005] Although many QTLs related to the number of ears per wheat plant have been identified, most QTLs have a small phenotypic contribution, require additive effects to be expressed, and have poor repeatability across different years and environments. Therefore, these QTLs are difficult to apply to the genetic improvement of the number of ears per wheat plant. Summary of the Invention
[0006] The purpose of this invention is to provide a SNP molecular marker related to the number of ears per wheat plant and its application, so as to solve the problems existing in the prior art.
[0007] To achieve the above objectives, the present invention provides the following solution:
[0008] One of the technical solutions of the present invention is an SNP molecular marker related to the number of ears per wheat plant. The molecular marker is located on chromosome 4A of the wheat genome and is the nucleotide sequence shown in SEQ ID NO.1, wherein the 783rd base of the nucleotide sequence is C or T.
[0009] The second technical solution of the present invention is a primer set for specific detection of the SNP molecular marker, including the primers shown in SEQ ID NO.2 to 5.
[0010] The third technical solution of the present invention is a method for identifying the number of ears per wheat plant using the SNP molecular marker, comprising the following steps: detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the genomic DNA of the wheat to be identified, wherein the number of ears per wheat plant with the genotype CC is higher than that of wheat with the genotype TT.
[0011] The fourth technical solution of the present invention is the application of the SNP molecular marker in breeding of wheat spike number-related traits.
[0012] The fifth technical solution of the present invention is the application of the SNP molecular marker in the identification or auxiliary identification of wheat spike number-related traits in breeding.
[0013] The sixth technical solution of the present invention is the application of the SNP molecular marker in the preparation of products for identifying or assisting in the identification of wheat spike number-related traits.
[0014] Based on the above technical solution, the present invention has the following technical effects:
[0015] This invention, through genetic variation analysis of a natural wheat population, identified a single SNP corresponding to position 783 from the 5' end of SEQ ID NO. 1. By designing a dCAPS marker for this SNP, two genotypes were found: genotype A (C) and genotype B (T). Association analysis demonstrated that, in homozygous cases of these two genotypes, the number of ears per plant was: wheat homozygous for genotype A > wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting this SNP. Experiments have shown that by detecting this SNP, wheat varieties with a higher number of ears per plant can be identified. This invention provides a novel method for marker-assisted selection breeding of wheat, which is of significant importance in agricultural practice and / or related scientific research for cultivating high-yielding wheat varieties. Attached Figure Description
[0016] Figure 1 The electrophoretic detection results of the SNP-labeled enzyme digestion products developed in this invention are shown below; wherein, lane M is the molecular weight standard; lane C is the band cleaved by XhoI, and lane T is the band that cannot be cleaved by XhoI.
[0017] Figure 2 This is a schematic diagram of the gene structure and SNP sites of the present invention.
[0018] Figure 3 This is a schematic diagram of gene SNP sites and genotypes in the wheat population material of this invention.
[0019] Figure 4 This is a schematic diagram showing the correlation between gene polymorphism sites and the number of ears per plant in a natural population.
[0020] Figure 5 This is a schematic diagram illustrating the results of the correlation analysis between gene polymorphism sites in a natural population and the number of ears per plant.
[0021] Figure 6 This is the XhoI identification site.
[0022] Figure 7 This is a photo of the wheat sowing site in Example 2.
[0023] Figure 8 This is a photo of the wheat harvesting site in Example 2. Detailed Implementation
[0024] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.
[0025] This invention provides an SNP molecular marker associated with the number of ears per wheat plant. The molecular marker is located on chromosome 4A of the wheat genome and is the nucleotide sequence shown in SEQ ID NO.1, where the 783rd base is C or T.
[0026] In some specific implementations, the SNP molecular markers include genotypes CC and TT.
[0027] Embodiments of the present invention also provide a primer set for specifically detecting the SNP molecular marker, including the primers shown in SEQ ID NO.2 to 5.
[0028] This invention also provides a method for identifying the number of ears per wheat plant using the SNP molecular marker, comprising the following steps: detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the genomic DNA of the wheat to be identified, wherein the number of ears per wheat plant with the genotype CC is higher than that of wheat with the genotype TT.
[0029] In some specific implementations, the method for detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the wheat genomic DNA to be identified is as follows:
[0030] (1) Using the wheat genomic DNA to be identified as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2~SEQ ID NO.3;
[0031] (2) Dilute the PCR product from step (1) and perform PCR amplification using the primer pairs shown in SEQ ID NO.4 to SEQ ID NO.5;
[0032] (3) The PCR product of step (2) is digested with XhoI enzyme to obtain the digested product; if the digested product is two or smaller fragments: 94bp, the genotype of the wheat to be tested at the site is C / C; if the digested product is one or larger fragment: 118bp, the genotype of the wheat to be tested at the site is T / T.
[0033] This invention also provides the application of the SNP molecular marker in breeding of wheat spike number-related traits.
[0034] This invention also provides the application of the SNP molecular marker in identifying or assisting in the identification of wheat spike number-related traits in breeding.
[0035] This invention also provides the application of the SNP molecular marker in the preparation of products for identifying or assisting in the identification of wheat spike number-related traits.
[0036] The wheat materials used in the embodiments of this invention are all from the National Crop Germplasm Bank (https: / / www.cgris.net / home). Material information can be found on the China Crop Germplasm Information Network, website: https: / / www.cgris.net / contact.
[0037] Example 1
[0038] 1.1 Specific primers and sequence analysis for amplifying the genomic fragment containing this wheat SNP
[0039] A SNP was found on wheat chromosome 4A (iwgsc_refseqv1.0 assembly for Triticum aestivum), corresponding to position 783 from the 5' end of SEQ ID NO.1. Two genotypes were found at this locus in the naturally occurring wheat population:
[0040] SEQ ID NO.1(>chromosome:IWGSC:4A:406557729-406560182):
[0041]
[0042]
[0043] CAAGCCATAAAATCATAGAATGGT.
[0044] Note: Bold and slanted sites in the sequence are SNP sites. The underlined part represents the sequence from position 384 to 1170 of SEQ ID NO.1 used for PCR amplification. The double underlined part represents the sequence from position 688 to 805 of SEQ ID NO.1 used for PCR amplification.
[0045] Genotype A: C; Genotype B: T.
[0046] Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site:
[0047] F1:ATGAAAGAAGCCCTCCGAGAA(SEQ ID NO.2);
[0048] R1:TCAGAATAAGGTGCATATCTTCTT(SEQ ID NO.3);
[0049] F2: CCTGTTTTGAATGTAAGGAC (SEQ ID NO.4);
[0050] R2: CAAATAACTTCCGGCATGTCTC (SEQ ID NO. 5).
[0051] The sequence from positions 384 to 1170 of SEQ ID NO.1 was amplified by PCR using primers F1 and R1; the sequence from positions 688 to 805 of SEQ ID NO.1 was amplified by PCR using primers F2 and R2. Enzyme digestion analysis showed that this polymorphism could be recognized by XhoI.
[0052] 1.2 Establishment of PCR-restriction polymorphism detection and genotyping methods
[0053] 1) Extract genomic DNA from the wheat to be tested.
[0054] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) consists of: 7 μL ddH2O, 10 μL 2×TaqMix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).
[0055] The PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 54℃ for 30 s, 72℃ for 30 s, for 30 cycles; 72℃ for 10 min; and stored at 16℃.
[0056] 3) Dilute the PCR product from step 2) 10 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2×TaqMix 10 μL, primer F2 (10 μmol / L) and primer R2 (10 μmol / L) 1 μL, template (20 ng / μL) 1 μL.
[0057] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 54℃ for 30 s, 72℃ for 15 s, for 35 cycles; 72℃ for 10 min, and stored at 16℃.
[0058] 4) Digest the PCR product obtained in step 3) with XhoI enzyme to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified site according to the following method:
[0059] If the enzyme digestion product consists of two or smaller fragments (94 bp), the genotype of the wheat being tested at that locus is C / C; if the enzyme digestion product consists of one or larger fragment (118 bp), the genotype of the wheat being tested at that locus is T / T. Figure 1 ).
[0060] 5) Based on the results of step 4), wheat is classified into two types, I and II, at the stated site:
[0061] I: C / C (i.e., homozygous genotype A); II: T / T (i.e., homozygous genotype B).
[0062] Note: The part before the " / " indicates the case on one homologous chromosome, and the part after the " / " indicates the case on another homologous chromosome.
[0063] 1.3 Genotyping of natural populations was performed using dCAPS markers, and association analysis was conducted with the number of ears per plant trait.
[0064] Each wheat variety in a natural population consisting of 348 hexaploid wheat accessions was used as a test wheat variety. The wheat amplification products were then sequenced and verified. The results are shown in Table 1.
[0065] Table 1 shows the polymorphic sites in the natural wheat population.
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073] Exon capture sequencing was performed on 383 samples, and specific genotyping was conducted on these samples. Genotyping included two cases: homozygous C / C genotype A and homozygous T / T genotype B. For example... Figure 3Of the 383 materials, 371 materials could be clearly distinguished as homozygous C / C genotype A or homozygous T / T genotype B, while the remaining 12 materials could not be genotyped.
[0074] Furthermore, of these 383 materials, 348 had agronomic trait data from multiple years and locations, while the remaining 35 materials lacked sufficient data to meet the requirements for subsequent analysis. Therefore, as shown in Table 2 and... Figure 4 As shown, only these 348 data points were used in the association analysis between the genetic polymorphism sites in natural populations and the number of ears per plant. However, among these 348 data points, 17 materials did not have genotyping, so the actual number of samples for association analysis was 331. These 331 samples were used to discover the relationship between molecular markers and traits.
[0075] In 2018, wheat populations of the above-mentioned natural populations were planted in dry-hot and dry-hot and hydrothermal fields at the Third Branch Experimental Station of Hebei Agricultural University (Baoding, Hebei); in 2019, they were planted in dry-hot and dry-hot and hydrothermal and hydrothermal fields at the Hengshui Experimental Site of Hebei Agricultural University (Baoding and Hengshui, Hebei); and in 2020, they were planted in dry-hot and dry-hot fields at the Gaocheng Experimental Site of Hebei Agricultural University (Gaocheng Experimental Station). The number of spikes per plant for each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the relationship between the number of spikes per plant and the polymorphic loci. A mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 2. Figure 4 As shown.
[0076] Table 2. Association analysis results between gene polymorphism sites in natural populations and the number of ears per plant.
[0077]
[0078]
[0079] The association analysis results in Table 2 show that the differences in the number of spikes per plant between the two types formed by the natural population of 331 hexaploid wheat accessions shown in Table 1 were statistically significant (P < 0.05). Specifically, wheat of type I had a higher number of spikes per plant than wheat of type II. In several environments, wheat of type I had 0.25, 0.57, 0.2, 0.26, 0.48, 0.64, 0.46, 0.4, 0.65, and 0.37 more spikes per plant than wheat of type II, respectively. This study of the natural population indicates that type I is a superior genotype for increasing the number of spikes per wheat plant.
[0080] Example 2
[0081] To further verify that wheat with homozygous genotype A is greater than or candidate greater than wheat with homozygous genotype B, an association analysis was conducted on the genetic polymorphism sites in natural populations and the number of ears per plant for another 120 materials (Table 3). Among these 120 data points, 3 materials did not have genotyping, so the actual number of samples for association analysis was 117. These 117 samples were used to verify that there is indeed a relationship between molecular markers and traits.
[0082] Table 3. Validation of the polymorphic sites described in natural wheat populations.
[0083]
[0084]
[0085]
[0086] In 2020, wheat populations of the above-mentioned natural populations were planted in dry-hot and dry-hot and hydrothermal fields at the Hengshui Experimental Site of Hebei Agricultural University (Hengshui, Hebei); in 2021, in dry-hot and dry-hot and hydrothermal and hydrothermal fields at the Pingshan Experimental Site of Hebei Agricultural University (Hengshui and Pingshan, Hebei); and in 2022, in dry-hot and dry-hot fields at the Gaocheng Experimental Site of Hebei Agricultural University (Gaocheng Experimental Station). The number of spikes per plant for each wheat variety was investigated. A correlation analysis was performed using Tassel 2.1 software to analyze the relationship between the number of spikes per plant and the polymorphic loci. A mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 4. Figure 5 As shown.
[0087] Table 4. Association analysis results between gene polymorphism sites in natural populations and the number of ears per plant.
[0088]
[0089]
[0090] The association analysis results in Table 4 show that the differences in the number of spikes per plant between the two types of wheat in the natural population composed of 120 hexaploid wheat accessions shown in Table 3 were statistically significant (P < 0.05). Specifically, wheat of type I had a higher number of spikes per plant than wheat of type II. In several environments, the number of spikes per plant in type I wheat was 0.53, 0.53, 0.81, 0.24, 0.59, 0.49, 0.56, 0.53, 0.36, and 0.44 grams higher than that in type II wheat, respectively. This study of the natural population indicates that type I is a superior genotype for increasing the number of spikes per plant in wheat.
[0091] In summary, this invention discloses a SNP locus associated with the number of ears per wheat plant and its application. Through genetic variation analysis of the coding region of a natural wheat population, this invention identified a SNP corresponding to position 783 from the 5' end of SEQ ID NO. 1. This SNP has two genotypes: genotype A (C) and genotype B (T). Association analysis demonstrated that, in homozygous cases of these two genotypes, the number of ears per plant is: wheat homozygous for genotype A > wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting this SNP. Experiments have shown that by detecting this SNP, wheat varieties with a higher number of ears per plant can be identified. This invention provides a new method for marker-assisted selection breeding of wheat, which is of great significance in the breeding of high-yielding wheat varieties or in research.
[0092] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A SNP molecular marker associated with the number of ears per wheat plant, characterized in that, The molecular marker is located on chromosome 4A of the wheat genome and is the nucleotide sequence shown in SEQ ID NO.1, where the 783rd base is C or T.
2. The SNP molecular marker according to claim 1, characterized in that, The SNP molecular markers include genotypes CC and TT.
3. A primer set for specific detection of the SNP molecular marker as described in claim 1 or 2, characterized in that, Includes the primers shown in SEQ ID NO. 2 to 5.
4. A method for identifying the number of ears per wheat plant using the SNP molecular markers described in claim 1 or 2, characterized in that, Includes the following steps: The genotypes of the corresponding single nucleotide polymorphism sites of the SNP molecular markers in the genomic DNA of wheat to be identified were detected. Wheat with genotype CC had a higher number of ears per plant than wheat with genotype TT.
5. The method according to claim 4, characterized in that, The method for detecting the genotype of the corresponding single nucleotide polymorphism site of the SNP molecular marker in the wheat genomic DNA to be identified is as follows: (1) Using the wheat genomic DNA to be identified as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2~SEQ ID NO.3; (2) Dilute the PCR product from step (1) and perform PCR amplification using the primer pairs shown in SEQ ID NO.4 to SEQ ID NO.5; (3) The PCR product of step (2) is digested with XhoI enzyme to obtain the digested product; if the digested product is two or smaller fragments: 94bp, the genotype of the wheat to be tested at the site is C / C; if the digested product is one or larger fragment: 118bp, the genotype of the wheat to be tested at the site is T / T.
6. The application of the SNP molecular markers as described in claim 1 or 2 in breeding of wheat spike number-related traits.
7. The application of the SNP molecular markers as described in claim 1 or 2 in the identification or auxiliary identification of wheat spike number-related traits in breeding.
8. The application of the SNP molecular marker as described in claim 1 or 2 in the preparation of products for identifying or assisting in the identification of wheat spike number-related traits.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) site related to spikelet number of wheat per ear and application thereof
CN118308524A
SNP-498 site related to ear number of single wheat plant and application of SNP-498 site
CN119144754A
SNP-C682T related to grain number per ear of wheat and application of SNP-C682T
CN119410814A
SNP (Single Nucleotide Polymorphism) molecular marker related to thousand seed weight of wheat and application thereof
CN120796566A
Cited By
C783T SNP (Single Nucleotide Polymorphism) related to grain number per ear of wheat and application thereof
CN120945115A
C783T SNP related to wheat ear grain number and its application
CN120945115B