A molecular marker, primer and application related to the strain Kosakonia oryzendophytica FY-07

By using the molecular marker and primer set of strain FY-07 and combined with PCR amplification technology, the accuracy and rapidity of bacterial cellulose product production species identification were solved, efficient and low-cost bacterial species identification were achieved, and product safety and market specifications were ensured.

CN119876444BActive Publication Date: 2025-07-08TIAN JIN SAI LU SI SHENG WU KE JI YOU XIAN GONG SI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510360668.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-26
Publication Date
2025-07-08
Estimated Expiration
2045-03-26

AI Technical Summary

Technical Problem

The prior art cannot quickly and accurately identify bacterial strains of bacterial cellulose products, and lacks unified industry standards, and poses a risk of potential pathogenic substances being mixed.

Method used

The molecular markers and primer sets related to strain FY-07 were used to identify bacterial cellulose products through PCR amplification technology, and the O9K67_04420 gene and its non-coding region sequences at both ends were used as molecular markers to design forward and reverse primers for identification.

Benefits of technology

It has achieved the identification of strain FY-07 with strong specificity and high sensitivity, fast, accurate, low cost, low equipment requirements, wide application scope, protect production bacterial strains, standardize the market, and prevent potential pathogenic substances from being mixed in.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876444B_ABST
    Figure CN119876444B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker, primer and application related to strain FY-07. The present invention develops a molecular marker for identifying strain FY-07 and the bacterial cellulose product synthesized by strain FY-07, and its nucleotide sequence is shown in SEQ ID No.1, and a primer set for amplifying this sequence is provided. The molecular marker and its primer set of the present invention have high specificity and sensitivity in identifying strain FY-07, and are of great significance for protecting production strains, standardizing the market, preventing potential pathogenic substances from mixing into bacterial cellulose products, etc.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker, primer and application related to strain FY-07. Background Art

[0002] Microbial exopolysaccharides are polymers synthesized by microorganisms, and usually have advantages such as good biocompatibility, diverse properties, and biodegradability, so they are widely used. Bacterial cellulose, as a kind of microbial exopolysaccharide, has the same nature as plant cellulose, but has advantages such as high purity, high crystallinity, nano three-dimensional network structure, and high mechanical strength, so it can be widely used in the fields of food, cosmetics, papermaking, biomedical materials, etc.

[0003] Multiple microorganisms can produce bacterial cellulose, such as Gluconacetobacter, Achromobacter, Aerobacter, Agrobacterium, Alcaligenes, Enterobacter, Pseudomonas, Rhizobium, Salmonella, Sarcina, etc., among which there are some potentially pathogenic genera. Therefore, detecting the production strains of bacterial cellulose products is very important for protecting production strains, standardizing the market, and preventing the mixing of potentially pathogenic substances. The relatively common microbiological detection method is the spread plate method, which can only be used to detect live bacteria, and this method has problems such as poor accuracy and stability, being easily affected by environmental factors, cumbersome steps, and long detection cycles. In addition, the bacterial cellulose industry is in its initial stage of development, and there is no unified and recognized industry standard and related detection methods. Therefore, from the perspectives of protecting production strains, standardizing the market, or preventing potentially pathogenic substances from mixing into bacterial cellulose products, it is very necessary to establish a method for quickly identifying production strains from bacterial cellulose products or solid and liquid in the fermentation process.

[0004] Strain FY-07 and strain DSM 15973 are existing strains for producing bacterial cellulose products. However, due to the high purity characteristics of bacterial cellulose itself, the composition components of bacterial cellulose produced by different genera are basically the same and the performance differences are not significant after treatment, so it is impossible to distinguish the source of its production strains only through the structure and performance of bacterial cellulose products. Therefore, a detection technology with low equipment requirements, good accuracy, low cost, high efficiency, and fast detection is needed to achieve the rapid identification of bacterial cellulose production strains. Summary of the Invention

[0005] In view of the above technical problems, the present invention provides a molecular marker, primer and application related to strain FY-07.

[0006] The technical solution of the present invention is as follows:

[0007] The present invention provides an application of a molecular marker in identifying strain FY-07 or a bacterial cellulose product synthesized by strain FY-07, and the nucleotide sequence of the molecular marker is as shown in SEQ ID No.1.

[0008] As an embodiment, the bacterial cellulose product includes food, cosmetics, paper products, biomedical materials, and intermediates of bacterial cellulose products.

[0009] As an embodiment, the intermediates of the bacterial cellulose product include seed liquid, fermentation broth, water-boiled treatment liquid, aerated liquid, and dried impregnation liquid.

[0010] The present invention also provides a primer set for identifying strain FY-07 or a bacterial cellulose product synthesized by strain FY-07, and the primer set includes a forward primer and a reverse primer; the sequence of the forward primer is as shown in SEQ ID No.2; the sequence of the reverse primer is as shown in SEQ ID No.3.

[0011] The present invention also provides a kit including the above primer set for identifying strain FY-07 or a bacterial cellulose product synthesized by strain FY-07.

[0012] As an embodiment, it further includes reagents for PCR amplification.

[0013] The present invention also provides an application of the above primer set or the above kit in identifying strain FY-07 or a bacterial cellulose product synthesized by strain FY-07.

[0014] The present invention also provides a method for identifying strain FY-07 or a bacterial cellulose product synthesized by strain FY-07, including the following steps: using the primer set or the kit to perform PCR amplification on the DNA of the strain to be tested or the bacterial cellulose product, and determining the strain type or the synthesis strain of the bacterial cellulose product according to the amplification product. If a specific identification band of 585bp appears in the amplification product, it is determined to be strain FY-07 or a bacterial cellulose product synthesized by strain FY-07.

[0015] As an embodiment, it further includes a 25μL PCR amplification system.

[0016] As an embodiment, the PCR reaction conditions are: pre-denaturation at 95°C for 10 min; 95°C: 30 - 45s, 50 - 60°C: 30 - 45s, 72°C: 45 - 60s, for 35 cycles; extension at 72°C for 10 min.

[0017] Compared with the prior art, the beneficial effects of the present invention are:

[0018] 1. The molecular markers and primer sets of the present invention can specifically and highly sensitively identify strain FY-07 from bacterial strains or bacterial cellulose products.

[0019] 2. The identification method of the present invention is rapid, accurate, requires a small amount of samples, has high efficiency, wide application range, low equipment requirements, and low cost, and is of great significance for protecting production bacterial strains, standardizing the market, preventing potential pathogenic substances from mixing into bacterial cellulose products, etc. Description of the Drawings

[0020] Figure 1 Comparison diagram of bacterial cellulose production of wild-type strain FY-07 (left) and O9K67_04420 gene knockout strain (right), where the white flocs are bacterial cellulose;

[0021] Figure 2 Amplification map of PCR products identified by molecular markers, where 3 and 15 are molecular weight markers, 1 is with the genome of strain FY-07 as the template, 2 is with sterile water as the template, 4 is with the genome of the seed liquid as the template, 5 is with the genome of the fermentation broth as the template, 6 is with the genome of the liquid after boiling bacterial cellulose products as the template, 7 is with the genome of the liquid after alkali-boiling treatment as the template, 8 is with the genome of the liquid after the first aeration as the template, 9 is with the genome of the liquid after the second aeration as the template, 10 is with the genome of the liquid after the third aeration as the template, 11 is with the genome of the liquid after the fourth aeration as the template, 12 is with the genome of the liquid after the fifth aeration as the template, 13 is with the genome of the sample after the sixth aeration treatment as the template, 14 is with the genome of the impregnating solution of the dried bacterial cellulose fermentation product as the template, 16 is with the genome of the dry film product of the bacterial cellulose facial mask as the template, 17 is with the genome of the wet film product of the bacterial cellulose facial mask as the template;

[0022] Figure 3 Detection diagram of the specificity and sensitivity of molecular marker identification, where 2 is the molecular weight marker, 1 is with the genome of strain DSM 15973 at 10 ng / μL as the template, 3 is with the genome of strain FY-07 at 10 ng / μL as the template, 4 is with the genome of strain FY-07 at 1 ng / μL as the template, 5 is with the genome of strain FY-07 at 0.1 ng / μL as the template, 6 is with the genome of strain FY-07 at 0.01 ng / μL as the template, 7 is with the genome of strain FY-07 at 0.001 ng / μL as the template, 8 is with the genome of strain FY-07 at 0.0001 ng / μL as the template. Detailed Embodiments

[0023] The present invention provides an application of a molecular marker in identifying strain FY-07 or bacterial cellulose products synthesized by strain FY-07. The preservation number of strain FY-07 is CGMCC No. 6103, and the taxonomic name is Kosakoniaoryzendophytica It has been disclosed in Patent CN102690773A. By knocking out the gene O9K67_04420 with unknown function in the present invention, the original function of this gene is lost, and it is verified that the gene O9K67_04420 is crucial for the synthesis of bacterial cellulose by strain FY-07. Therefore, the gene O9K67_04420 and partial sequences of the non-coding regions at both ends thereof are selected as molecular markers, and the nucleotide sequence of the molecular marker is as shown in SEQ ID No.1.

[0024] In the present invention, the bacterial cellulose products include foods, cosmetics, paper-making products, biomedical materials, and intermediates of bacterial cellulose products. In one embodiment, the foods include fermented soy products, fermented fruit and vegetable products, dietary fiber supplements, and functional beverages; the cosmetics include bacterial cellulose masks and bacterial cellulose creams; the paper-making products include bacterial cellulose papers; the biomedical materials include tissue engineering scaffolds of bacterial cellulose, wound dressings of bacterial cellulose, and drug sustained-release carriers of bacterial cellulose; the intermediates of bacterial cellulose products include seed liquids, fermentation broths, water-boiled treatment liquids, aerated liquids, and dried impregnation liquids.

[0025] The present invention also provides a primer set for identifying strain FY-07 or bacterial cellulose products synthesized by strain FY-07. In the present invention, the primer set includes a forward primer and a reverse primer; the sequence of the forward primer jd1 is as shown in SEQ ID No.2; the sequence of the reverse primer jd2 is as shown in SEQ ID No.3. In the present invention, the primers shown in SEQ ID No.2 and SEQ ID No.3 are designed based on the nucleotide sequence of the molecular marker shown in SEQ ID No.1 as a template.

[0026] The present invention also provides a kit for identifying strain FY-07 or bacterial cellulose products synthesized by strain FY-07, which includes the above primer set. As one embodiment, the kit further includes reagents for PCR amplification. In one embodiment, the reagents for PCR amplification are DNA template, primer set (jd1 / jd2), premix Taq polymerase, and water.

[0027] The present invention also provides a method for identifying strain FY-07 or bacterial cellulose products synthesized by strain FY-07, including the following steps: performing PCR amplification on the DNA of the strain to be tested or the bacterial cellulose product using the above primer set or the above kit, and determining the strain type or the synthesis strain of the bacterial cellulose product according to the amplification product. If a specific identification band of 585bp appears in the amplification product, it is determined to be strain FY-07 or bacterial cellulose products synthesized by strain FY-07.

[0028] In the present invention, a 25 μL PCR amplification system is further included. In the PCR amplification system, the molar concentration of the primer group sequences shown in SEQ ID No.2 and SEQ ID No.3 is 15 - 30 μM. In one embodiment, the molar concentration of the primer group is 20 μM. In the present invention, the PCR amplification system further includes premix Taq polymerase. In the present invention, the PCR reaction system is as follows: in every 25 μL reaction solution, there is 1 μL of DNA template, 1 μL each of the primer group (jd1 / jd2) with a concentration of 20 μM, 12.5 μL of premix Taq polymerase, and water is added to make up to 25 μL.

[0029] In the present invention, the PCR reaction conditions are as follows: pre-denaturation at 95°C for 10 min; 95°C: 30 - 45 s, 50 - 60°C: 30 - 45 s, 72°C: 45 - 60 s, for 35 cycles; extension at 72°C for 10 min.

[0030] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be described in detail below with reference to the embodiments. However, they should not be construed as limiting the protection scope of the present invention.

[0031] For the materials, reagents, etc. used in the following embodiments, unless otherwise specified, the reagents, consumables, etc. involved in the present invention can be obtained from commercial channels. If the specific usage conditions are not indicated, they are usually carried out according to conventional conditions or according to the conditions recommended by the company.

[0032] Example 1 Molecular Marker of Bacterial Cellulose Synthesizing Strain FY-07 and Its Identification Method

[0033] 1. Molecular Marker of Bacterial Cellulose Synthesizing Strain FY-07

[0034] By analyzing the genomic sequence of strain FY-07, it was found that there is a unique gene with unknown function, O9K67_04420, in the bacterial cellulose operon of its genome, which is speculated to be related to bacterial cellulose synthesis. Therefore, gene knockout was carried out on it to explore whether this DNA sequence is suitable as a molecular marker.

[0035] In the present invention, knocking out the O9K67_04420 gene in strain FY-07 causes this gene to lose its original function. The specific steps are as follows:

[0036] (1) Extract the genome of strain FY-07 as the PCR template;

[0037] (2)The upstream and downstream homologous arm fragments of O9K67_04420 were amplified using primer pairs KO1U and KO1L (shown in SEQ ID No.4 and SEQ ID No.5) and primer pairs KO2U and KO2L (shown in SEQ ID No.6 and SEQ ID No.7) with the FY-07 genome as a template, respectively;

[0038] SEQ ID No.4:

[0039] GGAAGCATAAAGTCTCGAGATAAATCGCACATCGATAGCGCCAAAC;

[0040] SEQ ID No.5:

[0041] ACGTTCACGGACTTCAAATTCACCGGACATTTTTAGTTTTCCAGC;

[0042] SEQ ID No.6:

[0043] GCTGGAAAACTAAAAATGTCCGGTGAATTTGAAGTCCGTGAACGT;

[0044] SEQ ID No.7:

[0045] AATTTTTTTAAGGCAGTTATTGGTGCGTGATATAGCCGACCCCAG.

[0046] (3)PCR amplification was performed using primer pairs pTSK2GU and pTSK2GL (shown in SEQ ID No.8 and SEQ ID No.9) with plasmid pTSK2 as a template to obtain a linearized pTSK2 vector, and the pTSK2 vector has chloramphenicol resistance;

[0047] SEQ ID No.8:

[0048] CACCAATAACTGCCTTAAAAAAATT;

[0049] SEQ ID No.9:

[0050] GATTTATCTCGAGACTTTATGCTTCC.

[0051] (4)The DNA fragments obtained in step (2) and step (3) were mixed at a molar ratio of 3:1 and then added together to a 10 μL 2X MultiF Seamless Assembly Mix seamless cloning system, and then incubated at 50 °C for 1 hour;

[0052] (5) Add the reaction system to the competent S17 Escherichia coli cell solution for heat shock transformation, and screen for transformants on a chloramphenicol-resistant plate;

[0053] (6) Transfer the knockout vector in the transformants obtained in step (5) to strain FY-07 by conjugation, and screen for correct transformants on a plate containing chloramphenicol and ampicillin resistance; it is difficult to transform strain FY-07 normally because it produces bacterial cellulose. In the present invention, S17 Escherichia coli is used as a medium, and the transformation is completed by the method of conjugation transfer;

[0054] (7) Inoculate the correct transformants obtained in step (6) into LB liquid medium and culture overnight at 37 °C. Take 10 μL of the bacterial solution and spread it on a plate containing chloramphenicol and ampicillin resistance, and place it at 42 °C for culture until colonies appear;

[0055] (8) Pick the colonies obtained in step (7) and perform colony PCR amplification with primer pairs KOY1U and KOY1L (as shown in SEQ ID No.10 and SEQ ID No.11) and primer pairs KOY2U and KOY2L (as shown in SEQ ID No.12 and SEQ ID No.13) respectively. Use the FY-07 genomic DNA as a template as a reference fragment. When the size of the fragment obtained by one of the two primer pairs is smaller than the reference fragment, and the difference in size is the size of the knockout fragment, it indicates that a single crossover has occurred; when the sizes of the fragments obtained by both primer pairs are smaller than the reference fragment, and the difference in size is the size of the knockout fragment, it indicates that a double crossover has occurred;

[0056] SEQ ID No.10:

[0057] TCTGGTCCGTCATAACTGATG;

[0058] SEQ ID No.11:

[0059] TACCCCGGCATAACAATGTT;

[0060] SEQ ID No.12:

[0061] CGGGGTCAGGCAAATACTAT;

[0062] SEQ ID No.13:

[0063] GCCGTCAGGTTACGTTCAAA.

[0064] Select the colonies verified as single crossovers and transfer them into LB liquid medium without resistance for overnight culture at 30°C. Then, transfer them to a new LB liquid medium at an inoculation amount of 1% for overnight culture. Take 2 μL of the obtained overnight culture and spread it on an LB plate containing 10% sucrose, and incubate it at 42°C until colonies appear. Pick the obtained colonies and perform PCR using the primer pair KOY1U and KOY2L. Using the FY-07 genome as a template as a reference fragment, when the size of the obtained fragment is smaller than the reference fragment and the difference in size is the size of the knockout fragment, it indicates that double crossover has occurred.

[0065] (9) Inoculate the double-crossover colonies obtained in step (8) into LB liquid medium containing ampicillin resistance, incubate at 42°C, and transfer and subculture 2 to 5 times to lose the plasmid. The obtained strain is the O9K67_04420 gene knockout strain.

[0066] Inoculate the obtained O9K67_04420 gene knockout strain and the wild-type strain FY-07 into LB liquid medium respectively for overnight culture at 30°C, and observe the production of bacterial cellulose. The experimental results are as Figure 1 shown. The O9K67_04420 gene knockout strain no longer produces any bacterial cellulose, while the wild-type strain FY-07 can produce a large amount of bacterial cellulose. This indicates that the O9K67_04420 gene is crucial for the production of bacterial cellulose by the strain FY-07. Therefore, this gene sequence is suitable as a molecular marker for rapid identification of the production strain FY-07 of bacterial cellulose products.

[0067] 2. Identification method of strain FY-07 using molecular markers

[0068] According to the genomic sequence of strain FY-07 and its key genes for bacterial cellulose synthesis, select the O9K67_04420 gene and partial sequences of its non-coding regions at both ends as molecular markers. The specific nucleotide sequence is shown in SEQ ID No.1, with a total length of 585 bp. The upstream and downstream identification primer sets for the molecular marker sequence are jd1 / jd2, as shown in SEQ ID No.2 and SEQ ID No.3.

[0069] SEQ ID No.1:

[0070] ATGTATGATGATTTAGGTTCTTTGGCTGGAAAACTAAAAATGTCCGGTGTCTCTTTCCAGGAAATGAATGAAGAAGATGGTGCTACTATGCAAGCAGTAACCACAACGGCAGTCACCTCCGACGCCAGCGACGAAAAACACGAAGCGGCAATCACTGAAATCCCGGCTGTCAGCCGCAAAGAAGTGAGCCCTGCCAGTGCGCCAGCAGACGTACCGGCTAACACTATCTCCTGGCCGAAAAGCAAACCGGCACCGGTCGCTGCACCAAACGCGTTCAGCACACCGGCAAATACGATTATGGAAAGCGTTGCGGCCATCAGCCGTCCGGCGGAATTTGAAGTCCGTGAACGTAATCCGGTGCGGCTGGATATGTTATTTACGGTAATTGGCAAATAATACCGTTCAGCCATGTGGGATCCACACATGGTAATAATCAGCACAATTTTTCATGACCTGCTGCAGGTGATGCTATCGGTCTATGACTAATTTGATGGCCAGCAGAATGCGTCATGATTTTTAACAGGTAACCGGAAACATTGTTATGCCGGGGTACCTTTATTATTTTCTGTGCAAGATGATACAAAC;

[0071] SEQ ID No.2:

[0072] ATGTATGATGATTTAGGTTCTTTGG;

[0073] SEQ ID No.3:

[0074] GTTTGTATCATCTTGCACAGAAAATA。

[0075] The specific identification method is as follows:

[0076] (1) Extract the genome of strain FY-07 as the DNA template;

[0077] (2) Perform PCR amplification using DNA as a template; the PCR reaction system is as follows: in each 25 μL reaction solution, it contains 1 μL of DNA template, 1 μL each of 20 μM primer sets (jd1 / jd2), 12.5 μL of premix Taq polymerase, and add water to 25 μL; the PCR reaction conditions are: pre-denaturation at 95 °C for 10 min; 95 °C: 30 - 45 s, 50 - 60 °C: 30 - 45 s, 72 °C: 45 - 60 s, for 35 cycles; extension at 72 °C for 10 min;

[0078] (3) Electrophoretically detect the amplified product using a gel imager, recover the target fragment by gel extraction, obtain the core conserved sequence and verify it by sequencing company sequencing. The sequencing result is consistent with the full-length 585 bp sequence of the molecular marker, that is, the molecular marker of strain FY-07 is obtained.

[0079] The results of electrophoretic detection are as Figure 2 shown in Lane 1 of [Figure]. Using the FY-07 genomic DNA as a template for molecular marker detection, a clear and single DNA band with a size of 585 bp can be obtained, indicating that the molecular marker is detected. The results show that this molecular marker can be used to identify strain FY-07.

[0080] Example 2 Sensitivity and Specificity of Molecular Marker Detection

[0081] The sensitivity and specificity of molecular marker detection determine its application scenarios and scope. Therefore, relevant verification was carried out on the SEQ ID No.1 sequence. Among them, strain DSM 15973, classified and named as Komagataeibacter sucrofermentan, has high-efficient bacterial cellulose production ability. The specific method is as follows:

[0082] (1) Extract the genomic DNA of strain FY-07 and strain DSM 15973 as PCR templates and detect their DNA concentrations;

[0083] (2) Adjust the genomic DNA concentrations of both strain FY-07 and strain DSM 15973 to 10 ng / μL, and use the 10 ng / μL genomic DNA of strain FY-07 as the mother solution for gradient dilution until 0.0001 ng / μL;

[0084] (3)Using 1 μL of each gradient-diluted FY-07 bacterial liquid sample and 1 μL of DSM 15973 bacterial liquid as templates for PCR amplification, the PCR amplification system is as follows: in each 25 μL reaction solution, it contains DNA template: 1 μL, primer pair (jd1 / jd2) at 20 μM: 1 μL each, premix Taq polymerase: 12.5 μL, and add water to 25 μL; the PCR reaction conditions are: pre-denaturation at 95°C for 10 min; 95°C: 30 - 45 s, 50 - 60°C: 30 - 45 s, 72°C: 45 - 60 s, for 35 cycles; extension at 72°C for 10 min;

[0085] (4)Electrophoretically detect the amplification products using a gel imager to observe whether each sample obtains a clear and single DNA band with a size of 585 bp.

[0086] The results of the electrophoretic detection are as Figure 3 shown. In the first lane, using the genomic DNA of the bacterial cellulose-producing strain DSM 15973 at 10 ng / μL as a template, the target band was not obtained; in the third lane, using the genomic DNA of FY-07 at 10 ng / μL as a template, a bright and single target band could be obtained, indicating that this molecular marker can specifically identify the strain FY-07 and has high specificity. From the third lane to the eighth lane, using the genomic DNA of the gradient-diluted strain FY-07 as a template, when the dilution degree of the FY-07 genomic DNA template is lower than 0.01 ng / μL, the target band cannot be obtained, indicating that the template detection threshold of this molecular marker is 0.01 ng / μL and the sensitivity is good.

[0087] Example 3 Detection of the process product - seed liquid of bacterial cellulose fermentation production by strain FY-07 using molecular markers

[0088] 1. Collect the seed liquid:

[0089] (1)Streak the bacterial liquid of the bacterial cellulose-producing strain FY-07 on an LB solid medium containing 0.1% congo red and culture it at 30°C for 24 h to obtain well-grown FY-07 single colonies;

[0090] (2)Pick the larger red FY-07 single colonies and streak them densely on an LB solid slant medium and culture it at 30°C for 24 h to obtain a bacterial cellulose membrane containing live FY-07 strains;

[0091] (3)Pick the bacterial cellulose membrane containing live FY-07 strains and streak it densely again on an LB solid slant medium and culture it at 30°C for 24 h to obtain a culture medium surface containing a large number of live FY-07 strains and bacterial cellulose membranes;

[0092] (4) Rinse the surface of the medium with 100 mL of sterile distilled water until the live FY-07 strain and the bacterial cellulose membrane on the surface of the medium are detached into the sterile distilled water. Mix the distilled water containing the live FY-07 strain and the bacterial cellulose membrane to obtain a seed solution.

[0093] 2. Perform PCR identification on the seed solution:

[0094] Take 2 μL of the seed solution sample as the PCR template for PCR identification of molecular markers. The PCR amplification system is as follows: in each 25 μL reaction solution, it contains DNA template: 2 μL, primer pair (jd1 / jd2) of 20 μM: 1 μL each, premix Taq polymerase: 12.5 μL, add water to 25 μL; The PCR reaction conditions are: pre-denaturation at 95°C for 10 min; 95°C: 30 - 45 s, 50 - 60°C: 30 - 45 s, 72°C: 45 - 60 s, 35 cycles; extension at 72°C for 10 min;

[0095] Detect the amplified product by gel imaging electrophoresis, and the results are shown in Figure 2 . According to the molecular marker design, when the molecular marker is detected by the above method, it indicates that the sample of this process comes from the fermentation production process of FY-07, while when the molecular marker is not detected, it indicates that the sample of this process does not come from the fermentation production process of FY-07.

[0096] Example 4 Detection of the process product - fermentation broth of bacterial cellulose fermented by strain FY-07 using molecular markers

[0097] 1. Collect the fermentation broth

[0098] Inoculate the seed solution of Example 3 into 90 mL of HS-XGK medium at an inoculation amount of 1%, and at the same time add 10 mL of sterile 25% glucose carbon source to the medium, and ferment at 30°C for 24 h to obtain a fermentation broth containing a bacterial cellulose membrane.

[0099] 2. Perform PCR identification on the fermentation broth:

[0100] Same as the identification method in Example 3, and the results are shown in Figure 2 .

[0101] Example 5 Detection of the process product - treatment solution of boiled bacterial cellulose product fermented by strain FY-07 using molecular markers

[0102] 1. Collect the treatment solution of the boiled bacterial cellulose product

[0103] The bacterial cellulose membrane of Example 4 was fished out of the culture medium and placed in 300 mL of sterile water for treatment at 100 °C for 0.5 h to remove most of the bacteria and impurities, obtaining a treatment solution of the boiled bacterial cellulose product.

[0104] 2. Perform PCR identification on the treatment solution:

[0105] Using the same identification method as in Example 3, the results are shown in Figure 2 .

[0106] Example 6 Detection of Process Products of Bacterial Cellulose Fermented by Strain FY-07 Using Molecular Markers - Alkaline Boiling Treatment Solution

[0107] 1. Collect the alkaline boiling treatment solution

[0108] The treatment solution of the boiled bacterial cellulose product of Example 5 was treated with 0.5 M NaOH solution at 100 °C for 0.5 h to further remove the bacteria and residual culture medium in the bacterial cellulose membrane, obtaining the alkaline boiling treatment solution.

[0109] 2. Perform PCR identification on the alkaline boiling treatment solution:

[0110] Using the same identification method as in Example 3, the results are shown in Figure 2 .

[0111] Example 7 Detection of Process Products of Bacterial Cellulose Fermented by Strain FY-07 Using Molecular Markers - Liquid after Aeration

[0112] 1. Collect the liquid after the first, second, third, fourth, fifth, and sixth aerations

[0113] The membrane after alkaline boiling treatment in Example 6 was placed in sterile water for aeration treatment, and the water was changed regularly. The aeration operation was repeated until the pH value of the bacterial cellulose membrane was neutral to obtain the wet bacterial cellulose membrane. The liquid after each operation was retained for molecular marker identification;

[0114] 2. Perform PCR identification on the liquid after each aeration:

[0115] Using the same identification method as in Example 3, the results are shown in Figure 2 .

[0116] Example 8 Detection of Process Products of Bacterial Cellulose Fermented by Strain FY-07 Using Molecular Markers - Impregnation Solution of Fermentation Product after Drying

[0117] 1. Collect the impregnation solution of the fermentation product after drying

[0118] The wet bacterial cellulose membrane of Example 7 was dried to obtain the dry bacterial cellulose membrane. Part of the dry membrane sample was placed in sterile water for soaking to obtain the impregnation solution of the bacterial cellulose fermentation product after drying.

[0119] 2. PCR identification of the impregnation solution of the fermented product after drying:

[0120] Using the same identification method as in Example 3, the results are shown in Figure 2 .

[0121] The electrophoresis results of Examples 3-8 are as shown in Figure 2 lanes 3 to 11. Molecular marker detection was performed using the liquid samples of each process during the production of bacterial cellulose by FY-07 fermentation as templates, and a clear and single DNA band with a size of 585 bp could be obtained, indicating that the molecular marker was detected. Among them, the molecular marker was not detected in lane 7 because the DNA molecules in the sample were damaged due to the too high pH value of the sample, indicating that the molecular marker detection method is not applicable to the sample after alkali boiling of the bacterial cellulose product; the DNA bands in lanes 13 and 14 were weak, indicating that most of the bacteria and impurities were completely treated, resulting in almost no detection of the molecular marker in the treated water and dried samples, but it does not affect the applicability of the molecular marker in the remaining process samples; no DNA band could be detected when using sterile water as the template. The results show that this molecular marker can be used to identify strain FY-07 and all processed products and treatment solutions in the production process prepared with this strain as the production strain.

[0122] Example 9 Detection of the bacterial cellulose mask product produced by strain FY-07 fermentation using molecular markers

[0123] (1) Take some dry and wet film products of the bacterial cellulose mask produced by FY-07 fermentation and soak them in sterile water, and take some of the soaking solution as the PCR template for amplification; the PCR amplification system is: in each 25 μL reaction solution, it contains DNA template: 2 μL, primer pair (jd1 / jd2) of 30 μM: 1 μL each, premix Taq polymerase: 12.5 μL, and add water to 25 μL; the PCR reaction conditions are: pre-denaturation at 95 °C for 10 min; 95 °C: 30 - 45 s, 50 - 60 °C: 30 - 45 s, 72 °C: 45 - 60 s, 35 cycles; extension at 72 °C for 10 min;

[0124] (2) Electrophoresis detection of the amplification products was performed using a gel imager. According to the molecular marker design, when the molecular marker is detected by the above method, it indicates that the production strain of this bacterial cellulose mask product is FY-07, and when the molecular marker is not detected, it indicates that the production strain of this product is not FY-07.

[0125] The experimental results are as shown in Figure 2 lanes 16 and 17. Molecular markers can be detected for the dry and wet film products of the bacterial cellulose mask produced by strain FY-07 fermentation, indicating that this molecular marker is applicable to the identification of the production strain of the bacterial cellulose mask product.

[0126] In summary, the present invention provides a method for identifying the production strain from bacterial cellulose products or solid and liquid substances in the fermentation process using molecular markers. This method is rapid, accurate, requires a small amount of samples, has high efficiency, wide applicability, low equipment requirements, and low cost, and is of great significance for protecting the production strain, standardizing the market, and preventing potential pathogenic substances from mixing into bacterial cellulose products, etc.

[0127] The above are only embodiments of the present invention, and do not limit the patent scope of the present invention accordingly. Any equivalent structural or equivalent process transformation made using the content of the specification of the present invention, or directly or indirectly applied in other related technical fields, shall be similarly included in the patent protection scope of the present invention.

Claims

1. Use of a reagent for detecting molecular markers in identifying strain FY-07, characterized in that, The nucleotide sequence of the molecular marker is as shown in SEQ ID No.1; The preservation number of the strain FY-07 is CGMCC No.6103.

2. Use of a primer set in identifying strain FY-07, characterized in that, The primer set includes a forward primer and a reverse primer; the sequence of the forward primer is as shown in SEQ ID No.2; the sequence of the reverse primer is as shown in SEQ ID No.

3.

3. Use of a kit in identifying strain FY-07, characterized in that, The kit includes the primer set described in claim 2.

4. The application according to claim 3, characterized in that, It also includes reagents for PCR amplification.

5. A method for identifying strain FY-07, characterized in that, It includes the following steps: using the primer set in the application described in claim 2 or the kit in the application described in claim 3 to perform PCR amplification on the DNA of the strain to be tested, and determining the strain type according to the amplification product. If a specific identification band of 585bp appears in the amplification product, it is determined to be the strain FY-07.

6. The identification method according to claim 5, characterized in that It also includes a 25μL PCR amplification system.

7. The identification method according to claim 5, wherein The PCR reaction conditions are: pre-denaturation at 95°C for 10 min; 95°C: 30 - 45 s, 50 - 60°C: 30 - 45 s, 72°C: 45 - 60 s, for 35 cycles; extension at 72°C for 10 min.

Citation Information

Patent Citations

  • Enterobacteria strain FY-07 and method thereof for producing bacterial cellulose by static liquid submerged fermentation

    CN102690773A

  • Primer set for detecting enterobacter sp. having cellulose synthase function, and method for detecting enterobacter sp.

    JP2015139442A