Composition for detecting reproductive tract pathogens, preparation method and application thereof

Abstract

This invention provides a composition for detecting genital tract pathogens, its preparation method, and its application, belonging to the field of nucleic acid or microbial assays or tests. The composition provided by this invention includes a forward primer, a reverse primer, and a probe targeting seven genital tract pathogens. The forward and reverse primers are used to amplify the target DNA. A blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide from the 3' end of the reverse primer, where 4 ≤ i ≤ 8. The probe is labeled with a fluorescent group and a second quenching group at both ends, and a first quenching group in the middle. A portion of the probe's sequence is identical to a portion of the reverse primer's sequence. The composition provided by this invention enables multiplex qualitative detection of seven genital tract pathogens: Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma urealyticum, Ureaplasma microsporum, Mycoplasma hominis, Mycoplasma genitalium, and herpes simplex virus type 2.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid or microbial assay or testing technology, and more particularly to compositions for detecting reproductive tract pathogens, their preparation methods and applications. Background Technology

[0002] Sexually transmitted diseases (STDs) refer to a group of infectious diseases that are mainly transmitted through sexual contact, similar sexual behaviors, and indirect transmission. More than 30 STDs have been identified worldwide, among which the representative ones include: Mycoplasma hominis, Ureaplasma urealyticum, Neisseria gonorrhoeae, Chlamydia trachomatis, Herpes simplex virus type 2, Candida albicans, Haemophilus ducreyi, Trichomonas vaginalis, Mycoplasma genitalium, Treponema pallidum, and Klebsiella pneumoniae.

[0003] Sexually transmitted diseases (STDs) are a group of common infectious diseases prevalent worldwide. Over the past 20 years, they have shown a trend of expanding prevalence, lower age of onset, increased number of asymptomatic or mildly symptomatic patients, and a rise in drug-resistant strains, making them a public health problem that all of humanity must face. STDs often present with no obvious symptoms or lack of symptoms; timely detection and diagnosis are crucial for accurate diagnosis and treatment. Molecular detection methods, with their advantages of zero window period and high sensitivity, are the gold standard for detecting most pathogens.

[0004] Molecular diagnostic methods help improve the speed and accuracy of pathogen gene detection, which is significant for infection control, prevention, and treatment in hospitals and community settings. Currently, the main molecular diagnostic method is polymerase chain reaction (PCR), including conventional PCR, allele PCR, real-time quantitative PCR, PCR-Sanger sequencing, PCR-gene chip technology, and PCR-guided hybridization. Among these, real-time quantitative PCR can simultaneously amplify several target DNA sequences in a single test tube using multiple sets of primers and probes. Since its introduction, this technology has been widely adopted in many fields of nucleic acid detection, such as mutation identification, transgenic detection, diagnosis of hereditary diseases, and pathogen identification, due to its significant advantages in sensitivity and accuracy. However, for the simultaneous detection of multiple pathogens, interference between multiple primer sets can lead to false positives, affecting detection and making it impossible to effectively detect or differentiate multiple pathogens. Furthermore, the construction of multiplex PCR systems is usually limited by the number of fluorescence channels in the instrument; constructing systems in separate tubes increases reagent costs and is more cumbersome. Summary of the Invention

[0005] This invention provides a composition for detecting reproductive tract pathogens and a method for preparing the same, enabling the detection of multiple reproductive tract pathogens in a single tube.

[0006] In a first aspect, the present invention provides a composition for detecting genital tract pathogens, the composition comprising a first composition for detecting Neisseria gonorrhoeae, a second composition for detecting Chlamydia trachomatis, a third composition for detecting Ureaplasma urealyticum, a fourth composition for detecting Ureaplasma parvum, a fifth composition for detecting Mycoplasma hominis, a sixth composition for detecting Mycoplasma genitalium, and a seventh composition for detecting herpes simplex virus type 2.

[0007] The first composition, the second composition, the third composition, the fourth composition, the fifth composition, the sixth composition, and the seventh composition all include a forward primer, a reverse primer, and a probe;

[0008] The forward and reverse primers are used to amplify the target DNA; a blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide from the 3' end of the reverse primer, where 4≤i≤8 and i is a positive integer;

[0009] The probe satisfies the following conditions:

[0010] 1) The probe is a single-stranded nucleic acid molecule;

[0011] 2) The first nucleotide at the first end of the probe is labeled with a fluorescent group, the nth nucleotide from the first end of the probe is labeled with a first quenching group, and the first nucleotide at the second end of the probe is labeled with a second quenching group, where 9≤n≤30, n is a positive integer, and n is less than the total number of nucleotides in the probe.

[0012] 3) Partial nucleotide sequence of the probe is identical to the nucleotide sequence from the 1st nucleotide to the ith nucleotide starting from the 3' end of the reverse primer;

[0013] 4) The probe does not bind to the forward primer;

[0014] 5) The probe does not bind to the reverse primer.

[0015] In this invention, the target DNA refers to a DNA fragment corresponding to a target nucleic acid fragment. The target nucleic acid fragment can be DNA or RNA. The target nucleic acid fragment is a nucleic acid fragment existing in a specific region of the gene of the pathogen to be detected, possessing a certain ability to serve as a detection target. This nucleic acid fragment can be significantly different from the gene sequences of other pathogens or the sample itself. For pathogens whose genetic material is DNA, the target nucleic acid fragment is the target DNA; for pathogens whose genetic material is RNA, the target DNA is obtained by reverse transcription of the target nucleic acid fragment.

[0016] In this invention, the pathogen refers to an organism or substance capable of causing disease in a host (such as a human, animal, or plant), such as viruses, chlamydia, rickettsia, mycoplasma, bacteria, spirochetes, fungi, and other microorganisms and parasites. In one specific embodiment, the pathogen is a microorganism. Further, the genetic material of the microorganism may be DNA.

[0017] In this invention, the target DNA is double-stranded DNA. The forward primer specifically binds to one strand of the target DNA, and the reverse primer specifically binds to the other strand. An extension reaction is carried out using the double-stranded DNA as a template under the action of DNA polymerase. Both the forward and reverse primers are single-stranded DNA.

[0018] In this invention, the design principles of the forward and reverse primers are the same as or similar to those of conventional forward and reverse primers in the art. The difference is that, in this invention, a blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide from the 3' end of the reverse primer, where 4≤i≤8, and i is a positive integer (i is one of 4, 5, 6, 7, and 8), and i is less than the total number of nucleotides in the reverse primer. When the above forward and reverse primers are used to amplify the target DNA by PCR, the forward primer binds to the template strand of the target DNA and extends. The extension stops when the blocking group is encountered, resulting in a double-stranded amplification product in which one strand is shorter than the other.

[0019] Furthermore, the total number of nucleotides in the reverse primer can be 18-35 nucleotides.

[0020] In this invention, the probe can be a single-stranded DNA molecule.

[0021] In this invention, the first end can be the 5' end of the probe, and correspondingly, the second end is the 3' end of the probe; the first end can also be the 3' end of the probe, and correspondingly, the second end is the 5' end of the probe.

[0022] In this invention, n can be any one of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30.

[0023] In this invention, a portion of the nucleotide sequence of the probe is identical to the nucleotide sequence from the first nucleotide to the i-th nucleotide starting from the 3' end of the reverse primer. Further, the nucleotide sequence in the probe identical to that of the reverse primer should be located close to both ends of the probe to facilitate binding with the shorter DNA strand in the double-stranded amplification product, thereby increasing the binding rate. Even further, the nucleotide sequence in the probe identical to that of the reverse primer is located close to the 3' end of the probe, i.e., between the nucleotides in the probe modified by the two quencher groups.

[0024] In this invention, the aforementioned binding means that the probe will not use either the forward or reverse primers as templates for PCR amplification. That is, in the absence of target DNA or the sample to be tested containing the corresponding pathogen, the probe remains in a coiled state, and the fluorescent signal emitted by the fluorescent group labeled at the first end of the probe will be absorbed by any one of the quenching groups, thus making the corresponding fluorescent signal undetectable. When at least two forward and reverse primers are present in the PCR system, the probe will also not bind to primer pairs targeting other target DNAs.

[0025] The composition described above has a probe length of 20-60 nt and a GC content of 40%-60%.

[0026] In the composition described above, the blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer, and C12 Spacer.

[0027] In the composition described above, the fluorescent group is selected from at least one of FAM (carboxyfluorescein), JOE (carboxydimethylfluorescein), TAMRA (tetramethylrhodamine), ROX (rhodamine X), CY3, CY5, VIC, and HEX (hexachlorofluorescein).

[0028] In the composition described above, the quenching group is selected from at least one of BHQ1 and BHQ2.

[0029] In one specific embodiment, the first composition includes a first forward primer, a first reverse primer, and a first probe for detecting Neisseria gonorrhoeae; the second composition includes a second forward primer, a second reverse primer, and a second probe for detecting Chlamydia trachomatis; the third composition includes a third forward primer, a third reverse primer, and a third probe for detecting Ureaplasma urealyticum; the fourth composition includes a fourth forward primer, a fourth reverse primer, and a fourth probe for detecting Ureaplasma parvum; the fifth composition includes a fifth forward primer, a fifth reverse primer, and the first probe for detecting Mycoplasma hominis; the sixth composition includes a sixth forward primer, a sixth reverse primer, and the fourth probe for detecting Mycoplasma genitalium; and the seventh composition includes a seventh forward primer, a seventh reverse primer, and the second probe for detecting herpes simplex virus type 2.

[0030] The first forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:1;

[0031] The second forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:3;

[0032] The third forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:5;

[0033] The fourth forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:7;

[0034] The fifth forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:9;

[0035] The sixth forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:11;

[0036] The seventh forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:13;

[0037] The general structural formula of the reverse primer is shown in Formula 1:

[0038] 5'-n(a)-Yn(b)-3' Equation 1

[0039] In Equation 1, n(a) and n(b) are polynucleotide fragments with different nucleotide sequences, and Y is a blocking group;

[0040] In the first reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:2, and the nucleotide sequence of n(b) is GCCGTA;

[0041] In the second reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:4, and the nucleotide sequence of n(b) is GCAGGA;

[0042] In the third reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:6, and the nucleotide sequence of n(b) is AAGACC;

[0043] In the fourth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:8, and the nucleotide sequence of n(b) is GACGG;

[0044] In the fifth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:10, and the nucleotide sequence of n(b) is CTTTAC;

[0045] In the sixth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:12, and the nucleotide sequence of n(b) is GGCCAA;

[0046] In the seventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:14, and the nucleotide sequence of n(b) is CTCCA;

[0047] The first probe is a single-stranded DNA with the nucleotide sequence SEQ ID NO:17, and the first nucleotide of SEQ ID NO:17 is labeled with a first fluorescent group, the 25th nucleotide is labeled with a first quenching group, and the 45th nucleotide is labeled with a second quenching group.

[0048] The second probe is a single-stranded DNA with the nucleotide sequence SEQ ID NO:18, and the first nucleotide of SEQ ID NO:18 is labeled with a second fluorescent group, the 27th nucleotide is labeled with a third quenching group, and the 46th nucleotide is labeled with a fourth quenching group.

[0049] The third probe is a single-stranded DNA with the nucleotide sequence SEQ ID NO:19, and the first nucleotide of SEQ ID NO:19 is labeled with a third fluorescent group, the 27th nucleotide is labeled with a fifth quenching group, and the 43rd nucleotide is labeled with a sixth quenching group.

[0050] The fourth probe is a single-stranded DNA with the nucleotide sequence SEQ ID NO:20, wherein the first nucleotide of SEQ ID NO:20 is labeled with a fourth fluorescent group, the 26th nucleotide is labeled with a seventh quencher group, and the 40th nucleotide is labeled with an eighth quencher group.

[0051] In this invention, the reproductive tract pathogens include Neisseria gonorrhoeae (Neisseria gonorrhoeae). Neisseria gonorrhoeae NG), Chlamydia trachomatis ( Chlamydia trachomatis CT), Ureaplasma urealyticum ( Ureaplasma urealyticum , UUR), Ureaplasma parvum ( Ureaplasma parvum UPA), Mycoplasma hominis ( Mycoplasma hominis Mh), herpes simplex virus type 2 (M ...) Herpes simplex virus type 2 HSV-2) and Mycoplasma genitalium ( Mycoplasma genitalium At least one of (Mg).

[0052] The principles involved in this invention are as follows: Figure 1 Specifically, when the target double-stranded DNA is present, the forward and reverse primers provided by this invention bind to the target DNA and extend to generate a pre-amplified product, which includes a shorter DNA strand and a longer DNA strand. Simultaneously, the probe binds to the shorter DNA strand in the pre-amplified product through complementary base pairing and continues PCR amplification along the 5' to 3' direction of this DNA strand. As PCR amplification proceeds, the probe structure changes (mainly the distance between the fluorophore and the quencher group), preventing the quencher group from absorbing the fluorescent signal emitted by the fluorophore, thus allowing the fluorescence signal to be detected by the instrument. When the target double-stranded DNA is absent, the probe remains coiled, and the quencher group absorbs the fluorescent signal, making it undetectable. By observing the presence or absence of a fluorescent signal, the presence of the target double-stranded DNA can be determined, confirming whether the sample contains the corresponding pathogen. Due to limitations in the number of fluorescence channels in the instrument, the probe provided by this invention can simultaneously detect two target pathogens. Through melting curve analysis, combined with different Tm values ​​of the target PCR products, qualitative detection of the two pathogens can be achieved.

[0053] The above detection process is illustrated using Chlamydia trachomatis as an example: The nucleotide sequence of the target DNA for detecting Chlamydia trachomatis provided by this invention is shown in SEQ ID NO:22; for the above target DNA, the nucleotide sequence of the forward primer provided by this invention is 5'- GGTAGATCCGATATCAGCAAAAGTGCTCC-3' (SEQ ID NO:3), and the nucleotide sequence of the reverse primer is 5'- GTGCCACCTTATTTGCTGCAGGA-3' (the first 17 nucleotides are SEQ ID NO:4), and a blocking group is connected between the 17th nucleotide (T) and the 18th nucleotide (G) from the 5' end. The nucleotide sequence of the probe is 5'- CCACGCCACGTCAGACAAACGAACGCTG GCAGGACCACTCCCTCCA -3' (SEQ ID NO:18), with the first nucleotide (C) from the 5' end labeled with a fluorescent group, the 27th nucleotide (T) labeled with a first quencher group, and the 46th nucleotide (A) labeled with a second quencher group. When the target DNA is amplified by PCR using the above forward and reverse primers, the resulting pre-amplified product includes the nucleotide sequence 5'-GGTAGATCCGATATCAGCAAAAGTGCTCCTAAAGGAAGATTCCTTCGGTA. TC CTGC The 3' DNA strand (SEQ ID NO:29) has nucleotides 1 to 6 from its 3' end (as underlined in the above sequence) that bind to nucleotides 29 to 34 from the 5' end of the probe (as underlined in the above sequence) through complementary pairing. Because the 3' end of the probe is labeled with a fluorescent quencher group, it cannot trigger the extension reaction of DNA polymerase. Therefore, the DNA strand acts as a primer, and the probe is used as a template for extension to perform secondary PCR amplification. The second amplification product forms a double-stranded structure with the probe. The fluorescent signal emitted by the fluorescent group cannot be absorbed by the quencher group, and the fluorescent signal is detected, indicating the presence of target DNA.

[0054] The composition described above further includes a composition for detecting an internal reference gene. In one specific embodiment, the internal reference gene may be target DNA corresponding to human β-actin (β-actin). Further, the nucleotide sequence of the target DNA corresponding to human β-actin is SEQ ID NO:28. Based on this target DNA, the composition for detecting the target DNA corresponding to human β-actin includes an eighth forward primer, an eighth reverse primer, and a probe, wherein the nucleotide sequence of the eighth forward primer is SEQ ID NO:15; the structure of the eighth reverse primer is shown in Formula 1, and the nucleotide sequence of n(a) is SEQ ID NO:16, and the nucleotide sequence of n(b) is CACGA; the probe is a third probe.

[0055] In the composition described above, the molar ratio of the forward primer to the reverse primer is greater than or equal to 3:1, which improves the amplification product chain capable of binding to the probe. Further, the molar ratio of the forward primer to the reverse primer is 3:1-10:1, specifically 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 5.5:1, 6:1, 6.5:1, 7:1, 7.5:1, 8:1, 8.5:1, 9:1, 9.5:1, 10:1, or any combination thereof. Even further, the molar ratio of the forward primer to the reverse primer is 10:1.

[0056] It should be noted that, in this invention, forward primers and reverse primers refer to primer pairs that target the same target DNA. For example, the molar ratio of the first forward primer to the first reverse primer is greater than or equal to 3:1. This invention does not impose any particular limitation on the molar ratio of the first forward primer to the second reverse primer.

[0057] In the composition described above, the molar concentration of the forward primer in the composition is 90-1000 nM, specifically 90 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1000 nM, or any combination thereof.

[0058] In the composition described above, the molar concentration of the reverse primer in the composition is 30-100 nM, specifically 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM, or any combination thereof.

[0059] In the composition described above, the molar concentration of the probe in the composition is 100-1000 nM, specifically 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1000 nM, or any combination thereof.

[0060] It should be noted that the concentrations of the aforementioned forward primer, reverse primer, and probe are all concentrations of one primer and one probe, that is, the concentration of the first forward primer in the composition is 90-1000 nM, the concentration of the first reverse primer in the composition is 30-100 nM, and the concentration of the first probe in the composition is 100-1000 nM.

[0061] In a second aspect, the present invention provides a method for preparing any of the compositions described above, comprising:

[0062] S1. Provide the forward primer, reverse primer, and probe in the above composition;

[0063] S2. The forward primer, reverse primer and probe are combined to obtain the composition.

[0064] As described above, the forward primer, reverse primer, and probe can all be synthesized using conventional methods in the art.

[0065] Thirdly, the present invention provides a kit for detecting reproductive tract pathogens, comprising any of the compositions described above.

[0066] Fourthly, the present invention provides applications of any of the compositions described above and / or the kits described above, wherein the applications are selected from any one of A1)-A2):

[0067] A1) Application in detecting reproductive tract pathogens;

[0068] A2) Application in the preparation of products for detecting reproductive tract pathogens.

[0069] Fifthly, the present invention provides a method for detecting reproductive tract pathogens, comprising:

[0070] Prepare the DNA from the sample to be tested;

[0071] The DNA was subjected to real-time quantitative PCR using any of the compositions or kits described above to determine whether the sample to be tested contained reproductive tract pathogens.

[0072] As described above, the DNA can be extracted using a conventional DNA extraction kit in the art.

[0073] As described above, depending on the fluorescent group carried by the probe, it can first be determined whether the sample contains the pathogen to be detected by detecting the fluorescence signal. For example, if the corresponding fluorescence signal is detected, it indicates that the sample contains the pathogen to be detected; if the corresponding fluorescence signal is not detected, it indicates that the sample does not contain the pathogen to be detected. For the determination of Neisseria gonorrhoeae and Mycoplasma hominis, when a fluorescence signal is present with the first probe, the Tm value can be used to determine whether the sample contains Neisseria gonorrhoeae and / or Mycoplasma hominis.

[0074] The methods described above may have a direct purpose other than disease diagnosis and / or disease treatment. The applications or methods described above are non-disease diagnostic applications or methods. The applications or methods described above do not have the direct purpose of obtaining disease diagnosis results or health status of living human or animal bodies.

[0075] The methods described above are applications or methods not intended for disease treatment. These methods do not have the direct purpose of restoring or restoring health or reducing suffering in a living human or animal body.

[0076] As described above, the sample to be tested can be a sample from a non-living human or animal body, such as an environmental sample (e.g., air), clothing or towels, or animal tissues and / or organs used as food.

[0077] This invention provides forward and reverse primers targeting seven common reproductive tract pathogens, as well as four universal probes. The probes emit fluorescence by altering their conformation after the target sequence of the amplified product hybridizes with the probe. The presence and type of pathogen are determined by combining the Tm value. This invention enables multiplex qualitative detection of seven reproductive tract pathogens in a single tube, effectively avoiding false positives in multiplex detection and providing technical support for disease diagnosis and prevention. Attached Figure Description

[0078] Figure 1 This is a schematic diagram illustrating the principle of the composition provided by the present invention in PCR amplification;

[0079] Figure 2 The results of PCR detection of template plasmids containing Chlamydia trachomatis target DNA using the forward primer, reverse primer and second probe provided in Example 1;

[0080] Figure 3 The results of PCR detection of template plasmids containing target DNA of herpes simplex virus type 2 using the forward primer, reverse primer and second probe targeting herpes simplex virus type 2 provided in Example 1;

[0081] Figure 4 The results of PCR detection of template plasmids containing target DNA of Mycoplasma genitalium using the forward primer, reverse primer and fourth probe provided in Example 1;

[0082] Figure 5 The results of PCR detection of template plasmids containing Ureaplasma microphylla target DNA using the forward primer, reverse primer and fourth probe provided in Example 1;

[0083] Figure 6 The results of PCR detection of template plasmids containing human β-actin target DNA using the forward primer, reverse primer and third probe targeting human β-actin provided in Example 1;

[0084] Figure 7 The results of PCR detection of template plasmids containing Ureaplasma urealyticum target DNA using the forward primer, reverse primer, and third probe provided in Example 1;

[0085] Figure 8The results of PCR detection of template plasmids containing Neisseria gonorrhoeae target DNA using the forward primer, reverse primer and first probe targeting Neisseria gonorrhoeae provided in Example 1;

[0086] Figure 9 The results of PCR detection of template plasmid containing Mycoplasma hominis target DNA using the forward primer, reverse primer and first probe provided in Example 1;

[0087] Figure 10 The results of octet PCR detection using the composition provided in Example 1 on seven template plasmids containing target DNA of reproductive tract pathogens and template plasmids containing internal reference genes;

[0088] Figure 11 The results of multiplex PCR detection of the negative template plasmid using the composition provided in Example 1;

[0089] Figure 12 The results of multiplex PCR detection of the negative template plasmid using the composition provided in Comparative Example 1;

[0090] Figure 13 The results are for multiplex PCR detection of a positive template plasmid containing Neisseria gonorrhoeae target DNA using the composition provided in Comparative Example 1. Detailed Implementation

[0091] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, embodiments of this invention, and should not be construed as limiting the invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention. In the description of this invention, it should be understood that the terminology used is for descriptive purposes only and should not be construed as indicating or implying relative importance.

[0092] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0093] Example 1: PCR detection of seven reproductive tract pathogens based on the primer and probe composition provided by the present invention.

[0094] Step 1: Provide a plasmid containing the target DNA, wherein Neisseria gonorrhoeae (Neisseria gonorrhoeae) Neisseria gonorrhoeaeThe nucleotide sequence of the target DNA corresponding to (NG) is SEQ ID NO:21; Chlamydia trachomatis ( Chlamydia trachomatis The nucleotide sequence of the target DNA corresponding to CT is SEQ ID NO:22; Ureaplasma urealyticum (Ureaplasma urealyticum) The nucleotide sequence of the target DNA corresponding to UUR is SEQ ID NO:23; Ureaplasma microphylla (UUR) Ureaplasma parvum The nucleotide sequence of the target DNA corresponding to UPA is SEQ ID NO:24; Mycoplasma hominis ( Mycoplasma hominis The nucleotide sequence of the target DNA corresponding to Mh is SEQ ID NO:25; Mycoplasma genitalium ( Mycoplasma genitalium The nucleotide sequence of the target DNA corresponding to (Mg) is SEQ ID NO:26; herpes simplex virus type 2 ( Herpes simplex virus type 2, The nucleotide sequence of the target DNA corresponding to HSV-2 is SEQ ID NO:27; human β-actin ( beta-actin, β-actin The nucleotide sequence of the target DNA corresponding to ) is SEQ ID NO:28;

[0095] SEQ ID NO:21:

[0096] 5'-CCGTTGGCTGCAAGTGCCGATTTATGCGGGGCTGACTGTTGTACGGGCGATTTGTGCCTATAAG-3';

[0097] SEQ ID NO:22:

[0098] 5'-GGTAGATCCGATATCAGCAAAAGTGCTCCTAAAGGAAGATTCCTTCGGTATCCTGCAGCAAATAAGGTGGCAC-3';

[0099] SEQ ID NO:23:

[0100] 5'-CCAATCTTTGAACAAATCGTAGCAGGTGCTTGTGGTCTTAAGATTCACGAAGACTGAGGGG-3';

[0101] SEQ ID NO:24:

[0102] 5'-GTACCAGGGGCAATTAATTTCGCTAGTGGTGAAATTGTGATGAATGAAGGTAGAGAGGCAAAAGTAATTAGTATTAAAAATACTGGGGACCGTCCTATACAAGTTGGATCACATTTTC-3';

[0103] SEQ ID NO:25:

[0104] 5'-ACATAGGTCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTTCGTAGGCTGTTTGTT-3';

[0105] SEQ ID NO:26:

[0106] 5'-GCGATTGTAACCCCATCGTTAGTAATTAATGGGTTTGCAAATTTTCTCTCTAAAATAACATTTTGGCCTTTAGGACCTACTGTTACT-3';

[0107] SEQ ID NO:27:

[0108] 5'- ACGGCCAAGTACGTGCGGAACAACATGGAGACCACCGCGTTTCACCGGGACGACCACGAGACCGACATGGAGCTCAAGCCGGCGAAGGT-3';

[0109] SEQ ID NO:28:

[0110] 5'- TGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGAC-3'.

[0111] At the same time, a negative control plasmid is provided. The negative control plasmid does not contain the above-mentioned target DNA sequence, and the remaining sequences are the same as those of the plasmid containing the target DNA.

[0112] Step 2: Based on the target DNA described above, provide the primer and probe composition shown in Table 1. According to the reaction system shown in Table 2, mix the template plasmid containing the target DNA, the forward primer, reverse primer, probe, and PCR reaction premix solution to obtain a PCR reaction system with a total volume of 25 μL. The PCR reaction premix solution includes DEPC-treated water, Tris buffer (pH 9.0), dATP, dCTP, dGTP, dUTP, KCl, MgCl2, (NH4)2SO4, and trehalose.

[0113]

[0114]

[0115] In Table 1, iSpC3 indicates the insertion of a blocking group C3 spacer into the two adjacent nucleotides of the reverse primer; the sequence corresponding to the reverse primer only includes the sequence located upstream of the C3 spacer at 5'. 5'-ROX indicates that the first nucleotide at the 5' end of the first probe is modified with the fluorescent group ROX; T25-BHQ2 indicates that the 25th nucleotide (T) from the 5' end of the first probe is modified with the first quencher group BHQ2; 3'-BHQ2 indicates that the first nucleotide at the 3' end of the first probe is modified with the second quencher group BHQ2; the modification descriptions for the second, third, and fourth probes are the same as for the first probe; FAM represents 5-carboxyfluorescein; HEX represents hexachlorofluorescein; ROX represents carboxy-X-rhodamine; CY5 represents cyanine dye; BHQ1 and BHQ2 represent fluorescence quenchers, respectively.

[0116]

[0117] Step 3: After sealing the PCR tube, gently mix the sample, then briefly centrifuge and incubate at room temperature for 5 minutes. Place the PCR tube in a handheld centrifuge again, briefly centrifuge, then transfer it to the tray of the real-time quantitative PCR instrument and perform the PCR amplification reaction. The PCR amplification procedure is shown in Table 3.

[0118]

[0119] Step 4: Data Analysis: The results were interpreted using the SLAN real-time fluorescence quantitative PCR instrument analysis software from Shanghai Hongshi Medical Technology Co., Ltd., based on the Tm value of the melting curve. The results are as follows: Figure 2-11 As shown in Table 1 of this invention, the composition can be used to perform PCR amplification on template plasmids containing target DNA, and different pathogens can be distinguished by fluorescence signals and Tm values, without false positives.

[0120] Comparative Example 1

[0121] This comparative example tested negative template plasmids and templates containing only Neisseria gonorrhoeae positive samples. The detection methods were the same as in Example 1, except that the forward primers used in the composition were the same as in Example 1, and the nucleotide sequences of the reverse primers were the same as in Example 1, but C3 spacer modification was not used. The probes used to detect Neisseria gonorrhoeae and Mycoplasma hominis are shown in Table 4, and the remaining probes are the same as in Example 1. The real-time PCR reaction procedure is shown in Table 5.

[0122]

[0123]

[0124] After the PCR amplification reaction was completed, melting curve analysis was performed. The analysis results are as follows: Figure 12-13 As shown, when the reverse primer is not modified with a C3 spacer, non-specific peaks are prone to occur in the multiplex PCR system due to interference between primers, leading to false positives. The composition provided by this invention effectively solves the problem of non-specific peaks and false positives, making it suitable for multiplex PCR detection.

[0125] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A composition for detecting reproductive tract pathogens, characterized in that, The composition comprises a first composition for detecting Neisseria gonorrhoeae, a second composition for detecting Chlamydia trachomatis, a third composition for detecting Ureaplasma urealyticum, a fourth composition for detecting Ureaplasma parvum, a fifth composition for detecting Mycoplasma hominis, a sixth composition for detecting Mycoplasma genitalium, and a seventh composition for detecting herpes simplex virus type 2. The first composition comprises a first forward primer, a first reverse primer, and a first probe for detecting Neisseria gonorrhoeae; the second composition comprises a second forward primer, a second reverse primer, and a second probe for detecting Chlamydia trachomatis; the third composition comprises a third forward primer, a third reverse primer, and a third probe for detecting Ureaplasma urealyticum; the fourth composition comprises a fourth forward primer, a fourth reverse primer, and a fourth probe for detecting Ureaplasma parvum; the fifth composition comprises a fifth forward primer, a fifth reverse primer, and the first probe for detecting Mycoplasma hominis; the sixth composition comprises a sixth forward primer, a sixth reverse primer, and the fourth probe for detecting Mycoplasma genitalium; and the seventh composition comprises a seventh forward primer, a seventh reverse primer, and the second probe for detecting herpes simplex virus type 2. The first forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:1; The second forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:3; The third forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:5; The fourth forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:7; The fifth forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:9; The sixth forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:11; The seventh forward primer is a single-stranded DNA with the nucleotide sequence shown in SEQ ID NO:13; The general structural formula of the reverse primer is shown in Formula 1: 5'-n(a)-Yn(b)-3' Equation 1 In Equation 1, n(a) and n(b) are polynucleotide fragments with different nucleotide sequences, and Y is a blocking group; In the first reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:2, and the nucleotide sequence of n(b) is GCCGTA; In the second reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:4, and the nucleotide sequence of n(b) is GCAGGA; In the third reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:6, and the nucleotide sequence of n(b) is AAGACC; In the fourth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:8, and the nucleotide sequence of n(b) is GACGG; In the fifth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:10, and the nucleotide sequence of n(b) is CTTTAC; In the sixth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:12, and the nucleotide sequence of n(b) is GGCCAA; In the seventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:14, and the nucleotide sequence of n(b) is CTCCA; The first probe is a single-stranded DNA with the nucleotide sequence SEQ ID NO:17, and the first nucleotide of SEQ ID NO:17 is labeled with a first fluorescent group, the 25th nucleotide is labeled with a first quenching group, and the 45th nucleotide is labeled with a second quenching group. The second probe is a single-stranded DNA with the nucleotide sequence SEQ ID NO:18, and the first nucleotide of SEQ ID NO:18 is labeled with a second fluorescent group, the 27th nucleotide is labeled with a third quenching group, and the 46th nucleotide is labeled with a fourth quenching group. The third probe is a single-stranded DNA with the nucleotide sequence SEQ ID NO:19, and the first nucleotide of SEQ ID NO:19 is labeled with a third fluorescent group, the 27th nucleotide is labeled with a fifth quenching group, and the 43rd nucleotide is labeled with a sixth quenching group. The fourth probe is a single-stranded DNA with the nucleotide sequence SEQ ID NO:20, and the first nucleotide of SEQ ID NO:20 is labeled with a fourth fluorescent group, the 26th nucleotide is labeled with a seventh quencher group, and the 40th nucleotide is labeled with an eighth quencher group. Any two of the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are different.

2. The composition according to claim 1, characterized in that, The molar ratio of the forward primer to the reverse primer is greater than or equal to 3:

1.

3. The composition according to claim 1 or 2, characterized in that, The blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer, and C12 Spacer.

4. The composition according to claim 1, characterized in that, The first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are independently selected from one of FAM, JOE, TAMRA, ROX, CY3, CY5, VIC, and HEX; And / or, the first quenching group, the second quenching group, the third quenching group, the fourth quenching group, the fifth quenching group, the sixth quenching group, the seventh quenching group, and the eighth quenching group are independently selected from one of BHQ1 and BHQ2.

5. A method for preparing the composition according to any one of claims 1-4, characterized in that, The preparation method consists of S1-S2: S1. Provide the forward primer, reverse primer, and probe in the above composition; S2. The forward primer, reverse primer and probe are combined to obtain the composition.

6. A kit for detecting reproductive tract pathogens, characterized in that, The forward primer, reverse primer, and probe in the kit are composed of the composition according to any one of claims 1-4.

7. The use of the composition according to any one of claims 1-4 and / or the kit according to claim 6 in the preparation of products for detecting reproductive tract pathogens.

Images