Zika virus detection target and rapid detection method and kit thereof
By detecting miR-216b-5p in Zika virus-infected cell exosomes, combined with fluorescent probes and carboxylic graphene oxide molecules, the problem of short detection window period in the prior art was solved, and a rapid and sensitive Zika virus infection detection was achieved.
Patent Information
- Application Number
- CN202510118812.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-24
- Publication Date
- 2025-04-25
AI Technical Summary
The prior art has the problem of a short detection window period when detecting Zika virus infection, and it is difficult to detect the virus within one week after the symptoms appear.
By performing miRNA sequencing analysis on endothelial cells of human umbilical vein infected with Zika virus, miR-216b-5p was determined as a specific target, a fluorescent probe that binds complementarily, and using carboxylic graphene oxide molecules as fluorescence quenchers to achieve rapid detection.
The detection time of viral infection is shortened, early detection and early diagnosis are achieved, and it has good specificity, and the detection can be completed in about 1 hour.
Smart Images
Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The invention relates to a Zika virus nucleic acid detection target and a rapid detection method and a detection kit designed according to the target, belonging to the technical field of molecular biology. Background Art
[0003] Exosomes are extracellular lipid membrane vesicles that can be released by almost all living cells. In recent years, exosomes have been shown to be an important pathway for cell communication and are widely present in body fluids such as blood and urine. miRNA is a type of endogenous small molecule single-stranded RNA in eukaryotic organisms, with a length of about 20-24 nucleotides. It binds to mRNA in cells, causing degradation or translation inhibition of target mRNA, thereby exerting a regulatory effect. Currently, circulating exosomes and the microRNA (miRNA) contained in them have been widely studied as diagnostic targets. The components contained in exosomes secreted by cells affected by viral infection will change, including changes in miRNA or other nucleic acid types that play a regulatory role and increases or decreases in protein content. In addition, some viruses can also deliver viral particles or viral nucleic acids to other cells through the exosome secretion pathway. When infected with Zika virus, exosomes can be secreted into the blood before the release of viral particles. Therefore, the detection of exosome-related components secreted by cells infected with viruses is expected to detect Zika virus infection at an early stage. Therefore, analyzing exosomes through relevant models of viral infection simulated by cell culture will help extend the window period for viral infection detection and achieve early detection and diagnosis of Zika virus infection.
[0004] Nanomaterials have been widely used in various fields. Graphene oxide is a single-layer material peeled off from graphite oxide. Since a large number of oxygen-containing groups are introduced on the molecular surface and edge of carbon, it can exist stably in aqueous solution. At the same time, the structure of graphite is conducive to the adsorption of nucleic acids. In biomedicine, nanomaterials can be used as spectral quenchers. After the graphene oxide molecules adsorb nucleotides containing fluorescent groups, the fluorescent molecules can undergo resonance energy transfer with them, so that detectable fluorescent signals cannot be emitted. If there are target nucleotides that can bind to them in the reaction system, a stronger probe-target interaction will be established, and the probe will leave the graphene oxide surface and re-emit the fluorescent signal. Since the adsorption and dissociation reaction time of nucleic acids is short, this method avoids the process of amplifying the target fragment through temperature change cycles in the PCR method, greatly shortens the reaction time, can achieve rapid detection of target nucleic acids, and improves the sensitivity of the reaction to a certain extent. Summary of the invention
[0005] The degree of viremia after Zika virus infection is not high, and the nucleic acid amplification method recommended by WHO to detect specific molecular targets on the viral genome has a short detection window period, and it is still difficult to detect within one week after the onset of symptoms. Therefore, establishing an early detection method for ZIKV infection that can be used on site is of great significance for Zika virus prevention and control and epidemic prediction and early warning.
[0006] Zika virus is mainly transmitted through mosquito bites, and systemic viral infection requires Zika virus to penetrate into blood vessels and enter various tissues through the circulatory system. Therefore, blood vessels have become an important channel and have important research significance. In addition, in the early stage of infection, when the virus has not yet passed through the body's barriers to enter other tissues, the vascular endothelium is the target cell that the early virus may infect. Existing studies have shown that Zika virus can trigger cell autophagy after infecting human umbilical vein endothelial cells. Therefore, when simulating the virus infection model in the laboratory, we selected human umbilical vein endothelial cells as the target cells for research to explore the changes in miRNA in the exosomes secreted after virus infection as a detection target for early infection.
[0007] The present invention performs miRNA sequencing analysis on exosomes of human umbilical vein endothelial cells (huVEC) infected with Zika virus to obtain a miRNA expression spectrum different from that of normal cultured cells. The highly expressed miR-216b-5p sequence was verified by qPCR as a specific target for detection of cells infected with Zika virus. At the same time, compared with exosomes infected with other flaviviruses, the target molecule has good specificity. Based on this, a fluorescent probe that can complement and bind to it is designed, and carboxylic graphene oxide molecules are used as fluorescence quenchers to prevent the fluorescent probe from being normally excited by the excitation light and emitting a fluorescent signal. If the total RNA extracted from the sample contains miR-216b-5p, the probe can dissociate from the material after binding to it and re-release the fluorescent signal, thereby determining the presence of the target nucleic acid to achieve the purpose of detection. The principle of the reaction process is as follows: Figure 1 The present invention discloses a MiRNA detection target for exosomes released after Zika virus infects human umbilical vein endothelial cells. When Zika virus infects human umbilical vein endothelial cells, a series of molecules such as miR-30c-5p and miR-216b-5p are obtained from the exosomes released by the cells, such as Figure 8 shown.
[0008] like Fig. 9 As shown, the qPCR verification results and amplification curves of the tailing method and stem-loop method (U6 gene was used as the internal reference, and the results were displayed using log multiples).
[0009] like Fig. 10A and Fig. 10BAs shown, the relative quantification of miR-30c-5p, miR-216b-5p and other molecules with obvious differences was performed, and the analysis showed that miR-216b-5p had a more significant relative quantitative difference. (U6 was selected as the internal reference gene, and the results were relative RNA expression levels. Two-sample t-test was used, *: P<0.05, **: P<0.01, n=7)
[0010] like Fig.11 As shown, after Zika virus, dengue virus, and Japanese encephalitis virus infected human umbilical vein endothelial cells, the miR-216b-5p molecule was relatively quantified, and it was still the molecule with the most significant difference. The original sequence of the 5'-3' end of the miR-216b-5p molecule was: AAAUCUCUGCAGGCAAAUGUGA.
[0011] Therefore, based on this target, a rapid detection method for miRNA released from exosomes after Zika virus infection of human umbilical vein endothelial cells was designed, including the following steps:
[0012] Step 1: Design of fluorescent probe
[0013] miRNA sequencing analysis was performed on exosomes released from human umbilical vein endothelial cells infected with Zika virus to obtain miR-216b-5p molecules different from those derived from normal cultured cells, and a fluorescent probe that was reverse complementary to the miR-216b-5p molecule was designed for the miR-216b-5p molecule, and an oligonucleotide fragment that was reverse complementary to the probe was designed as a positive control; the original sequence of the miR-216b-5p at the 5'-3' end was AAAUCUCUGCAGGCAAAUGUGA, the sequence of the fluorescent probe at the 5'-3' end was the fluorescent group *-TCACATTTGCCTGCAGAGATTT, and the sequence of the oligonucleotide fragment at the 5'-3' end was (GCG)AAATCTCTGCAGGCAAATGTGA;
[0014] Step 2: Preparation of fluorescence quencher
[0015] After the fluorescence quencher and ultrapure water are treated with an ultrasonic homogenizer, they are set aside for use and shaken to mix before each use;
[0016] Step 3: Reaction process
[0017] Prepare a nucleic acid reaction buffer solution, add the fluorescent probe designed in step 1 into it, then add the fluorescence quencher described in step 2 to quench the fluorescence, then add the total RNA extracted from the sample, mix well and let stand, and finally use a fluorescence spectrophotometer to perform fluorescence detection on the mixed test solution;
[0018] Step 4: Analyze the test results
[0019] The excitation light wavelength and emission light wavelength for detection are selected according to the fluorescent group used, and the presence or absence of the target nucleotide is determined based on the peak fluorescence intensity shown.
[0020] Furthermore, in step 1, the fluorescent probe is 22 bp in length, the target nucleic acid sequence to be detected is a miRNA sequence, the ribonucleic acid mimic is a DNA sequence consistent with the miR-216b-5p sequence, the fluorescent group* is FAM*, and the 5'-3' end sequence of the fluorescent probe is FAM*-TCACATTTGCCTGCAGAGATTT. During detection, different fluorescence excitation wavelengths are selected according to the selected fluorescent group. The commonly used fluorescent group excitation wavelengths and detection wavelengths are as follows: The fluorescent group can be selected according to the following commonly used fluorescent groups, not limited to FAM,
[0021]
[0022] Furthermore, the fluorescence quencher in step 2 is a carboxylic acid graphene oxide molecular suspension, and the ultrasonic homogenizer treatment time is 1 hour ± 20 minutes.
[0023] Furthermore, the nucleic acid reaction buffer solution in step 3 is a HEPES nucleic acid buffer solution containing sodium and magnesium ions.
[0024] The present invention also relates to a MiRNA detection kit for releasing exosomes after Zika virus infects human umbilical vein endothelial cells, referred to as a Zika virus detection kit or kit, comprising the following parts: a nucleic acid reaction buffer solution, a specific fluorescent probe, a fluorescent quencher and a positive control; the nucleic acid reaction buffer solution is a HEPES nucleic acid buffer solution containing sodium and magnesium ions, the specific fluorescent probe is a specific fluorescent probe designed for the miR-216b-5p gene nucleic acid sequence, the fluorescent quencher is a carboxylic acid graphene oxide molecular suspension, and the positive control is a DNA fragment consistent with the miR-216b-5 sequence.
[0025] Furthermore, the length of the fluorescent probe fragment is 22 bp; the length of the nucleic acid mimic fragment is 22 (25) bp.
[0026] Furthermore, the kit also includes a negative blank control substance.
[0027] Beneficial effects: Based on the material-probe combination, the present invention uses the specific components in the exosomes secreted after the Zika virus infects the cells as targets, which greatly shortens the detection time of the virus infection and achieves the beneficial effects of early detection and early treatment while ensuring high sensitivity. In addition, this target can also be distinguished from other flaviviruses, such as dengue virus and Japanese encephalitis virus, and has good specificity for the detection of Zika virus. Based on the short material-probe adsorption reaction and nucleotide hybridization reaction time, multiple temperature cycles of the qPCR reaction are avoided, so the reaction results can be presented in a short time, improving the detection efficiency. The detection can be completed in about 1 hour and a test report can be issued. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 It is a schematic diagram of the detection principle of the present invention,
[0029] Figure 2 Schematic diagram of the lowest detection limit obtained by gradient dilution of nucleotide mimics in an embodiment of the present invention,
[0030] Figure 3 1 is a schematic diagram of the fluorescence recovery results of the kit for detecting miRNA in positive and negative samples in an embodiment of the present invention,
[0031] Figure 4 is a schematic diagram of the amplification curve of miR-216-5p in two samples in the embodiment of the present invention,
[0032] Figure 5A is a schematic diagram of the sample types and quantity distribution used in the embodiments of the present invention,
[0033] Figure 5B yes Figure 5A Schematic diagram of the peak fluorescence intensity recovered when testing various samples.
[0034] Figure 6 This is a schematic diagram of the time required for the reaction system to reach equilibrium in an embodiment of the present invention.
[0035] Figure 7 is a schematic diagram of the early infection detection effect in an embodiment of the present invention,
[0036] Figure 8 This is a schematic diagram of a series of molecules such as miR-30c-5p and miR-216b-5p obtained from exosomes released from human umbilical vein endothelial cells after Zika virus infection.
[0037] Fig. 9 The results of qPCR verification and amplification curves using the tailing method and stem-loop method are shown in log multiples.
[0038] Fig. 10A This is a schematic diagram of the relative quantitative difference t test for miR-216b-5p molecules with obvious differences.
[0039] Fig. 10B This is a schematic diagram of the relative quantitative difference t test for miR-30c-5p molecules with obvious differences.
[0040] Fig.11 This is a schematic diagram of the relative quantitative difference significance analysis of miR-216b-5p molecules after Zika virus, dengue virus, and Japanese encephalitis virus infected human umbilical vein endothelial cells. DETAILED DESCRIPTION
[0041] The present invention is further explained below in conjunction with the accompanying drawings and specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. After reading the present invention, various equivalent forms of modifications to the present invention by those skilled in the art all fall within the scope defined by the claims attached to this application.
[0042] Example
[0043] In this embodiment, unless otherwise specified, all methods are conventional in the art. HEPES, NaCl, and MgCl2 buffers were purchased from Merck KGaA, Darmstadt, Germany. Probes and oligonucleotides were synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd. Carboxylated graphene oxide molecules were purchased from Jiangsu Xianfeng Nanotechnology Co., Ltd. Exosomes and exosome RNA extraction kits were purchased from TransGene Biotech.
[0044] Step 1: Design of fluorescent probe
[0045] Target miRNA selection: This target miRNA is derived from human umbilical vein endothelial cells. As the most stable of the many miRNAs that increase after Zika virus infection, its fragment length is 22bp. The target miRNA probe synthesis was performed by Shanghai Sangon Biotech Co., Ltd.
[0046] The design of the probe is a DNA sequence that is reverse complementary to the target miRNA, with a fluorescent group added to its 5' end.
[0047] Design of nucleotide mimics: a DNA oligonucleotide fragment synthesized to simulate the sequence of miRNA in the positive sample, that is, to replace uracil (U) in the miRNA sequence with thymine (T). The sequence is shown in Table 1 below:
[0048] Table 1. Nucleotide analog sequences
[0049] name Primer sequence (5'-3') Common sequences AAATCTCTGCAGGCAAATGTGA Optional sequence GCGAAATCTCTGCAGGCAAATGTGA
[0050] If the commonly used sequence cannot bind normally and cause the probe to detach and release fluorescence, use the optional sequence for the experiment. The optional sequence only adds three bases, GCG, at the 5' end, and has better binding efficiency in the experiment.
[0051] Step 2: Preparation of fluorescence quencher
[0052] Treat the fluorescence quencher and ultrapure water with an ultrasonic homogenizer for 1 hour before use, and shake and mix before each use;
[0053] Step 3: Reaction process
[0054] The "probe-material" fluorescence quenching reaction system based on the exosome miRNA target was established. The reaction system was 200 μL, and the components and final concentrations of the buffer preparation and reaction solution were shown in Table 2 below:
[0055] Table 2. Dosage table of probe-material reaction solution system
[0056]
[0057] The system has a target detection sensitivity of 4 ng and a repeatability of 0.53%-2.99%.
[0058] Step 4: Analyze the test results
[0059] The reaction program selects an excitation light with a wavelength of 485 nm and detects emission light with a wavelength of 500-800 nm, such as Figure 3 shown.
[0060] Result determination: First, perform a reaction system test with only the fluorescent probe added to obtain the peak fluorescence intensity, then perform a quenching reaction to obtain the quenched fluorescence intensity. Then prepare another reaction system and perform a test based on the original image to evaluate the fluorescence intensity recovery effect. Figure 7 shown.
[0061] Target positive: peak fluorescence intensity recovered by more than 50%; Target negative: peak fluorescence intensity recovered by less than 30%;
[0062] If the recovery efficiency is between 30% and 50%, the reaction solution is centrifuged before testing. If there is no significant increase in the peak fluorescence intensity before centrifugation, it is negative.
[0063] Invalid test: There is no obvious peak in the fluorescent probe test results, or the fluorescence quenching effect is poor, or the use of nucleic acid analogs cannot restore the fluorescence. In this case, it is necessary to re-extract the sample or replace the probe or material for retesting.
[0064] Preparation of positive control
[0065] A DNA oligonucleotide fragment synthesized according to the sequence of miR-216b-5p, that is, replacing uracil (U) in the miRNA sequence with thymine (T), can be used after being dissolved and diluted with pure water. If the effect is not good, a few bases can be added to the 5' end of the sequence and tried again, as in step 1 of the above embodiment.
[0066] Performance data of the test system
[0067] Sensitivity verification: Take a 100μM concentration of simulated oligonucleotide and perform gradient dilution, where the minimum addition amount is 0.4μL / 200μL (final concentration is 0.2μM), and perform probe-material binding test. Figure 2 As shown, the reaction can finally have good linearity when the target nucleotide concentration is 0.2 μM (the reaction system content is about 3.16 ng), indicating that the method can detect the target nucleotide at this concentration. The four-grid table also shows that its sensitivity can reach 95%, as shown in Table 3 below.
[0068] Specificity verification: Other viruses of the genus Flavivirus were selected for detection (20 cases of Zika virus and 10 cases of other viruses). The results showed that the detection specificity of this method for Zika virus was 100%, as shown in Table 3 below. Figure 4 It can be seen that the fluorescence intensity recovery of miRNA in Zika virus-infected samples also has good significance.
[0069] Table 3. Four-compartment table of test results of kit detection and material-probe method detection
[0070]
[0071] Repeatability evaluation: Three independent experiments were performed, and 100% detection was possible within 15 min, with a repeatability of 0.53%-2.99% and a CV of <3%, which showed good repeatability, as shown in Table 4 below.
[0072] Table 4. Repeatability of detection based on miR-216 mimic oligonucleotides
[0073]
[0074] Reaction time verification: The reaction can reach equilibrium in about 5 minutes, thus achieving rapid detection of target nucleotides, such as Figure 5A and Figure 5B shown.
[0075] Early detection effect of infection: Through the test results of samples of human umbilical vein endothelial cells infected with Zika virus at different time periods, it can be found that this method also has a good effect on early detection of virus infection, such as Figure 6As shown, it is further verified that the detection method of the present invention can present the reaction results in a short time, improve the detection efficiency, and quickly issue the detection report.
[0076] like Figure 8 As shown in Figure 2, when Zika virus infects human umbilical vein endothelial cells, a series of molecules such as miR-30c-5p and miR-216b-5p are obtained from the exosomes released by the cells. Fig. 9 As shown, the tailing method and stem-loop method qPCR verification results and amplification curves (U6 gene is used as the internal reference, and the results are displayed using log multiples). Fig. 10A and Fig. 10B As shown in the figure, the relative quantitative analysis of miR-30c-5p and miR-216b-5p, which showed that miR-216b-5p had a more significant relative quantitative difference. (U6 was selected as the internal reference gene, and the results were the relative expression of RNA. Two-sample t-test was used, *: P<0.05, **: P<0.01, n=7) Fig.11 As shown, after Zika virus, dengue virus and Japanese encephalitis virus infected human umbilical vein endothelial cells, the miR-216b-5p molecule was relatively quantitatively detected, which further proved that the target miR-216b-5p molecule of the present application had very significant differences compared with other molecules, and the selection of this target had outstanding substantial characteristics.
[0077] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.
[0078] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.
Claims
1. A Zika virus detection target, specifically a miRNA detection target for exosomes released after Zika virus infects human umbilical vein endothelial cells, characterized in that: The target is human umbilical vein endothelial cells infected with Zika virus, and the molecules obtained in the exosomes released by the cells are subjected to relative quantitative difference analysis to obtain the most significantly different molecule, which is the miR-216b-5p molecule. The original sequence of the 5'-3' end of the miR-216b-5p molecule is: AAAUCUCUGCAGGCAAAUGUGA.
2. A rapid detection method for Zika virus, specifically a rapid detection method for miRNA released from exosomes after Zika virus infects human umbilical vein endothelial cells, characterized in that: The method comprises the following steps: Step 1: Design of fluorescent probe miRNA sequencing analysis was performed on exosomes released from human umbilical vein endothelial cells infected with Zika virus to obtain miR-216b-5p molecules different from those derived from normal cultured cells, and a fluorescent probe that was reverse complementary to the miR-216b-5p molecule was designed for the miR-216b-5p molecule, and an oligonucleotide fragment that was reverse complementary to the probe was designed as a positive control; the original sequence of the miR-216b-5p at the 5'-3' end was AAAUCUCUGCAGGCAAAUGUGA, the sequence of the fluorescent probe at the 5'-3' end was the fluorescent group *-TCACATTTGCCTGCAGAGATTT, and the sequence of the oligonucleotide fragment at the 5'-3' end was (GCG)AAATCTCTGCAGGCAAATGTGA; Step 2: Preparation of fluorescence quencher After the fluorescence quencher and ultrapure water are treated with an ultrasonic homogenizer, they are set aside for use and shaken to mix before each use; Step 3: Reaction process Prepare a nucleic acid reaction buffer solution, add the fluorescent probe designed in step 1 into it, then add the fluorescence quencher described in step 2 to quench the fluorescence, then add the total RNA extracted from the sample, mix well and let stand, and finally use a fluorescence spectrophotometer to perform fluorescence detection on the mixed test solution; Step 4: Analyze the test results The excitation light wavelength and emission light wavelength for detection are selected according to the fluorescent group used, and the presence or absence of the target nucleotide is determined based on the peak fluorescence intensity shown.
3. The rapid detection method according to claim 2, characterized in that: In step 1, the fluorescent probe is 22 bp in length, the target nucleic acid sequence to be detected is a miRNA sequence, the ribonucleic acid mimic is a DNA sequence consistent with the miR-216b-5p sequence, the fluorescent group* is FAM*, and the 5'-3' end sequence of the fluorescent probe is FAM*-TCACATTTGCCTGCAGAGATTT.
4. The rapid detection method according to claim 2, characterized in that: The fluorescence quencher in step 2 is a carboxylic acid graphene oxide molecular suspension, and the ultrasonic homogenizer treatment time is 1 hour ± 20 minutes.
5. The rapid detection method according to claim 2, characterized in that: The nucleic acid reaction buffer solution in step 3 is a HEPES nucleic acid buffer solution containing sodium and magnesium ions.
6. A Zika virus detection kit, specifically a MiRNA detection kit for exosomes released after Zika virus infects human umbilical vein endothelial cells, characterized in that: The invention comprises the following parts: a nucleic acid reaction buffer solution, a specific fluorescent probe, a fluorescent quencher and a positive control; the nucleic acid reaction buffer solution is a HEPES nucleic acid buffer solution containing sodium and magnesium ions, the specific fluorescent probe is a specific fluorescent probe designed for the nucleic acid sequence of the miR-216b-5p gene, the fluorescent quencher is a carboxylic acid graphene oxide molecular suspension, and the positive control is a DNA fragment consistent with the miR-216b-5 sequence.
7. The kit according to claim 6, characterized in that The specific fluorescent probe is 22 bp in length; the positive control fragment is 22 (25) bp in length.
8. The kit according to claim 7, characterized in that The kit also includes a negative blank control substance.