Kit for rapidly and quantitatively detecting human parvovirus B19, primer probe combination and application thereof

Abstract

The invention discloses a kit for rapidly and quantitatively detecting human parvovirus B19, a primer probe combination and application thereof. The kit comprises a B19 primer probe mixed solution, a B19 enzyme mixed solution and a B19 PCR reaction solution, wherein the B19 PCR reaction liquid comprises a PCR reinforcing agent, and the PCR reinforcing agent comprises a nano material type PCR reinforcing agent, a small molecule chemical type PCR reinforcing agent and a protein type PCR reinforcing agent. The primer pair, the probe and the kit provided by the invention are simple and convenient to use and operate, wide in applicable population and high in detection sensitivity, can detect viral nucleic acid as low as 100IU / mL, and are beneficial to early diagnosis.

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, and in particular to a kit for rapid and quantitative detection of human parvovirus B19, a primer-probe combination and an application thereof. Background Art

[0002] Human parvovirus B19 (B19 virus for short) belongs to the Parvoviridae family, Erythrovirus genus, is a non-enveloped, single-stranded linear DNA virus. Human parvovirus B19 infection can cause a variety of diseases, and the clinical manifestations of infection vary greatly among people of different ages or immune status. Adults with normal immunity usually show some mild, self-limiting, cold-like fever symptoms after infection with the B19 virus, but infection with the B19 virus can cause serious diseases in special populations. For example, patients who are in an immunosuppressive state such as undergoing organ transplant surgery may be infected with anemia, pure red cell aplasia, chronic anemia, fever, joint pain, etc. Therefore, the diagnosis and monitoring of parvovirus B19 are of great clinical significance.

[0003] At present, the detection method for products approved by NMPA is serological testing. However, this detection method has many shortcomings, such as people with impaired immune function and those receiving immunosuppressive treatment cannot produce antibodies, serological testing cannot be used, and it cannot meet the needs of clinical rapid and accurate diagnosis. Fluorescence quantitative PCR technology has become a common method for virus detection due to its advantages of high sensitivity, high specificity and quantitative detection. However, in practical applications, there are still some problems that affect the detection effect, such as low amplification efficiency and low sensitivity.

[0004] Therefore, there is an urgent need to develop a method with high sensitivity and rapid quantitative detection of human parvovirus B19 to overcome the shortcomings of serological testing that cannot detect people with impaired immune function or receiving immunosuppressive treatment and the low sensitivity of traditional fluorescent quantitative PCR. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a kit for rapid and quantitative detection of human parvovirus B19, a primer-probe combination and application thereof.

[0006] Specifically, the present invention provides a kit for rapid quantitative detection of human parvovirus B19, the kit comprising a B19 primer-probe mixture, a B19 enzyme mixture, and a B19 PCR reaction solution;

[0007] Wherein, the B19 PCR reaction solution includes a PCR enhancer, and the PCR enhancer includes a nanomaterial PCR enhancer, a small molecule chemical PCR enhancer and a protein PCR enhancer.

[0008] In some embodiments, the nanomaterial-based PCR enhancer includes graphene nanosheets, gold nanoparticles (AuNPs), graphene oxide (GO), quantum dots (QDs), upconversion nanoparticles (UCNPs) and carbon nanotubes (CNTs).

[0009] In some embodiments, the small molecule chemical PCR enhancer includes trehalose, betaine, dithiothreitol (DTT), formamide, glycerol, propylene glycol, DMSO, tetramethylammonium chloride (TMAC), and spermidine.

[0010] In some embodiments, the protein-based PCR enhancer includes bovine serum albumin (BSA), single-stranded binding protein, and bovine thrombin (BT).

[0011] In some specific embodiments, the PCR enhancer includes one or more of graphene nanosheets, betaine, trehalose, BSA and single-stranded binding protein.

[0012] In some specific embodiments, the PCR enhancer includes one or more of 0.001-0.01 w / w% graphene nanosheets, 0.5-3 M betaine, 0.1-1 M trehalose, 0.2-1 mg / mL BSA and 1-15 ng / μL single-stranded binding protein.

[0013] In some specific embodiments, the PCR enhancer includes one or more of 0.01 w / w% graphene nanosheets, 1.7 M betaine, 0.5 M trehalose, 0.8 mg / mL BSA, and 5 ng / μL single-stranded binding protein.

[0014] In some embodiments, the kit further comprises one or more of a B19 negative control, a B19 weak positive control, a B19 positive control, a B19 quantitative standard, and a B19 internal standard control.

[0015] In some specific embodiments, the B19 weak positive quality control product and the B19 positive quality control product are pseudovirus particles comprising the nucleotide sequence shown in SEQ ID NO:1; the B19 internal standard quality control product is a plasmid comprising the nucleotide sequence shown in SEQ ID NO:2.

[0016] In some specific embodiments, the B19 primer-probe mixture includes an upstream primer B19-F having a nucleotide sequence as shown in SEQ ID NO:3, a downstream primer B19-R having a nucleotide sequence as shown in SEQ ID NO:4, and a probe B19-P having a nucleotide sequence as shown in SEQ ID NO:5.

[0017] In some embodiments, the B19 primer-probe mixture further includes a primer probe for detecting an internal reference.

[0018] In some specific embodiments, the primer probe for detecting the internal reference includes an upstream primer NC-F with a nucleotide sequence as shown in SEQ ID NO:6, a downstream primer NC-R with a nucleotide sequence as shown in SEQ ID NO:7, and a probe NC-P with a nucleotide sequence as shown in SEQ ID NO:8.

[0019] In some specific embodiments, the 5' end of the probe is labeled with any one of the fluorescent dyes FAM, VIC, ROX, and CY5, and the 3' end of the probe is labeled with a quenching fluorescent dye BHQ.

[0020] In some embodiments, the B19 PCR reaction solution further comprises one or more of 5×Hotstart Taq PCR Buffer, dATP, dGTP, dCTP, dTTP and dUTP.

[0021] In some specific embodiments, the B19 PCR reaction solution further comprises 5×Hotstart Taq PCR Buffer, 100-600 μM dATP, 100-600 μM dGTP, 100-600 μM dCTP, 50-300 μM dTTP and 50-300 μM dUTP.

[0022] In some specific embodiments, the B19 PCR reaction solution further comprises 5×Hotstart Taq PCR Buffer, 200 μM dATP, 200 μM dGTP, 200 μM dCTP, 200 μM dTTP and 200 μM dUTP.

[0023] In some embodiments, the B19 enzyme mixture comprises Hotstart Taq DNA Polymerase and Uracil DNA Glycosylase, Heat-labile.

[0024] In some specific embodiments, the B19 enzyme mixture comprises 0.005-0.5 U / μL Hotstart Taq DNA Polymerase and 0.005-0.5 U / μL Uracil DNA Glycosylase, Heat-labile.

[0025] In some specific embodiments, the B19 enzyme mixture contains 0.1 U / μL Hotstart Taq DNA Polymerase and 0.04 U / μL Uracil DNA Glycosylase, Heat-labile.

[0026] The present invention also provides a primer-probe combination, wherein the primer-probe combination further comprises a primer probe for detecting an internal reference.

[0027] In some specific embodiments, the primer probe for detecting the internal reference includes an upstream primer NC-F with a nucleotide sequence as shown in SEQ ID NO:6, a downstream primer NC-R with a nucleotide sequence as shown in SEQ ID NO:7, and a probe NC-P with a nucleotide sequence as shown in SEQ ID NO:8.

[0028] In some specific embodiments, the 5' end of the probe is labeled with any one of the fluorescent dyes FAM, VIC, ROX, and CY5, and the 3' end of the probe is labeled with a quenching fluorescent dye BHQ.

[0029] The present invention also provides a method for rapid quantitative detection of human parvovirus B19, the method comprising the following steps:

[0030] The kit or the primer-probe combination is used to perform PCR detection on the sample to be tested.

[0031] In some embodiments, the sample to be tested is a biological sample containing genomic DNA.

[0032] In some specific embodiments, the sample to be tested is whole blood or oral mucosal exfoliated cells.

[0033] In some specific embodiments, the reaction conditions of the PCR detection are: 37°C UDG enzyme reaction for 2 min, 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 60°C annealing and extension for 30 s, for a total of 45 cycles.

[0034] The present invention also provides the use of the kit or the primer-probe combination in detecting human parvovirus B19; wherein the use is for non-diagnostic and non-therapeutic purposes.

[0035] The present invention also provides a method for rapid quantitative detection of human parvovirus B19, which combines small molecule chemistry, nanomaterials and protein PCR enhancers to improve the sensitivity of B19 virus nucleic acid detection.

[0036] In some specific embodiments, the method comprises the following steps:

[0037] (1) The first step is to design specific primers and probes: Based on the gene sequences of genotypes 1, 2, and 3 of human parvovirus B19, specific primers (B19-F and B19-R) and a fluorescent probe (B19-P) were designed. Specific primers (NC-F and NC-R) and a fluorescent probe (NC-P) were designed for the Chlorella gene and used as internal standard primers and probes.

[0038] (2) The human parvovirus B19 nucleic acid target gene sequence is as follows

[0039] TCCACCCAGACCTCCAAACCACCCCAATTGTCACAGACACCAGTATCAGCAGCAGTGGTGGTGAAAGCTCTGAAGAACTCAGTGAAAGCAGC (SEQ ID NO: 1)

[0040] (3) The internal standard gene target gene sequence is as follows

[0041] ACCTTGAAGTGGCACAGCGTGGTCAAGATCTCTCAGAGCTTGTACCGGGAGGCACCTGGCG TGGACCCCTTCCGCCCAGACCAGCGCACCCCCGTCCCCAACTTCTTCCT (SEQ ID NO: 2)

[0042] (4) The specific recognition B19 nucleic acid primer probe sequence is as follows:

[0043] Table 1B19 Nucleic Acid Amplification Primer Probe Sequences

[0044] name sequence B19-F CACCCAGAYCTCCAAACC(SEQ ID NO:3) B19-R GCTGCTTTCACTGAGTTSTTC(SEQ ID NO:4) B19-P 5'FAM-CCAGTRTCAGCAGCAGTGGTGGTGAA-3'BHQ1(SEQ ID NO:5)

[0045] (5) The primer probe sequences for specifically recognizing the internal standard gene are as follows:

[0046] Table 2 Internal standard amplification primer probe sequences

[0047]

[0048]

[0049] (6) The second step is to prepare a human parvovirus B19 amplification system, which includes a B19 nucleic acid-specific binding primer B19-F, a B19 nucleic acid-specific primer B19-R, a B19 nucleic acid-specific probe B19-P, an internal standard-specific primer NC-F, an internal standard-specific primer NC-R, an internal standard-specific probe NC-P, deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP), deoxyuridine triphosphate (dUTP), 5× Hotstart Taq PCR Buffer, a PCR enhancer, Hotstart Taq DNA Polymerase and Uracil DNA Glycosylase, and Heat-labile.

[0050] (7) The PCR enhancer is obtained through a large number of experimental screening and optimization, and includes nanomaterials, small molecule chemicals and protein PCR enhancers.

[0051] (8) The nanomaterial PCR enhancer contains graphene nanosheets, which have unique physical and chemical properties. The addition of graphene nanosheets to the PCR buffer will enhance thermal conductivity, thereby making the interaction between DNA, Taq DNA polymerase and other reagents more effective. The small molecule chemical PCR enhancer contains betaine and trehalose. Betaine can help DNA polymerase pass through certain complex secondary structures of DNA smoothly and prevent DNA polymerase from dissociating from template DNA. High concentration of betaine solution can stabilize DNA-protein complex. Trehalose can work by protecting the enzyme from interference from blood inhibitors. The protein enhancer contains BSA and single-stranded binding protein. BSA can bind to the compounds remaining in the nucleic acid extraction process and protect the activity of TaqDNA polymerase, thereby enhancing the efficiency of PCR amplification. During the PCR process, the double-stranded DNA unwinds to form single-stranded DNA. Single-stranded binding proteins can quickly bind to these single-stranded DNAs to prevent the single-stranded DNA from reforming into double-stranded DNA, thereby maintaining the stability of the single-stranded state and providing favorable conditions for primer binding and subsequent amplification. Single-stranded binding proteins can interact with DNA polymerase to optimize its movement and catalysis on the single-stranded template, thereby enhancing the activity of DNA polymerase and accelerating the speed of DNA synthesis. Single-stranded binding proteins can reduce the risk of single-stranded DNA being attacked and degraded by nucleases, ensure the integrity of the template, and help the smooth progress of the PCR reaction.

[0052] (9) The PCR amplification system for human parvovirus B19 further comprises one or more of the following components: 5× Hotstart Taq PCR Buffer, 100-600 μM dATP, 100-600 μM dGTP, 100-600 μM dCTP, 50-300 μM dTTP, 50-300 μM dUTP, 0.1-0.4 μM primers (B19-F, B19-R, NC-F and NC-R), 0.05-0.2 μM probes (B19-P and NC-P), 0.005-0.5 U / μL Hotstart Taq DNA Polymerase and 0.005-0.5 U / μL Uracil DNA Glycosylase, Heat-labile, 0.001-0.01w / w% graphene nanosheets, 0.5-3M betaine, 0.1-1M trehalose, 0.2-1mg / mL BSA, 1-15ng / μL single-stranded binding protein. The aliquot volume for PCR detection is 20-45μL.

[0053] (10) The third step is to prepare quantitative standards B19 quantitative standards I to IV, B19 internal standard quality control, B19 negative quality control, B19 positive quality control and B19 critical positive quality control. The quantitative standards B19 quantitative standards I to IV are traceable to the 3rd WHO International Standard for Parvovirus B19 for Nucleic Acid Amplification Techniques (NIBSC code: 12 / 208) and are plasmids containing the B19 target gene sequence. The B19 internal standard quality control is a plasmid containing the internal standard gene sequence. The B19 negative quality control is purified water. The B19 positive quality control and B19 critical positive quality control are pseudovirus particles containing the B19 target gene sequence.

[0054] (11) The B19 negative quality control product is purified water. The B19 positive quality control product and the B19 weak positive quality control product contain final concentrations of 5×10 4 ~5×10 5 IU / mL and 200-1000 IU / mL of B19 pseudovirus containing the target gene sequence. The B19 quantitative standards 1-4 contain final concentrations of 1×10 7 ~3×10 7 IU / mL, 1×10 6 ~3×10 6 IU / mL, 1×10 5 ~3×10 5 IU / mL and 1×10 4 ~3×104 IU / mL of plasmid.

[0055] (12) The fourth step is to extract nucleic acids from the test sample, quality control product and quantitative standard product: 100-200 μL of each of the test sample, negative quality control product, positive quality control product, weak positive quality control product and quantitative standards 1 to 4 are taken for nucleic acid extraction simultaneously. Before nucleic acid extraction, 5-10 μL of internal standard quality control product are added respectively.

[0056] (13) Step 5: Add 5-30 μL of the extracted nucleic acid to the human parvovirus B19 PCR amplification system. The final PCR volume is 25-50 μL.

[0057] (13) Step 6: Real-time fluorescence quantitative PCR detection: Perform real-time fluorescence quantitative PCR detection and calculate the B19 virus content in the sample based on the standard curve.

[0058] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0059] The reagents and raw materials used in the present invention are commercially available.

[0060] The positive and progressive effects of the present invention are:

[0061] 1. High sensitivity: The present invention utilizes various PCR enhancers to improve amplification efficiency and detection sensitivity. The kit of the present invention can detect viral nucleic acid as low as 100 IU / mL, which is helpful for early diagnosis.

[0062] 2. Easy operation: The detection method of the present invention is based on conventional real-time fluorescence quantitative PCR technology, with a simple operation process and easy to promote and apply in clinical laboratories.

[0063] 3. Widely applicable population: The detection method of the present invention can be used for auxiliary diagnosis of B19 virus infection in people with impaired immune function, those receiving immunosuppressive treatment, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1A-1B It is a schematic diagram of the test results; Figure 1A This is the amplification curve of the B19 positive sample. Figure 1B It is an amplification curve diagram for detecting B19 negative samples; wherein, the ordinate of the amplification curve diagram is ΔRn, and the abscissa is the Cycle value, and the value range is 2-44.

[0065] Figure 2 This is the standard curve of B19 standard.

[0066] Figure 3A-3D Schematic diagram of sample test results for primer probe screening; Figure 3Ais the amplification curve of the sample detection results of primer probe set 1, Figure 3B is the amplification curve diagram of the sample detection results of primer probe set 2, Figure 3C is the amplification curve diagram of the sample detection results of primer probe set 3, Figure 3D It is an amplification curve diagram of the sample detection results of primer probe set 4; wherein, the ordinate of the amplification curve diagram is ΔRn, and the abscissa is the Cycle value, and the value range is 2-44.

[0067] Figure 4 It is a sensitivity amplification curve diagram for detecting B19 nucleic acid; wherein, the ordinate of the amplification curve diagram is ΔRn, the abscissa is the Cycle value, and the value range is 2-44.

[0068] Figure 5A-Figure 5I Schematic diagram of the detection limit concentration sample test results for PCR enhancer screening; Figure 5A This is the amplification curve of the detection result of the sample with the detection limit concentration of graphene nanosheets added. Figure 5B This is the amplification curve of the detection results of the sample with the detection limit concentration of betaine added. Figure 5C This is the amplification curve of the detection results of the sample with the detection limit concentration of trehalose added. Figure 5D This is the amplification curve of the detection results of samples with the detection limit concentration of BSA added. Figure 5E This is the amplification curve of the detection result of the sample with the detection limit concentration of the added single-stranded binding protein. Fig. 5F This is the amplification curve of the detection result of the sample with the detection limit concentration of dimethyl sulfoxide (DMSO) added. Figure 5G This is the amplification curve of the detection results of the sample with the detection limit concentration of tetramethylammonium chloride (TMAC) added. Figure 5H This is the amplification curve of the detection results of the sample with the detection limit concentration of formamide added. Fig.5I It is an amplification curve diagram of the detection result of the sample with the detection limit concentration of glycerol added; wherein, the ordinate of the amplification curve diagram is ΔRn, and the abscissa is the Cycle value, and the value range is 2-44.

[0069] Figure 6A-6E Schematic diagram of the test results of samples optimized for the addition of graphene nanosheets concentration; Fig. 6A This is the amplification curve of the test results of the sample with 0.005w / w% graphene nanosheets added. Figure 6B This is the amplification curve of the test results of the sample with 0.001w / w% graphene nanosheets added. Figure 6C This is the amplification curve of the test results of the sample with 0.005w / w% graphene nanosheets added. Fig.6D This is the amplification curve of the test results of the sample with 0.01w / w% graphene nanosheets added. Fig. 6EThis is an amplification curve diagram of the test results of the sample with 0.05w / w% graphene nanosheets added; the red curve is the internal standard, and the blue curve is the B19 virus; the ordinate of the amplification curve diagram is ΔRn, and the abscissa is the Cycle value, with a value range of 2-44.

[0070] Figure 7A-7E Schematic diagram of the test results of samples optimized for the addition of betaine concentration; Fig. 7A This is the amplification curve of the test results of the sample with 0.1M betaine added. Figure 7B This is the amplification curve of the test results of the sample with 0.5M betaine added. Figure 7C This is the amplification curve of the test results of the sample with 1.7M betaine added. Fig.7D This is the amplification curve of the test results of the sample with 3M betaine added. Fig. 7E This is the amplification curve of the test results of the sample with 5M betaine added; the red curve is the internal standard, and the blue curve is the B19 virus; the ordinate of the amplification curve is ΔRn, and the abscissa is the Cycle value, with a value range of 2-44.

[0071] Figure 8A-8E Schematic diagram of the test results of samples optimized for the addition of trehalose concentration; Fig. 8A This is the amplification curve of the test results of the sample with 0.05M trehalose added. Figure 8B This is the amplification curve of the test results of the sample with 0.1M trehalose added. Figure 8C This is the amplification curve of the test results of the sample with 0.5M trehalose added. Fig.8D This is the amplification curve of the test results of the sample with 1M trehalose added. Fig. 8E This is the amplification curve of the test results of the sample with 5M trehalose added; the red curve is the internal standard, and the blue curve is the B19 virus; the ordinate of the amplification curve is ΔRn, and the abscissa is the Cycle value, with a value range of 2-44.

[0072] Figure 9A-9E Schematic diagram of the test results of samples optimized for the addition of BSA concentration; Fig.9A This is the amplification curve of the test results of the sample with 0.1 mg / mL BSA added. Fig. 9B This is the amplification curve of the test results of the sample with 0.2 mg / mL BSA added. Fig. 9C This is the amplification curve of the test results of the sample with 0.8 mg / mL BSA added. Fig.9D This is the amplification curve of the test results of the sample with 1 mg / mL BSA added. Fig.9E This is the amplification curve of the test results of the sample with 2 mg / mL BSA added; the red curve is the internal standard, and the blue curve is the B19 virus; the ordinate of the amplification curve is ΔRn, and the abscissa is the Cycle value, with a value range of 2-44.

[0073] Figure 10A-10E Schematic diagram of sample test results optimized for the addition of single-stranded binding protein concentration; Fig. 10A This is the amplification curve of the sample test results with 0.5ng / μL single-stranded binding protein added. Fig. 10B This is the amplification curve of the sample test results with 1ng / μL single-stranded binding protein added. Fig. 10C This is the amplification curve of the sample test results with 5ng / μL single-stranded binding protein added. Fig. 10D This is the amplification curve of the sample test results with 15ng / μL single-stranded binding protein added. Fig. 10E It is the amplification curve diagram of the test results of the sample with 20 ng / μL single-stranded binding protein added; the red curve is the internal standard, and the blue curve is the B19 virus; the ordinate of the amplification curve diagram is ΔRn, and the abscissa is the Cycle value, and the value range is 2-44.

[0074] Figure 11A-11B The detection limit concentration sample results before and after adding PCR enhancer; Fig.11A The detection limit concentration sample result after adding PCR enhancer, Fig. 11B It is the detection limit concentration sample result without adding PCR enhancer; wherein, the ordinate of the amplification curve is ΔRn, and the abscissa is the Cycle value, and the value range is 2-44. DETAILED DESCRIPTION

[0075] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0076] Example 1: A kit containing a PCR enhancer for detecting human parvovirus B19 nucleic acid.

[0077] The composition of the kit is shown in Table 3.

[0078] Table 3 Composition of human parvovirus B19 nucleic acid detection kit (24 servings / box)

[0079] Product composition Main Ingredients Specifications and loading quantity B19 PCR reaction solution <![CDATA[Tris-HCl buffer, dNTP, Mg 2+ etc.]]> 600μL×1 tube B19 Primer Probe Mixture Specific primer probe 72μL×1 tube B19 enzyme mixture Taq enzyme, UDG enzyme 48μL×1 tube B19 negative quality control Purified water 600μL×1 tube B19 weak positive quality control B19 pseudovirus 600μL×1 tube B19 positive quality control B19 pseudovirus 600μL×1 tube B19 quantitative standard 1 B19 Plasmid 600μL×1 tube B19 quantitative standard 2 B19 Plasmid 600μL×1 tube B19 quantitative standard 3 B19 Plasmid 600μL×1 tube B19 quantitative standard 4 B19 Plasmid 600μL×1 tube B19 internal standard quality control product Internal standard plasmid 240μL×1 tube

[0080] The B19 PCR reaction solution contained a final concentration of 5×Hotstart Taq PCR Buffer, 200 μM dATP, 200 μM dGTP, 200 μM dCTP, 200 μM dTTP, 200 μM dUTP, 0.01 w / w% graphene nanosheets, 1.7 M betaine, 0.5 M trehalose, 0.8 mg / mL BSA, and 5 ng / μL single-stranded binding protein. dNTP was purchased from Shanghai Zhaowei Biotechnology Co., Ltd., and the remaining components were purchased from Suzhou Yuanqi Biotechnology Co., Ltd.

[0081] The B19 primer-probe mixture contains primers (B19-F, B19-R, NC-F and NC-R) with a final concentration of 0.2 μM and probes (B19-P and NC-P) with a final concentration of 0.1 μM. The primers and probes were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0082] The B19 enzyme mixture is 0.1U / μL Hotstart Taq DNA Polymerase and 0.04U / μL Uracil DNA Glycosylase, Heat-labile. Hotstart Taq DNA Polymerase and Uracil DNA Glycosylase, Heat-labile were purchased from Suzhou Yuanqi Biotechnology Co., Ltd.

[0083] Among them, the B19 negative control product is purified water.

[0084] Among them, the final concentrations of B19 positive quality control and B19 weak positive quality control were 9.29×10 4 IU / mL and 935IU / mL of B19 pseudovirus containing the target gene sequence. B19 pseudovirus was purchased from Fuboao (Suzhou) Biopharmaceutical Technology Co., Ltd.

[0085] Among them, B19 quantitative standards 1-4 contain final concentrations of 1.49×10 7 IU / mL, 1.42×10 6 IU / mL, 1.29×10 5 IU / mL and 1.34×10 4 IU / mL of B19 plasmid containing the target gene sequence. B19 plasmid was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0086] Among them, the B19 internal standard quality control product contains a final concentration of 2×10 5 The internal standard plasmid was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0087] Example 2: Establishment of detection method

[0088] (1) Sample processing

[0089] Take 200 μL of each of the sample to be tested, negative quality control, positive quality control, weak positive quality control and quantitative standards 1 to 4 for nucleic acid extraction simultaneously, and add 10 μL of internal standard quality control before nucleic acid extraction. Use the nucleic acid extraction or purification reagent of Anhui Tongke Biotechnology Co., Ltd. for nucleic acid extraction. Please strictly follow the product instructions during the extraction process.

[0090] (2) Preparation of PCR reaction system

[0091] According to the proportions in Table 4, the corresponding components in the kit for preparing human parvovirus B19 nucleic acid in Example 1 were pipetted, thoroughly mixed and briefly centrifuged, and then dispensed into PCR reaction tubes at a rate of 30.0 μL / tube.

[0092] Table 4 PCR reaction system preparation

[0093] Components Dosage (μL) B19 PCR reaction solution 25.0×N B19 Primer Probe Mixture 3.0×N B19 enzyme mixture 2.0×N

[0094] N = number of samples to be tested (n) + quantitative standard (4) + number of quality control products (3) + 1

[0095] (3) Sample addition

[0096] Take 20 μL of each of the B19 negative quality control, B19 weak positive quality control, B19 positive quality control, B19 quantitative standards 1 to 4, and nucleic acid extracts of the samples to be tested and add them to the corresponding PCR reaction tubes. Close the tube caps tightly, centrifuge instantly, and perform PCR reaction immediately.

[0097] (4) Amplification

[0098] Place each reaction tube in the fluorescent PCR in order, set the negative quality control, positive quality control, weak positive quality control, quantitative standards 1 to 4 and the sample to be tested in the corresponding order, and set the sample name and quantitative standard concentration. Perform the PCR reaction according to the following procedure, set the reaction volume to 50μL, and set it according to the operating instructions of each applicable instrument.

[0099] Table 5 PCR reaction cycles

[0100]

[0101] (5) Results analysis

[0102] After the reaction is completed, the PCR instrument supporting software is used to analyze the experimental results. The baseline or threshold line can be set according to the actual situation. The results of the FAM channel and the ROX channel are analyzed separately, and only the FAM or ROX fluorescence detection channel is displayed. At the same time, the negative quality control, weak positive quality control and positive quality control are selected. The baseline starting point can be set to 3-5, and the baseline end point can be set to 5-20. The threshold line is set in principle so that the threshold line just exceeds the highest point of the negative quality control amplification curve (irregular noise line).

[0103] (6) Quality Control:

[0104] All quality control test results should meet the ROX channel Ct value ≤ 36.0 and meet the conditions shown in Table 6:

[0105] Table 6 Quality control product testing standards

[0106] Quality Control Products FAM channel B19 negative quality control There was no obvious S-shaped amplification curve or Ct>40.0. B19 positive quality control <![CDATA[The test result is positive and the concentration range is 5×10 4 ~5×10 5 IU / mL.]]> B19 weak positive quality control The test result was positive. B19 quantitative standard 1~4 The test results were all positive and the standard curve correlation coefficient |r|≥0.98.

[0107] (7) Result judgment:

[0108] ① The test results shall be interpreted according to Table 7:

[0109] Table 7 Test result interpretation table

[0110]

[0111] ② If the Ct value of the ROX channel is >36.0 or there is no amplification curve, and the test result is <1×10 8 IU / mL indicates that the test result of the sample is invalid, which may be caused by inhibition of PCR reaction or improper extraction. The cause should be found and eliminated, and the experiment should be repeated on this sample.

[0112] (7) The results of the established method for detecting B19 virus negative and B19 virus positive samples are shown in Figure 1A-1B The standard curve of B19 standard detected by the established method is shown in Figure 2 .Depend on Figure 2 It can be seen that R 2 =0.999, the established method has good linearity.

[0113] Example 3 Primer probe screening

[0114] Table 8 Primer probe sequences

[0115]

[0116]

[0117]

[0118] The results of the detection using primer-probe combination 1 are as follows Figure 3A As shown, the detection results using primer probe combination 2 are as follows Figure 3B As shown, the detection results using primer probe combination 3 are as follows Figure 3C As shown, the detection results using primer probe combination 4 are as follows Figure 3D According to the above results, primer-probe combination 1 was selected as the optimal combination.

[0119] The human parvovirus B19 nucleic acid target gene sequence is as follows

[0120] TCCACCCAGACCTCCAAACCACCCCAATTGTCACAGACACCAGTATCAGCAGCAGTGGTGGTGAAAGCTCTGAAGAACTCAGTGAAAGCAGC (SEQ ID NO: 1)

[0121] The target gene sequence of the internal standard gene is as follows

[0122] ACCTTGAAGTGGCACAGCGTGGTCAAGATCTCTCAGAGCTTGTACCGGGAGGCACCTGGCG TGGACCCCTTCCGCCCAGACCAGCGCACCCCCGTCCCCAACTTCTTCCT (SEQ ID NO: 2).

[0123] Example 4: Sensitivity detection

[0124] (1) The human parvovirus B19 international standard (NIBSC code: 12 / 208) was diluted to 10 using B19 virus negative plasma samples. 6 IU / mL, 10 5 IU / mL, 10 4 IU / mL, 10 3 IU / mL, 10 2 IU / mL, 0IU / mL.

[0125] (2) The detection method of the present invention was used to determine the lower limit of detection. The results showed that the method was able to detect viral nucleic acid as low as 100 IU / mL. The detection limit evaluation test results are shown in Figure 4 .

[0126] Example 5: PCR enhancer screening

[0127] Table 9 PCR enhancers

[0128]

[0129]

[0130] Among them, the detection results of the samples with the detection limit concentration of graphene nanosheets added are as follows: Figure 5A As shown in the figure, the detection results of samples with added betaine are as follows Figure 5B As shown in the figure, the detection results of the sample with the detection limit concentration of trehalose added are as follows Figure 5C As shown in the figure, the detection results of samples with the detection limit concentration of BSA added are as follows Figure 5D As shown, the detection results of the sample with the detection limit concentration of the added single-stranded binding protein are as follows Figure 5E As shown in the figure, the detection results of the sample with the detection limit concentration of dimethyl sulfoxide (DMSO) added are as follows Fig. 5F As shown, the detection results of the sample with the detection limit concentration of tetramethylammonium chloride (TMAC) added are as follows Figure 5G As shown in the figure, the detection results of the sample with the detection limit concentration of formamide added are as follows Figure 5H As shown in the figure, the detection results of the sample with the detection limit concentration of glycerol added are as follows Fig.5I As shown in Figure 3, comprehensive comparison shows that the addition of graphene nanosheets, betaine, trehalose, BSA or single-stranded binding protein has better amplification efficiency.

[0131] Example 6: Optimization of PCR Enhancer Concentration

[0132] Table 10 Optimization of PCR enhancer concentration

[0133] Serial number PCR enhancer name Concentration 1 Concentration 2 Concentration 3 Concentration 4 Concentration 5 1 Graphene nanosheets 0.005w / w% 0.001w / w% 0.005w / w% 0.01w / w% 0.05w / w% 2 Betaine 0.1M 0.5M 1.7M 3M 5M 3 Trehalose 0.05M 0.1M 0.5M 1M 5M 4 BSA 0.1mg / mL 0.2mg / mL 0.8mg / mL 1mg / mL 2mg / mL 5 Single-chain binding protein 0.5ng / μL 1ng / μL 5ng / μL 15ng / μL 20ng / μL

[0134] The above PCR enhancer concentrations are all final concentrations. The test results of samples with optimized graphene nanosheet concentrations are as follows: Figures 6A to 6E As shown in Figure 2, the test results of samples with optimized betaine concentration are as follows: Figures 7A to 7E As shown in Figure 2, the test results of samples with optimized trehalose concentration are as follows: Figures 8A to 8E As shown in Figure 2, the test results of samples with optimized BSA concentration are as follows: Figures 9A to 9E As shown, the results of the sample test with optimized concentration of single-stranded binding protein are as follows Figures 10A to 10E As shown in the figure, comprehensive comparison shows that 0.001-0.01w / w% graphene nanosheets, 0.5-3M betaine, 0.1-1M trehalose, 0.2-1mg / mL BSA, and 1-15ng / μL single-stranded binding protein have better amplification efficiency.

[0135] Example 7: Comparison of PCR results before and after addition of PCR enhancer

[0136] (1) Human parvovirus B19 international standard (NIBSC code: 12 / 208) was diluted to 100 IU / mL using B19 virus negative plasma samples.

[0137] (2) The samples with the detection limit concentration were tested using a PCR reaction system with the addition of a PCR enhancer (the method established by the present invention, i.e., the experimental group) and a reaction system without the addition of a PCR enhancer (the control group). The experimental group and the control group only added an enhancer, and the concentrations of other components were the same. The results of the experimental group are shown in Fig.11A ,Depend on Figure 11A-11B It can be seen that the method established by the present invention (adding PCR enhancer) detected that the test results of the samples with a concentration of 100 IU / mL were all positive (10 / 10), and the results of the control group were shown in Fig. 11B The results of the control group without the addition of the enhancer and the samples with a concentration of 100 IU / mL were all negative (0 / 10). The method established in the present invention significantly improves the sensitivity.

[0138] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A kit for rapid quantitative detection of human parvovirus B19, characterized in that: The kit includes a B19 primer-probe mixture, a B19 enzyme mixture and a B19 PCR reaction solution; Wherein, the B19 PCR reaction solution includes a PCR enhancer, and the PCR enhancer includes a nanomaterial PCR enhancer, a small molecule chemical PCR enhancer and a protein PCR enhancer.

2. The kit according to claim 1, characterized in that The PCR enhancer includes one or more of graphene nanosheets, betaine, trehalose, BSA and single-stranded binding protein; Preferably, the PCR enhancer comprises one or more of 0.001-0.01 w / w% graphene nanosheets, 0.5-3 M betaine, 0.1-1 M trehalose, 0.2-1 mg / mL BSA, and 1-15 ng / μL single-stranded binding protein; More preferably, the PCR enhancer comprises one or more of 0.01 w / w% graphene nanosheets, 1.7 M betaine, 0.5 M trehalose, 0.8 mg / mL BSA and 5 ng / μL single-stranded binding protein.

3. The kit according to claim 1 or 2, characterized in that The kit further comprises one or more of a B19 negative quality control product, a B19 weak positive quality control product, a B19 positive quality control product, a B19 quantitative standard product, and a B19 internal standard quality control product; Among them, the B19 weak positive quality control product and the B19 positive quality control product are pseudovirus particles containing the nucleotide sequence shown in SEQ ID NO: 1; the B19 internal standard quality control product is a plasmid containing the nucleotide sequence shown in SEQ ID NO:

2.

4. The kit according to any one of claims 1 to 3, characterized in that The B19 primer-probe mixture includes an upstream primer B19-F having a nucleotide sequence as shown in SEQ ID NO:3, a downstream primer B19-R having a nucleotide sequence as shown in SEQ ID NO:4, and a probe B19-P having a nucleotide sequence as shown in SEQ ID NO:5; the B19 primer-probe mixture preferably also includes an upstream primer NC-F having a nucleotide sequence as shown in SEQ ID NO:6, a downstream primer NC-R having a nucleotide sequence as shown in SEQ ID NO:7, and a probe NC-P having a nucleotide sequence as shown in SEQ ID NO:8; The 5' end of the probe is labeled with any one of the fluorescent dyes FAM, VIC, ROX, and CY5, and the 3' end of the probe is labeled with the quenching fluorescent dye BHQ.

5. The kit according to any one of claims 1 to 4, characterized in that The B19 PCR reaction solution further comprises one or more of 5×Hotstart Taq PCR Buffer, dATP, dGTP, dCTP, dTTP and dUTP; Preferably, the B19 PCR reaction solution further comprises 5×Hotstart Taq PCR Buffer, 100-600 μM dATP, 100-600 μM dGTP, 100-600 μM dCTP, 50-300 μM dTTP and 50-300 μM dUTP; More preferably, the B19 PCR reaction solution further comprises 5×Hotstart Taq PCR Buffer, 200 μM dATP, 200 μM dGTP, 200 μM dCTP, 200 μM dTTP and 200 μM dUTP.

6. The kit according to any one of claims 1 to 5, characterized in that The B19 enzyme mixture contains HotstartTaq DNA Polymerase and Uracil DNA Glycosylase, Heat-labile; Preferably, the B19 enzyme mixture comprises 0.005-0.5U / μL Hotstart Taq DNA Polymerase and 0.005-0.5U / μL Racil DNA Glycosylase, Heat-labile; More preferably, the B19 enzyme mixture comprises 0.1 U / μL Hotstart Taq DNA Polymerase and 0.04 U / μL Racil DNA Glycosylase, Heat-labile.

7. A primer-probe combination, characterized in that: The primer-probe combination includes an upstream primer B19-F having a nucleotide sequence as shown in SEQ ID NO:3, a downstream primer B19-R having a nucleotide sequence as shown in SEQ ID NO:4, and a probe B19-P having a nucleotide sequence as shown in SEQ ID NO:5; the primer-probe combination preferably also includes an upstream primer NC-F having a nucleotide sequence as shown in SEQ ID NO:6, a downstream primer NC-R having a nucleotide sequence as shown in SEQ ID NO:7, and a probe NC-P having a nucleotide sequence as shown in SEQ ID NO:8; The 5' end of the probe is labeled with any one of the fluorescent dyes FAM, VIC, ROX, and CY5, and the 3' end of the probe is labeled with the quenching fluorescent dye BHQ.

8. A method for rapid quantitative detection of human parvovirus B19, characterized in that: The method comprises the following steps: Performing PCR detection on the sample to be tested using the kit according to any one of claims 1 to 6 or the primer-probe combination according to claim 7; Preferably, the sample to be tested is a biological sample containing genomic DNA, preferably whole blood or oral mucosal exfoliated cells.

9. The method according to claim 8, characterized in that The reaction conditions of the PCR detection are: 37°C UDG enzyme reaction for 2 minutes, 95°C pre-denaturation for 5 minutes; 95°C denaturation for 15 seconds, 60°C annealing and extension for 30 seconds, a total of 45 cycles.

10. Use of the kit according to any one of claims 1 to 6 or the primer-probe combination according to claim 7 in detecting human parvovirus B19; wherein, The use is for non-diagnostic and non-therapeutic purposes.

Images