Electrode for detecting protein substances, preparation method of electrode, biosensor and microflow detector

Abstract

The invention provides an electrode for detecting protein substances, a preparation method of the electrode, a biosensor and a microflow detector. The electrode comprises a carbon electrode, a Prussian blue layer and a gold nanoparticle layer which are stacked in sequence, the side, away from the Prussian blue layer, of the gold nanoparticle layer is modified with an aptamer, the particle size of gold nanoparticles of the gold nanoparticle layer ranges from 20 nm to 100 nm, and the mass of the gold nanoparticles on the Prussian blue layer per unit area ranges from 4 micrograms / cm < 2 > to 5 micrograms / cm < 2 >; the Prussian blue layer is formed on one side of the carbon electrode by adopting a cyclic voltammetry method, the cyclic voltammetry method adopts a three-electrode system to perform continuous scanning for 20-40 circles in a potential range of-0.2 V-0. 9V, an electrolyte comprises 5-25 mM of potassium ferricyanide, 5-25 mM of ferric chloride, 0.12-0.25 M of hydrochloric acid, 5-50 mM of potassium chloride and the balance of water, and the molar ratio of the potassium ferricyanide to the ferric chloride is 1: 1. The electrode has more excellent sensitivity and stability, and detection of pg / mL-magnitude ultralow-concentration protein substances is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of electrochemical biosensors, and in particular relates to an electrode for detecting protein substances and a preparation method thereof, a biosensor and a microfluidic detector. Background Art

[0002] Immunoassays are gradually becoming the most popular platform for clinical testing and biosensors. Immunological techniques selectively respond to specific biological targets by capturing specific interactions between probes and targets. Based on immune recognition, a variety of detection mechanisms for target biomolecules have been developed and studied. Based on the response mechanism, these methods can be divided into mechanical, optical, and electrochemical. Since the first report of immunoassays using nucleic acid aptamers, the use of aptamers instead of antibodies has received widespread attention in the field of immunoassays because it has some outstanding advantages over antibodies. One of the most prominent advantages of aptamers is that they do not have many restrictions on target substances and can be used to detect a variety of substances. As a platform technology similar to antibodies, aptamers have been widely used in food testing, environmental analysis, clinical diagnosis, etc.

[0003] For example, interleukin-6 (IL-6) is a multifunctional cytokine that regulates immune responses, hematopoiesis, acute phase responses, and inflammation, and its overexpression is associated with some inflammatory conditions as well as many types of cancers, such as head and neck cancer, colorectal cancer, and gastrointestinal cancer. Detection mechanisms for IL-6 include mechanical, optical, and electrochemical methods. Previous wearable sensing systems were limited to analyzing substances in the micromolar to millimolar range. However, due to the low content of IL-6 in sweat and the high number of interferents, a sensor suitable for non-invasive, rapid, and sensitive detection is needed.

[0004] At present, the detection of proteins in the human body is mainly in plasma, and the sampling method is invasive and highly dependent on expensive immunoassay methods of biological instruments. In recent years, with the growing demand for real-time monitoring of personal health status and the development of personalized medical devices, electrochemical sensors have received widespread attention due to their portability, good performance, simple equipment and low cost. In the field of non-invasive sensing of human proteins, Gao Wei's team at California Institute of Technology proposed a mechanically flexible and fully integrated sensor array for multiplexed in situ sweat analysis, which can selectively measure sweat metabolites (such as glucose and lactate) and electrolytes (such as sodium ions and potassium ions) as well as skin temperature (to calibrate the response of the sensor) at the same time, and can evaluate the physiological state of the subject in real time. The platform supports a wide range of personalized diagnosis and physiological monitoring applications. Although they have achieved sensing detection of CRP protein, its sensitivity is still at the order of ng / mL, and the signal molecule is chemically bound to the electrode. The signal intensity is at the order of µA, which is easily interfered by other signals. The use of antibodies to achieve antigen-antibody binding sensing is also limited by the poor chemical stability of the antibodies themselves, narrow detection range, and difficulty in synthesis. Therefore, the sensitivity and stability of protein detection sensors need to be further optimized and improved, and the process methods can also continue to be improved.

[0005] For human protein detection, the sensor unit needs to be able to detect ultra-low concentrations of the order of pg / mL. The commonly used detection methods reported include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay, and time-resolved fluorescence assay. However, most of these methods are costly, time-consuming, low in sensitivity and specificity, or require professional operators. Their main defects are: (1) The detection of proteins in the human body is mainly sampled from plasma, and the sampling method is invasive and highly dependent on expensive immunoassay methods of biological instruments; (2) The sensor detects a relatively single substance and cannot be universally applied; (3) Previous wearable sensor systems are limited to analyzing substances in the micromolar to millimolar range and have limited sensitivity; (4) Optical sensors are not easy to integrate and are difficult to make portable; (5) Immunoassay methods using antigens and antibodies have high requirements for the detection environment and limited sensitivity.

[0006] Since the content of human sweat protein is very low, traditional analytical methods are not suitable for non-invasive, rapid and sensitive detection requirements. Therefore, it is very important to prepare a flexible electrochemical biosensor that can be used with wearable devices to detect the protein concentration in sweat. Summary of the invention

[0007] The present invention aims to solve one of the technical problems in the prior art at least to a certain extent. To this end, one object of the present invention is to provide an electrode for detecting protein substances and a preparation method thereof, a biosensor and a microfluidic detector.

[0008] In a first aspect of the present invention, an electrode for detecting protein substances is provided, the electrode comprising: a carbon electrode, a Prussian blue layer and a gold nanoparticle layer stacked in sequence, an aptamer is modified on the side of the gold nanoparticle layer away from the Prussian blue layer, the particle size of the gold nanoparticles in the gold nanoparticle layer is 20nm-100nm, and the mass per unit area of ​​the gold nanoparticles on the Prussian blue layer is 4μg / cm 2 -5μg / cm 2 ; The Prussian blue layer is formed on one side of the carbon electrode by cyclic voltammetry. The cyclic voltammetry uses a three-electrode system to perform continuous scanning for 20 to 40 cycles in the potential range of -0.2 V to 0.9 V. The electrolyte includes 5 mM to 25 mM potassium ferrocyanide, 5 mM to 25 mM ferric chloride, 0.12 M to 0.25 M hydrochloric acid, 5 mM to 50 mM potassium chloride and the remainder water. The molar ratio of the potassium ferrocyanide to the ferric chloride is 1:1.

[0009] According to the electrode for detecting protein substances of the present invention, reference can be made to Figure 1 The Prussian blue layer 20 is formed on the carbon electrode 10 and prepared by cyclic voltammetry. The preparation process parameters of the cyclic voltammetry are controlled within the above range. The Prussian blue layer 20 obtained after deposition completely covers the substrate electrode and has an obvious CV peak current in the PBS solution. A gold nanoparticle layer 30 is then deposited on the Prussian blue layer 20, and the particle size of the gold nanoparticles is controlled to be 20nm~100nm. The mass per unit area of ​​the gold nanoparticles on the Prussian blue layer 20 is 4μg / cm 2 -5μg / cm 2 It can not only effectively improve the conductivity and electrocatalytic activity of the electrode material surface, but also the long-term electrochemical stability of the electroactive gold nanoparticles is largely guaranteed, thereby achieving relatively excellent electrochemical sensing detection performance. One side of the Prussian blue layer 20 is modified with an aptamer 40, so that low-content target substances can be detected.

[0010] The electrode of the present invention is stacked by a carbon electrode 10, a Prussian blue layer 20 and a gold nanoparticle layer 30, and the Prussian blue layer 20 and the gold nanoparticle layer 30 are controlled to meet the above conditions, so that the electrode has more excellent sensitivity and stability, especially realizing the detection of ultra-low concentration protein substances of the pg / mL level, which can meet the monitoring needs of ultra-low content protein substances, and the electrode does not require any pretreatment or additional supporting equipment before use, has good biocompatibility, and can be used as a high-sensitivity sensing patch electrode. It is a non-invasive electrode and can be further integrated into a wearable sensor in combination with a back-end circuit, and has the potential to monitor the sweat protein content in real time.

[0011] According to the electrode for detecting protein substances of the present invention, the aptamer sequence is 5′Amino C6 / TGCGGTTGTAGTACTCGTGGCCG / Thiol C6 SH 3′, which is used to detect interleukin-6.

[0012] According to the electrode for detecting protein substances of the present invention, the aptamer sequence is 5′Amino C6 / CTTCCACGCTCGTATTGTGCTTAGT / Thiol C6 SH 3′, which is used to detect human serum albumin; According to the electrode for detecting protein substances of the present invention, the aptamer sequence is 5′Amino C6 / ATACCAGCTTATTCAATTACAGTAGTGAGGGGTCCGTCGT GGGGTAGTTGGGTCGTGGAGATAGTAAGTGC / Thiol C6 SH 3′, used to detect retinol binding protein 4.

[0013] According to the electrode for detecting protein substances of the present invention, the three-electrode system adopted in the cyclic voltammetry method uses the carbon electrode as the working electrode, the silver / silver chloride electrode as the reference electrode, and the platinum wire electrode as the counter electrode.

[0014] The electrode for detecting protein substances according to the present invention can be used to detect protein substances at the pg / mL level in sweat.

[0015] In a second aspect of the present invention, the present invention provides a method for preparing the above-mentioned electrode for detecting protein substances, which can be referred to Figure 1 , the method comprising: (1) forming the Prussian blue layer on one side of the carbon electrode by cyclic voltammetry; (2) depositing gold nanoparticles on the formed Prussian blue layer by a constant potential electrochemical deposition method to form a gold nanoparticle layer; (3) applying the aptamer solution to the wet gold nanoparticle layer for reaction, washing and drying to obtain the aptamer-modified gold nanoparticle layer; (4) Applying a blocking solution to one side of the gold nanoparticle layer modified with the aptamer for blocking treatment.

[0016] First, the Prussian blue layer is formed on one side of the carbon electrode by cyclic voltammetry; then, gold nanoparticles are deposited on the formed Prussian blue layer by constant potential electrochemical deposition, in the AuNPs deposition stage, Au ions are reduced to gold nanoparticles, and in the diffusion stage, gold ions in the solution are transferred to the electrode surface in the liquid phase by migration, diffusion and convection, thereby forming a gold nanoparticle layer; then, the aptamer solution is applied to the wet gold nanoparticle layer for reaction, and the reaction is carried out after washing and drying to obtain the aptamer-modified gold nanoparticle layer; finally, a blocking solution is applied to one side of the gold nanoparticle layer modified with the aptamer for blocking treatment, thereby blocking the remaining active sites on the gold nanoparticles, and the unbound blocking solution is washed away with deionized water.

[0017] It should be noted that the carbon electrode is a conventional device in the art, and those skilled in the art can select the preparation process of the carbon electrode according to actual conditions, for example, the carbon electrode can be prepared by screen printing a conductive paste on a flexible substrate such as polyimide.

[0018] According to the preparation method of the electrode for detecting protein substances of the present invention, the electrolyte used in the constant potential electrochemical deposition method is a 1mM-5mM aqueous solution of chloroauric acid, the deposition potential is -0.2V~-0.5V, and the electrodeposition time is 400s~500s. By adopting the above electrochemical deposition process parameters, gold nanoparticles with a particle size of 20nm~100nm can be obtained, and a gold nanoparticle layer of a certain thickness can be formed, thereby improving the conductivity and electrocatalytic activity of the electrode material surface.

[0019] According to the method for preparing the electrode for detecting protein substances of the present invention, in step (2), the constant potential electrochemical deposition method adopts a three-electrode system, the three-electrode system uses a Pt wire electrode as a counter electrode, a silver / silver chloride electrode as a reference electrode, and the carbon electrode / Prussian blue layer obtained in step (1) as a working electrode.

[0020] According to the method for preparing an electrode for detecting protein substances of the present invention, in step (3), the aptamer solution is prepared by dissolving the aptamer in a buffer solution, and the concentration of the aptamer solution is 5 µM to 20 µM. For example, the concentration of the aptamer is 5 µM, 10 µM, 15 µM, 20 µM, etc., or a range between any two of the above values.

[0021] Preferably, the buffer is selected from TE buffer.

[0022] According to the method for preparing the electrode for detecting protein substances of the present invention, in step (3), the reaction temperature is 4°C to 25°C and the reaction time is 5h to 8h. By controlling the reaction temperature and time within the above range, it is more conducive to the modification of the aptamer on the gold nanoparticles.

[0023] According to the method for preparing the electrode for detecting protein substances of the present invention, in step (4), the blocking solution includes 6-mercapto-1-hexanol and bovine serum albumin.

[0024] According to the method for preparing the electrode for detecting protein substances of the present invention, in step (4), the blocking time is 1 hour to 2 hours. By controlling the blocking time, the active sites of the unmodified gold nanoparticles can be completely blocked.

[0025] In a third aspect of the present invention, the present invention provides a biosensor, which can be referred to Figure 2 The biosensor includes a working electrode 100, a counter electrode 200 and a reference electrode 300, wherein the working electrode is the electrode for detecting albumin-like substances. Thus, the biosensor can detect ultra-low concentration protein substances at the pg / mL level, and the sensor has the advantages of being non-invasive, miniaturized, portable, and integrable. The research is expected to be further developed into a wearable detection device in combination with microfluidics and other technologies, and due to the extremely low detection limit of the sensor, it is expected to be further developed for the detection of hormones and proteins in human sweat as a clinical auxiliary diagnosis method.

[0026] Those skilled in the art will appreciate that the biosensor also includes conventional components such as a packaging layer and leads. Those skilled in the art may select other conventional components according to actual needs, which will not be described in detail here.

[0027] It should be noted that there is no particular limitation on the shapes of the three electrodes, and they may be circular, rectangular, etc., for example.

[0028] In a fourth aspect of the present invention, the present invention provides a microfluidic detector, which can be referred to Figure 3 The microfluidic detector comprises a base layer 1, an electrode layer 2, an insulating layer 3, a fluidic layer 4 and a covering layer 5 which are stacked in sequence; the electrode layer 2 is composed of a plurality of groups of the above-mentioned biosensors, the fluidic layer 4 and the insulating layer 3 are provided with sensing through holes 6 at positions corresponding to the biosensors, the covering layer 5 and one end of the fluidic layer 4 are provided with sweat inlets 7 at positions corresponding to the ends thereof, the fluidic layer 4, the insulating layer 3 and the other end of the base layer 1 are provided with sweat outlets 8, the fluidic layer 4 is provided with grooves 9 along the sweat inlet 7 to the sweat outlet 8, and the grooves 9 are connected to the sensing through holes 6.

[0029] The above-mentioned microfluidic detector provided by the present invention realizes the integration of sweat collection, storage and detection, and can detect multiple signals at the same time to ensure the accuracy and uniformity of the signals. The closed system can also enable the entire microfluidic system to accurately measure the concentration of the substance to be measured without considering the problem of sweat volatilization. The electrode integrated microfluidic system becomes more practical. By optimizing the shape of the microfluidic channel and modifying the surface to make it separate, the sweat in and out time can be controlled to realize the detection of trace proteins in sweat at different times. The design of the arrayed pattern can realize the control of the timing of detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 It is a schematic diagram of the preparation process of the electrode for detecting protein substances provided by the present invention; Figure 2 is a schematic diagram of the structure of a biosensor according to an embodiment of the present invention; Figure 3 is a schematic structural diagram of a microfluidic detector according to an embodiment of the present invention; Figure 4 It is a schematic diagram of the structure of the fluidic layer in the microfluidic detector provided by the present invention; Figure 5 is a SEM image of the carbon electrode / Prussian blue electrode prepared in Example 1 of the present invention after gold nanoparticles are deposited; Figure 6 This is a schematic diagram of the principle of detecting protein signal response provided by Example 1 of the present invention; Figure 7 is a SWV curve diagram of the biosensor prepared in Example 1 of the present invention under different human serum albumin concentrations; Figure 8 This is a relationship diagram between the SWV peak current and the human serum albumin concentration obtained after data processing in Example 1 of the present invention. DETAILED DESCRIPTION

[0032] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. The present invention is described below with reference to specific embodiments. It should be noted that these embodiments are merely illustrative and do not limit the present invention in any way.

[0033] Example 1 The preparation process of the electrode for detecting protein substances in this embodiment is as follows: (1) The carbon electrode was prepared by printing TJ-6B soft board conductive carbon ink on a polyimide flexible substrate using screen printing technology. Specifically, the electrode carbon paste was prepared by mixing acrylic resin liquid (37wt%), ethanol, propylene glycol methyl ether, conductive carbon black, dispersant, K155 defoamer, and deionized water in a mass ratio of 30:9:8:25:0.5:0.2:27, and then adding a regulator. The regulator formula was: V610 emulsion, conductive metal powder, W35 water-based wax, triethanolamine, corrosion inhibitor, and K155 defoamer in a mass ratio of 10:10:5:1:1:0.3.

[0034] (2) Prussian blue was deposited on the carbon electrode prepared in step (1) by electrochemical deposition. Prussian blue was synthesized by cyclic voltammetry. First, an electrolyte of 5 mM potassium ferrocyanide and 5 mM ferric chloride (molar ratio of 1:1) was prepared. The electrolyte also contained 0.13 M hydrochloric acid solution and 5 mM potassium chloride. The carbon electrode obtained in step (1) was then immersed in the above electrolyte. A three-electrode system (with the carbon electrode as the working electrode, the silver / silver chloride electrode as the reference electrode, and the platinum wire electrode as the counter electrode) was used to continuously scan 20 cycles in a certain potential range of -0.2-0.9 V to construct a carbon electrode / Prussian blue electrode.

[0035] (3) Using a constant potential electrochemical deposition method, gold nanoparticles are deposited on the surface of the carbon electrode / Prussian blue electrode obtained in step (2). The SEM image of the obtained carbon electrode / Prussian blue electrode after the gold nanoparticles are deposited shows Figure 5 ,from Figure 5 It can be seen that the surface of the carbon electrode with microstructure is uniformly covered with Prussian blue and uniformly deposited with gold nanoparticles.

[0036] 1 mM chloroauric acid (HAuCl4) was prepared with deionized water, and then AuNPs were deposited on the working electrode surface using electrochemical deposition technology using a three-electrode system (Pt wire electrode-counter electrode, silver / silver chloride (Ag / AgCl) electrode-reference electrode, carbon electrode / Prussian blue electrode-working electrode). The deposition potential was selected to be -0.3 V, and the electrodeposition time was 500 s. During the AuNPs deposition stage, Au ions were reduced to gold nanoparticles, and during the diffusion stage, the gold ions in the solution were transferred to the electrode surface in the liquid phase by migration, diffusion, and convection, and finally a carbon electrode / Prussian blue layer / gold nanoparticle layer electrode was obtained.

[0037] In order to reduce the influence of concentration polarization on the deposition during the deposition process, the chloroauric acid solution was continuously stirred with a magnetic stirrer (speed of 200 rmin) -1After the deposition, the electrode was rinsed with deionized water and soaked in deionized water for 10 min to remove the residual chloroauric acid solution on the surface. After being blown dry with an ear-cleaning bulb, it was sealed in a culture dish and stored for later use.

[0038] (4) Aptamer-modified gold nanoparticles This example uses dry aptamer powder (aptamer sequence 5′Amino C6 / TGCGGTT GTAGTACTCGTGGCCG / Thiol C6 SH 3′, Shanghai Bioengineering), diluted to a concentration of 100 μM by TE buffer as the original storage solution. The specific process of preparing the original storage solution of the aptamer is as follows: the aptamer is 3.2 nmol, and 31.6 μL TE buffer is added with a pipette to dilute the aptamer to prepare an original storage solution with a concentration of 100 μM. Since the thiol groups in the aptamer may cross-link together to form disulfide bonds and affect the modification effect, TCEP is used to reduce the thiol groups in the aptamer in the experiment. The specific method is to first add 3.3 μL 100 mM TCEP solution to 96.7 μL 100 μM of the above nucleic acid aptamer solution, mix well and react at room temperature for 1 hour, then dilute with TE buffer to a 10 μM aptamer concentration for use, and store in a refrigerator at 4°C.

[0039] After the aptamer is prepared, the aptamer is chemically bound to the carbon electrode / Prussian blue layer / gold nanoparticle layer electrode obtained in step (3). First, 20 μL of 10 μM aptamer solution is dripped onto the surface of the gold nanoparticle layer under wet conditions (the electrode surface is always kept wet), and the reaction is carried out at 4°C for 7 hours. After that, the unbound aptamer solution is rinsed off with deionized water, and the electrode surface is allowed to dry to obtain an aptamer-modified electrode.

[0040] (5) Closed processing Use a pipette to transfer 20 μL of 1 mM MCH solution to the ligand-modified electrode obtained in step (4). Allow the binding reaction to proceed for 1.5 h at room temperature to block the remaining active sites on the gold nanoparticles. Rinse away the unbound MCH with deionized water, blow dry with an ear bulb, and store in a refrigerator at 4°C.

[0041] The preparation of the biosensor in this example is as follows: refer to Figure 2 The shape and structure of the biosensor are as follows: the working electrode is the electrode for detecting protein substances prepared in Example 1, and the counter electrode is also obtained by printing TJ-6B soft board conductive carbon ink on a polyimide flexible substrate using screen printing technology, and Ag / AgCl is screen-printed as a reference electrode.

[0042] The detection performance of the biosensor prepared in Example 1 for human serum albumin is tested as follows: First, prepare human serum albumin solutions (produced by Anbaisheng Diagnostics Technology Co., Ltd.) with different concentration gradients. The concentrations are as follows: 0.1 pg / mL, 1 pg / mL, 10 pg / mL, 100 pg / mL, 1 ng / mL and 10 ng / mL, and the dissolving liquid is PBS solution. If it can be shown in the experiment that PBS has no interference effect on the electrode surface (the detection electrical signal increases or remains unchanged with the addition of PBS), and the signal decreases significantly when the target is present, it means that the detection target is specifically recognized. The detection principle is as follows Figure 6 shown.

[0043] The present invention eliminates the interference of PBS on the electrode signal before testing. The specific method is to soak the electrode in PBS solution for 30 min, and then perform square wave voltammetry (SWV) test. The SWV parameters are set as follows: potential is -0.4-0.4 V, frequency is 30 Hz, step potential is 4 mV, and amplitude is 25 mV. After recording the electrical signal curve, soak it in PBS solution for 30 minutes and perform SWV test. Repeat the operation until the SWV peak signal rises or remains basically unchanged compared with the previous time. Next, start the test from low concentration to high concentration. Each time, use a pipette to transfer 20 μL of human serum albumin solution of a certain concentration (pipetted from low to high) to the surface of the prepared working electrode, react for 30 minutes, then rinse the target solution with deionized water, blow dry the working electrode with an ear-cleaning bulb, perform SWV detection and record the electrical signal.

[0044] The results are as follows Figure 7 and Figure 8 As shown, from Figure 7 and Figure 8 It can be seen that when the concentration of human serum albumin is between 0.1 pg / mL and 100 pg / mL, as the concentration of human serum albumin increases, the SWV peak current decreases, and the electrical signal value is linearly related to the logarithm of the concentration of human serum albumin, that is, I=103.7-21.2logC, where the unit of I is μA and the unit of C is g / mL. It can be shown that the Prussian blue-based aptamer sensing electrode was successfully prepared, and the sensitivity of the sensor is good. Based on the slope of the standard deviation ratio of 3 times the blank sample, it can be calculated that the detection limit of human serum albumin in this experimental method is less than 0.1pg / mL. The above results show that the flexible aptamer sensor can extremely sensitively identify human serum albumin and has an extremely low detection limit and a wide detection range.

[0045] Example 2 The electrode preparation process of Example 2 is the same as that of Example 1, and the aptamer is replaced with an aptamer for detecting interleukin-6 (produced by Beijing Bolide Biotechnology Co., Ltd.), and the sequence is: 5′Amino C6 / CTTCCACGCTCGTATTGTGCTTAGT / Thiol C6 SH 3′, Shanghai Biotech. The concentrations of interleukin-6 are as follows: 0.1 pg / mL, 1 pg / mL, 10 pg / mL, 100 pg / mL, 1 ng / mL and 10 ng / mL, and the dissolving solution is PBS solution. Before the test, the interference of PBS on the electrode signal is eliminated. The specific method is to first soak the electrode in PBS solution for 30 minutes, then perform SWV test, record the electrical signal curve, and then soak it in PBS solution for 30 minutes, perform SWV test, and repeat the operation until the SWV peak signal increases or remains basically unchanged compared with the previous time. Start the test from low concentration to high concentration. Use a pipette to transfer 20 μL of interleukin-6 solution of a certain concentration (from low to high) to the prepared working electrode surface each time. Allow the reaction to proceed for 30 minutes. After that, rinse off the target solution with deionized water, blow dry the working electrode with an ear bulb, perform SWV detection, and record the signal.

[0046] Example 2 also achieved the detection of interleukin-6 at the picogram level.

[0047] Example 3 The electrode preparation process of Example 3 is the same as that of Example 1, and the aptamer is replaced with an aptamer for detecting retinol binding protein 4 (produced by Shanghai Yubo Biotechnology Co., Ltd.), and the sequence is: 5′Amino C6 / ATACCAGCTTATTCAATTACAGTAGTGAGGGGTCCGTCGTGGGGTAGTTGGGTCGTGGAGATAGTAAGTGC / Thiol C6 SH 3′, Shanghai Biotech. The concentrations of retinol binding protein 4 protein are as follows: 0.1 pg / mL, 1 pg / mL, 10 pg / mL, 100 pg / mL, 1 ng / mL and 10 ng / mL, and the dissolving solution is PBS solution. Before the test, the interference of PBS on the electrode signal should also be eliminated, and the specific experimental method is the same as that for detecting human serum albumin.

[0048] Example 3 also achieved the detection of retinol binding protein 4 at the picogram level.

[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. An electrode for detecting protein substances, characterized in that: include: A carbon electrode, a Prussian blue layer and a gold nanoparticle layer are stacked in sequence, an aptamer is modified on the side of the gold nanoparticle layer away from the Prussian blue layer, the particle size of the gold nanoparticles in the gold nanoparticle layer is 20nm~100nm, and the mass per unit area of ​​the gold nanoparticles on the Prussian blue layer is 4μg / cm 2 -5μg / cm 2 ; The Prussian blue layer is formed on one side of the carbon electrode by cyclic voltammetry. The cyclic voltammetry uses a three-electrode system to perform continuous scanning for 20 to 40 cycles in the potential range of -0.2 V to 0.9 V. The electrolyte includes 5 mM to 25 mM potassium ferrocyanide, 5 mM to 25 mM ferric chloride, 0.12 M to 0.25 M hydrochloric acid, 5 mM to 50 mM potassium chloride and the remainder water. The molar ratio of the potassium ferrocyanide to the ferric chloride is 1:

1.

2. The electrode according to claim 1, characterized in that: The aptamer sequence is 5′Amino C6 / CTTCCACGCTCGTATTGTGCTTAGT / Thiol C6 SH 3′, which is used to detect human serum albumin; Or, the aptamer sequence is 5′Amino C6 / TGCGGTTGTAGTACTCGTG CCG / Thiol C6 SH 3′, for detection of interleukin-6; Or, the aptamer sequence is 5′Amino C6 / ATACCAGCTTATTCAATTACA GTAGTGAGGGGTCCGTCGTGGGGTAGTTGGGTCGTGGAGATAGTAAGTGC / Thiol C6 SH 3′, used to detect retinol binding protein 4.

3. The electrode according to claim 1, characterized in that: The three-electrode system used in the cyclic voltammetry method has the carbon electrode as the working electrode, the silver / silver chloride electrode as the reference electrode, and the platinum wire electrode as the counter electrode.

4. The electrode according to any one of claims 1 to 3, characterized in that: It can be used to detect protein substances at the pg / mL level. Preferably, it can be used to detect protein substances at the pg / mL level in sweat.

5. A method for preparing the electrode for detecting protein substances according to any one of claims 1 to 4, characterized in that: include: (1) forming the Prussian blue layer on one side of the carbon electrode by cyclic voltammetry; (2) depositing gold nanoparticles on the formed Prussian blue layer by a constant potential electrochemical deposition method to form a gold nanoparticle layer; (3) applying the aptamer solution to the wet gold nanoparticle layer for reaction, washing and drying to obtain the aptamer-modified gold nanoparticle layer; (4) Applying a blocking solution to one side of the gold nanoparticle layer modified with the aptamer for blocking treatment.

6. The method according to claim 5, characterized in that: In step (2), the electrolyte used in the constant potential electrochemical deposition method is a 1 mM to 5 mM aqueous solution of chloroauric acid, the deposition potential is -0.2 V to -0.5 V, and the electrodeposition time is 400 s to 500 s; And / or, the constant potential electrochemical deposition method adopts a three-electrode system, wherein the three-electrode system has a Pt wire electrode as a counter electrode, a silver / silver chloride electrode as a reference electrode, and the carbon electrode / Prussian blue layer obtained in step (1) as a working electrode.

7. The method according to claim 5 or 6, characterized in that: In step (3), the aptamer solution is prepared by dissolving the aptamer in a buffer solution, and the concentration of the aptamer solution is 5 µM to 20 µM; Preferably, the buffer is selected from TE buffer; And / or, the reaction temperature is 4°C to 25°C, and the reaction time is 5h to 8h.

8. The method according to claim 5 or 6, characterized in that: In step (4), the blocking solution includes 6-mercapto-1-hexanol and bovine serum albumin; And / or, the closure time is 1h~2h.

9. A biosensor, characterized in that: It comprises a working electrode, a counter electrode and a reference electrode, wherein the working electrode is the electrode for detecting protein substances according to any one of claims 1 to 4.

10. A microfluidic detector, characterized in that: It comprises a base layer, an electrode layer, an insulating layer, a fluidic layer and a covering layer stacked in sequence; the electrode layer is composed of a plurality of groups of biosensors as described in claim 9, the fluidic layer and the insulating layer are provided with sensing through holes at positions corresponding to the biosensors, the covering layer and one end of the fluidic layer are provided with sweat inlets at positions corresponding to the biosensors, the fluidic layer, the insulating layer and the base layer are provided with sweat outlets at the other ends, the fluidic layer is provided with grooves along the sweat inlet to the sweat outlet, and the grooves are connected to the sensing through holes.

Images