Liquid gate graphene transistor sensor for rapidly detecting cell factor IFN-gamma, preparation method and application thereof

Abstract

The invention discloses a liquid gate graphene transistor sensor for rapidly detecting a cell factor IFN-gamma, and a preparation method and application thereof. The sensor adopts an IFN-gamma aptamer to modify a gate on a liquid gate graphene field effect transistor (SSGT); during detection, after the aptamer on the grid captures an IFN-gamma target substance, the configuration is changed, the charge is changed, and then the Dirac point of a transfer curve is shifted, so that the target substance is detected respectively, and detection of IFN-gamma is finally realized by establishing a concentration model of a target system. According to the invention, the disadvantages of complex flow, insufficient adaptability in a multi-sample environment, lack of real-time monitoring capability and the like of the traditional detection means are solved, the rapid detection of one or more cytokines in blood can be realized through the combination and disassembly of the grids, the rapid detection method can be used for cell experiment detection and animal experiment detection, and the rapid detection method has a certain practical value.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedical detection, and in particular relates to a liquid-gate graphene transistor sensor for rapidly detecting cytokine IFN-γ, a preparation method and an application thereof. Background Art

[0002] Interferon (IFN-γ) is an important molecule in the immune system response, especially playing a key role in immune response and tumor immunotherapy. Changes in IFN-γ concentration can reflect changes in the body's immune status, so it has become one of the biomarkers for disease diagnosis and evaluation of immunotherapy effects. In immunotherapy, IFN-γ levels are often used to monitor the intensity of immune responses and evaluate treatment effects. Especially when treating PD-1 / PD-L1 immune checkpoint inhibitors, changes in IFN-γ levels can help evaluate the effectiveness of treatment. However, existing detection methods generally have problems such as cumbersome sample processing, long detection cycle, and high cost, which cannot meet the clinical needs for real-time and sensitive detection of cytokines.

[0003] Currently, commonly used cytokine detection methods include enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot (ELISpot) and polymerase chain reaction (PCR). These methods have high sensitivity and accuracy, but usually require high operating skills and expensive equipment, and are complex and time-consuming to operate, especially when dealing with body fluid samples such as blood, which are easily interfered with. In recent years, electrochemical detection methods have gradually become an emerging means of cytokine detection due to their advantages such as low cost, high sensitivity and simple equipment. As a new type of sensor, electrochemical field effect transistor (FET) has the characteristics of simple structure and low cost. Graphene field effect transistor (SGGT) further improves FET performance. Through graphene materials and electrolyte solution gates, the sensitivity and selectivity are significantly improved, making it show great potential in cytokine monitoring.

[0004] However, although electrochemical detection methods, especially SGGT sensors, have shown great advantages in cytokine detection, they still face some challenges. First, existing electrochemical sensors may be affected by nonspecific adsorption and interfering components in an environment with high background interference, especially in complex biological fluids (such as plasma, sweat and saliva), thereby reducing the accuracy and stability of the sensor. Secondly, most of the current electrochemical sensors require certain sample processing, such as dilution and filtration. Although these sensors can effectively detect at low concentrations, they still cannot fully meet the requirements of real-time and sample-free processing. In addition, although the sensitivity and detection limit of existing sensors are already high, it is still difficult to achieve accurate detection at extremely low cytokine concentrations in some cases. These problems make the existing technology still have certain technical bottlenecks in achieving high sensitivity, low detection limit, no interference, and no sample processing in real-time monitoring of cytokines. Therefore, the development of electrochemical sensors with higher sensitivity, stronger anti-interference ability and the ability to detect directly in untreated biological fluids is still a key issue that needs to be solved in current biosensor technology. Summary of the invention

[0005] In view of the problems of the above-mentioned prior art, the purpose of the present invention is to provide a liquid-gate graphene transistor sensor, preparation method and application thereof for rapid detection of cytokine IFN-γ; The sensor uses IFN-γ aptamers to modify the gate on the liquid-gate graphene field effect transistor (SGGT); During detection, the aptamer on the gate changes its configuration after capturing the IFN-γ target substance, resulting in a change in charge, and then generating a shift in the Dirac point of the transfer curve, thereby detecting the target substances separately, and relying on the establishment of a concentration model of the target system, ultimately achieving the detection of IFN-γ; The present invention overcomes the disadvantages of traditional detection methods such as complex processes, insufficient adaptability in a multi-sample environment, and lack of real-time monitoring capabilities, and can be used for rapid detection of one or more cytokines in the blood through the combination and disassembly of the gate, and can be used for cell experimental detection and animal experimental detection, and has certain practical value. The technical solution of the present invention is specifically described as follows.

[0006] The present invention provides a liquid-gate graphene transistor sensor for rapid detection of cytokine IFN-γ. The liquid-gate graphene transistor sensor comprises a substrate, a source electrode, a drain electrode and a gate electrode. The transistor channel covering the source and drain electrodes is a single-layer graphene, and the surface of the gate electrode is modified with a DNA aptamer that specifically recognizes IFN-γ. During detection, a sample solution to be tested containing or not containing the cytokine IFN-γ is used as an electrolyte solution, and the gate electrode is immersed in the electrolyte solution. After the DNA aptamer on the surface of the gate captures the IFN-γ target substance in the electrolyte, the configuration changes, resulting in a charge change, and a shift of the Dirac point of the transfer curve is generated, thereby realizing the electrochemical detection of IFN-γ.

[0007] In the present invention, the source and drain materials are independently selected from at least one of Au, Ag, and Cr, the gate is selected from any one of Cr / Au, Ag, Pt, Ag / AgCl electrodes, and glassy carbon electrodes; the substrate is selected from any one of glass, silicon wafer, or polyimide film. In a specific embodiment, the source, drain, and gate are all Cr / Au electrodes, and the substrate is a glass substrate.

[0008] In the present invention, the nucleotide sequence of the DNA aptamer that specifically recognizes IFN-γ is: CCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACTACACACGCA (SEQ ID NO: 1).

[0009] In the present invention, the DNA aptamer that specifically recognizes IFN-γ is a thiol-modified DNA aptamer. The aptamer is fixed by forming a covalent bond with the gate surface (Au, Ag, etc.) through the thiol group, and the stability of the aptamer is improved so that it maintains high selectivity in a variety of complex biological environments. In a specific embodiment, the nucleotide sequence of the DNA aptamer is: 5'CCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACTACACACGCA3' HS-SHC6.

[0010] In the present invention, Parylene C polymer film layers are provided on the surfaces of the source electrode, the drain electrode and the gate electrode to reduce the crosstalk between the electrodes and ensure high-sensitivity signal transmission.

[0011] The present invention also provides a method for preparing the above-mentioned liquid-gate graphene transistor sensor for rapid detection of cytokine IFN-γ, comprising the following steps: (1) Preparation of electrodes Depositing patterned source, drain and gate electrodes on the substrate through a shadow mask; transferring a single layer of graphene to the substrate to form a channel connecting the source and drain electrodes; and finally vacuum annealing; (2) Electrode modification Mix 1-5 μL 1-15 mmol / L tris(2-carboxyethyl)phosphine TCEP with 50-100 μL 1-10 μmol / L aptamer, let it stand for activation for 1-6 hours, drop the activated mixed solution on the gate surface, and modify it at room temperature overnight; After modification, the surface active sites were blocked with 1-10 mM 2-mercaptoethanol MCH for 3-12 hours, and then the modified electrode surface was rinsed with distilled water to obtain a liquid-gate graphene transistor sensor.

[0012] Furthermore, the present invention provides an application of the above-mentioned liquid-gate graphene transistor sensor in the rapid detection of cytokine IFN-γ, and the application method is as follows: The gate of the sensor is immersed in the IFN-γ standard diluted in the sample solution to be tested, and the standard curve of IFN-γ is fitted according to the gate voltage change value and current change at the Dirac point of the transfer curve measured by the sensor; The gate of the sensor is immersed in the sample solution to be tested, and the qualitative and quantitative detection of IFN-γ in the sample solution to be tested is achieved based on the standard curve according to the gate voltage change value and current change at the Dirac point of the transfer curve measured by the sensor.

[0013] In the present invention, the current change of the sensor in the gradient diluted IFN-γ standard in the sample solution environment is linearly related to the logarithm of the IFN-γ concentration; the concentration of the cytokine IFN-γ in the sample solution to be tested is between 5 fM and 50 nM.

[0014] In the present invention, the sample solution environment to be tested is PBS solution, albumin and plasma.

[0015] Compared with the prior art, the present invention has the following beneficial effects: 1. The sensor of the present invention solves the disadvantage of weak selectivity of electrochemical gate-controlled graphene field-effect transistors. The gate of SGGT is modified with cytokine IFN-γ aptamer. The sensor can be used for rapid detection of one or more substances in cell culture medium samples by splitting and combining the gates.

[0016] 2. The IFN-γ aptamer used in the sensor prepared by the present invention is selective and can avoid interference from other substances in plasma.

[0017] 3. The sample to be tested by the sensor prepared by the present invention can be directly tested without complicated sample processing and the operation is simple.

[0018] 4. The cytokine IFN-γ sensor prepared in the present invention is suitable for real-time monitoring of cytokine IFN-γ in vivo, which helps to quickly analyze the level of cytokine IFN-γ in the human body and realize real-time monitoring of the efficacy and risks of immunotherapy, and has certain practical value.

[0019] 5. In the present invention, the detection method can simultaneously detect other cytokines such as IL-2 and TNF-α by replacing the aptamer, and the aptamer gate can achieve multi-target detection by multiple chemical modifications.

[0020] 6. In the present invention, the sensor provides a constant voltage and current monitoring interface through an external power supply, and can be integrated with a biochip to achieve portable real-time detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] FIG1 is a schematic diagram of the structure of the cytokine IFN-γ sensor of the present invention.

[0022] FIG. 2 is a transfer characteristic curve of the biosensor of the present invention in response to changes in IFN-γ concentration in PBS electrolyte.

[0023] FIG. 3 is a linear relationship diagram of the potential shift of the Dirac point of the biosensor of the present invention in PBS electrolyte versus the logarithm of the concentration.

[0024] FIG. 4 is a transfer characteristic curve of the biosensor of the present invention in response to changes in IFN-γ concentration in an albumin electrolyte.

[0025] FIG. 5 is a linear relationship diagram of the potential shift of the Dirac point of the biosensor of the present invention in an albumin electrolyte versus the logarithm of the concentration.

[0026] FIG. 6 is a transfer characteristic curve of the biosensor of the present invention in response to changes in IFN-γ concentration in plasma electrolyte.

[0027] FIG. 7 is a linear relationship diagram of the potential shift of the Dirac point of the biosensor of the present invention in plasma electrolyte versus the logarithm of the concentration.

[0028] FIG8 is a real-time curve of the biosensor of the present invention detecting cytokine IFN-γ in PBS, albumin, and plasma.

[0029] FIG. 9 is a graph showing the relationship between the current change and the logarithmic concentration of the biosensor of the present invention in PBS, albumin, and plasma.

[0030] FIG. 10 is a diagram showing the selectivity test results of the biosensor of the present invention in PBS.

[0031] FIG11 is a schematic diagram of the structure of the prepared implantable electrode. DETAILED DESCRIPTION

[0032] The present invention proposes a rapid detection method for cytokine IFN-γ. In order to make the purpose, technical solution and effect of the present invention clearer and more specific, the present invention will be further described in detail with reference to the following examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0033] FIG1 is a schematic diagram of the structure of the cytokine IFN-γ sensor of the present invention. Figure 1As shown, it includes a substrate, a source electrode, a drain electrode and a gate electrode; the transistor channel covering the source and drain electrodes is a single-layer graphene, the gate surface is modified with a DNA aptamer that specifically recognizes IFN-γ, and a PDMS well is added to the electrode, and the PDMS well is used to store an electrolyte solution. During detection, a sample solution containing or not containing the cytokine IFN-γ is used as the electrolyte solution, and the gate is immersed in the electrolyte solution. After the DNA aptamer captures the IFN-γ target substance in the electrolyte, the configuration changes, resulting in a charge change, resulting in a shift in the Dirac point of the transfer curve, thereby realizing the electrochemical detection of IFN-γ.

[0034] The present invention provides a rapid detection method for cytokine IFN-γ, comprising the following steps: SGGT electrode modification: The cytokine IFN-γ aptamer was modified on the gate surface to obtain a cytokine IFN-γ sensor based on SGGT; the nucleotide sequence of the cytokine IFN-γ aptamer was: CCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACTACACACGCA (SEQ ID. NO: 1); Standard curve determination of cytokine IFN-γ: The cytokine IFN-γ standard was diluted to different concentrations using different sample environments, and then dripped onto the cytokine IFN-γ sensor so that the gate was immersed in the solution. The detection range of the sensor was determined based on the sensor transfer curve, real-time curve, and pulse curve. The standard curve was fitted based on the gate voltage change value at the Dirac point, the real-time curve current change value, and the concentration logarithm. In vivo model detection: Implantable electrodes prepared using micro-nano processing technology can be used to detect IFN-γ concentration in the blood in real time in vivo.

[0035] Furthermore, the step (1) is specifically as follows: at room temperature, 1-5 μL 1-15 mM tris(2-carboxyethyl)phosphine is mixed with 50-100 μL 1-10 μM aptamer, after static activation for 1-6 hours, it is dropped onto the gate surface of the liquid-gate graphene field effect transistor device, and modified at room temperature overnight; rinsed with deionized water, and surface active sites were blocked with 1-10 mM 2-mercaptoethanol for 3-12 hours; and then rinsed with deionized water to obtain a cytokine IFN-γ sensor based on SGGT.

[0036] Furthermore, the different concentrations in step (2) are 0, 5fM, 50fM, 500fM, 5pM, 50pM, 500pM, 5nM and 50nM; the relationship between the cytokine IFN-γ concentration and the gate voltage change value at the Dirac point and the real-time curve current change value is analyzed.

[0037] Furthermore, the implantable electrode in step (3) has a minimum width of 200 µm and can pass through the needle tip of the puncture needle.

[0038] Example 1

[0039] Performance testing of aptamer-functionalized cytokine IFN-γ sensor in PBS electrolyte Preparation of SGGT biosensor 1. Preparation of electrodes: First, the glass substrate was ultrasonically cleaned with acetone, ethanol, and deionized water. Patterned Cr / Au source, Cr / Au drain, and Cr / Au gate electrodes were deposited on the surface of the glass substrate through a shadow mask by thermal evaporation (Angstrom Engineering). A thin layer of Cr (thickness: about 5 nm) was used as an adhesion layer for the Au layer (thickness: about 40 nm). Then, a single layer of graphene was transferred to the glass substrate by a wet transfer technique to form a channel connecting the source and drain electrodes. During the graphene transfer process, the substrate was exposed to O2 plasma for 5 minutes to improve the hydrophilicity of graphene and the glass substrate. Finally, the device was annealed in a vacuum oven at 200°C for 1 hour to remove a small amount of residual solvent and other organic impurities; 2. Electrode modification: 1 μL 1mM tri(2-carboxyethyl)phosphine (TCEP) was mixed with 100 μL 1μM thiol-modified aptamer (structure: 5'CCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACTACACACGCA3' HS-SHC6, synthesized by Shanghai Biotech), and activated for 1 hour. The activated mixed solution was added dropwise to the gate surface and modified at room temperature overnight. After modification, the surface active sites were blocked with 1mM 2-mercaptoethanol (MCH) for 12 hours, and then the modified electrode surface was rinsed with distilled water; 3. After fixing the modified electrode with a fixture, immerse it in the sample solution to be tested, and use the Keysight B2902A digital source meter to measure the transfer curve and real-time curve.

[0040] Standard curve detection The detection range of the SGGT sensor prepared above was evaluated, and the transfer characteristic curve of the sensor was analyzed by detecting the sample solution mixed with different concentrations of cytokine IFN-γ standard. The sample was prepared in 100 mL PBS buffer, and the channel current was measured by Keysight B2902A digital source meter. The transfer curve test conditions were set to a gate voltage range of -1 V to 1 V and a fixed drain voltage of 0.1 V. The real-time curve test conditions were set to a gate voltage of -0.2 V and a fixed drain voltage of 0.1 V.

[0041] Test results and analysis: like Figure 1 As shown in the figure, as the concentration of the substance to be tested increases in the solution system, the gate voltage corresponding to the lowest point of the transfer curve (Dirac point) increases with the concentration of the substance to be tested. Therefore, the SGGT sensor using the aptamer-functionalized gate electrode can detect the cytokine IFN-γ under a certain concentration range. Figure 2 shows the change in the gate voltage of the Dirac point and the initial Dirac point (ΔV G ) and the logarithm of the cytokine IFN-γ concentration. It can be seen that the prepared sensor achieves continuous real-time detection in the concentration range of 5fM-50nM in PBS buffer, and the response signal is stable. In addition, the real-time curve is shown in Figure 8. When the biosensor is exposed to an IFN-γ solution with a concentration range of 5 fM to 50 nM, the device current shows a significant increase. Figure 9 is a graph showing the relationship between the current change and the logarithm of the concentration. It can be seen that the prepared sensor has a high linearity in the logarithm fitting of the current change and the concentration in the concentration range of 5fM-50nM in PBS buffer.

[0042] Example 2

[0043] Performance testing of aptamer-functionalized cytokine IFN-γ sensor in albumin electrolyte The preparation method of SGGT biosensor is the same as that of Example 1; Standard curve detection The detection range of the SGGT sensor prepared above was evaluated, and the transfer characteristic curve of the sensor was analyzed by detecting the sample solution mixed with different concentrations of cytokine IFN-γ standard. The sample to be tested was prepared in 100 mL of albumin solution, and the channel current was measured by Keysight B2902A digital source meter. The transfer curve test conditions were set to a gate voltage range of -1 V to 1 V and a fixed drain voltage of 0.1 V. The real-time curve test conditions were set to a gate voltage of -0.2 V and a fixed drain voltage of 0.1 V.

[0044] Test results and analysis: As shown in Figure 3, as the concentration of the substance to be tested increases in the solution system, the gate voltage corresponding to the lowest point (Dirac point) of the transfer curve increases with the concentration of the substance to be tested. Therefore, the SGGT sensor using the aptamer-functionalized gate electrode can detect the cytokine IFN-γ under a certain concentration range. Figure 4 shows the change in the gate voltage of the Dirac point and the initial Dirac point (ΔV G) and the logarithm of the cytokine IFN-γ concentration. It can be seen that the prepared sensor achieves continuous real-time detection in the concentration range of 5fM-50nM in albumin, and the response signal is stable. In addition, the real-time curve is shown in Figure 8. When the biosensor is exposed to an IFN-γ solution with a concentration range of 5 fM to 50 nM, the device current shows a significant increase. Figure 9 is a graph showing the relationship between the current change and the logarithm of the concentration. It can be seen that the prepared sensor has a high linearity in the logarithm fitting of the current change and the concentration in the concentration range of 5fM-50nM in albumin.

[0045] Example 3

[0046] Performance testing of aptamer-functionalized cytokine IFN-γ sensor in plasma electrolytes The preparation method of SGGT biosensor is the same as that of Example 1; Standard curve detection The detection range of the SGGT sensor prepared above was evaluated, and the transfer characteristic curve of the sensor was analyzed by detecting the sample solution mixed with different concentrations of cytokine IFN-γ standard. The sample was prepared in 100 mL of plasma solution, and the channel current was measured by Keysight B2902A digital source meter. The transfer curve test conditions were set to a gate voltage range of -1 V to 1 V and a fixed drain voltage of 0.1 V. The real-time curve test conditions were set to a gate voltage of -0.4 V and a fixed drain voltage of 0.1 V.

[0047] Test results and analysis: As shown in Figure 5, as the concentration of the substance to be tested increases in the solution system, the gate voltage corresponding to the lowest point (Dirac point) of the transfer curve decreases as the concentration of the substance to be tested increases. Therefore, the SGGT sensor using the aptamer-functionalized gate electrode can detect the cytokine IFN-γ under a certain concentration range. Figure 6 shows the change in the gate voltage of the Dirac point and the initial Dirac point (ΔV G ) and the logarithm of the cytokine IFN-γ concentration. It can be seen that the prepared sensor achieves continuous real-time detection in the concentration range of 5fM-50nM in plasma, and the response signal is stable; in addition, the real-time curve is shown in Figure 8. When the biosensor is exposed to an IFN-γ solution with a concentration range of 5 fM to 50 nM, the device current shows a significant decrease. Figure 9 is a graph showing the relationship between the current change and the logarithm of the concentration. It can be seen that the prepared sensor has a high linearity in the logarithm fitting of the current change and the concentration in the concentration range of 5fM-50nM in plasma.

[0048] Example 4

[0049] Anti-interference test of IFN-γ sensing by cytokine IFN-γ sensor The preparation method of SGGT biosensor is the same as that of Example 1; The selectivity of the prepared SGGT sensor was tested. Considering the possible interference of the sensor in the actual detection process, we selected some interfering substances that may exist in the blood for selectivity testing. 1 μL of 5 pM urea, lactic acid, and fructose were added to the 1×PBS system where the SGGT sensor with the cytokine IFN-γ aptamer modified gate was located to measure the real-time curve, and then 1 μL of 5 fM IFN-γ was added.

[0050] Test results and analysis: Figure 10 shows the comparison of real-time current change values ​​after the addition of interfering substances and IFN-γ. Among them, the ΔI corresponding to 5 fM concentration of IFN-γ is significantly higher than that of other interfering substances, indicating that the sensor has obvious advantages in responding to low concentrations of IFN-γ. The SGGT sensor modified with aptamers can achieve selective response, which shows that the modification process significantly improves the detection sensitivity and specificity of the sensor.

[0051] Example 5

[0052] A preparation method of an implantable electrode based on a liquid-gate graphene transistor comprises the following steps: (1) Electrode patterning and deposition: On the PI film substrate, patterned electrodes were prepared by photolithography. Then, a metal vacuum coater was used to coat 5 nm thick Cr and 50 nm thick Au in sequence by thermal evaporation to obtain Cr / Au electrodes, forming source, drain and side gate electrodes respectively. The source and drain electrodes adopt a forked finger structure with an electrode length of 1 mm, a width of 20 μm, an electrode spacing of 20 μm, and a spacing of 400 μm between the side gate electrode and the source and drain electrodes. After the electrode patterning is completed, the gold-plated electrode is finely processed by laser cutting technology, with the narrowest width of 200 μm, which is convenient for subsequent implantation operations; single-layer graphene is also used as the transistor channel, and single-layer graphene covers the source and drain electrodes.

[0053] (2) Device design and improvement: Different from the traditional design, the distance between the interdigitated electrode and the needle electrode interface is 7 cm. The device has a needle-like structure with a narrowest width of 200 μm, which is suitable for implantation into the tumor site through an indwelling needle. The electrode surface is coated with a 1 μm thick Parylene C polymer film using chemical vapor deposition (CVD) technology to isolate the water and oxygen environment and prevent electrical crosstalk between electrodes.

[0054] (3) Polymer membrane coating and experimental design: The coating design of Parylene C membrane fully considers the experimental needs. The membrane is 0.7 cm away from the needle tip to ensure that the needle tip of the interdigitated electrode is completely exposed to the tumor tissue. In the implantation experiment, the exposed electrode part is in contact with the tumor tissue for sensitive detection of IFN-γ.

[0055] Test results and analysis: The device structure is shown in Figure 11. The implantable electrode based on the liquid-gate graphene transistor showed good current response characteristics and sensitive immune response detection capabilities in this experiment. Through appropriate electrode structure design, fine processing technology and effective protection of the polymer film, the electrode can be successfully implanted in the tumor site and sensitively detect changes in the concentration of IFN-γ cytokines. This provides a new technical approach for real-time monitoring of the interaction between immune cells and tumor cells, and provides a feasibility basis for further clinical applications.

[0056] The above embodiments are only preferred implementations of the present invention and do not limit the technical scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made by ordinary technicians in this field based on the technical solution of the present invention should be deemed to fall within the scope of protection defined by the claims of the present invention.

Claims

1. A liquid-gate graphene transistor sensor for rapid detection of cytokine IFN-γ, characterized in that: The liquid-gate graphene transistor sensor comprises a substrate, a source electrode, a drain electrode and a gate electrode, wherein the transistor channel covering the source and drain electrodes is a single-layer graphene, and the surface of the gate electrode is modified with a DNA aptamer that specifically recognizes IFN-γ. During detection, a sample solution to be tested containing or not containing the cytokine IFN-γ is used as an electrolyte solution, and the gate electrode is immersed in the electrolyte solution. After the DNA aptamer on the surface of the gate electrode captures the IFN-γ target substance in the electrolyte, the configuration changes, resulting in a charge change, and a shift of the Dirac point of the transfer curve is generated, thereby realizing the electrochemical detection of IFN-γ.

2. The liquid-gate graphene transistor sensor for rapid detection of cytokine IFN-γ according to claim 1, characterized in that: The source and drain materials are independently selected from at least one of Au, Ag, and Cr; the gate is selected from any one of Cr / Au, Ag, Pt, Ag / AgCl electrode, and glassy carbon electrode; and the substrate is selected from any one of glass, silicon wafer, or polyimide film.

3. The liquid-gate graphene transistor sensor for rapid detection of cytokine IFN-γ according to claim 1, characterized in that: The nucleotide sequence of the DNA aptamer that specifically recognizes IFN-γ is: CCGCCCAAATCCCTAAGAGAAGACTGTAATGACATCAAACCAGACACACTACACACGCA.

4. The liquid-gate graphene transistor sensor for rapid detection of cytokine IFN-γ according to claim 1, characterized in that: The DNA aptamer that specifically recognizes interferon-γ is a DNA aptamer with a thiol group modified at the 3' end.

5. The liquid-gate graphene transistor sensor for rapid detection of cytokine IFN-γ according to claim 1, characterized in that: The surfaces of the source, drain and gate are provided with a Parylene C polymer film layer.

6. A method for preparing a liquid-gate graphene transistor sensor for rapid detection of cytokine IFN-γ according to claim 1, characterized in that: The following steps are involved: (1) Preparation of electrodes depositing patterned source, drain and gate electrodes on the substrate through a shadow mask; Transferring a single layer of graphene to a substrate by wet method to form a channel connecting the source and drain; finally vacuum annealing; (2) Electrode modification Mix 1-5 μL 1-15 mmol / L tris(2-carboxyethyl)phosphine TCEP with 50-100 μL 1-10 μmol / L aptamer, let it stand for activation for 1-6 hours, drop the activated mixed solution on the gate surface, and modify it at room temperature overnight; After modification, the surface active sites were blocked with 1-10 mM 2-mercaptoethanol MCH for 3-12 hours, and then the modified electrode surface was rinsed with distilled water to obtain a liquid-gate graphene transistor sensor.

7. An application of the liquid-gate graphene transistor sensor according to claim 1 in rapid detection of cytokine IFN-γ, characterized in that: The application method is as follows: The gate of the sensor is immersed in the IFN-γ standard diluted in the sample solution to be tested, and the standard curve of IFN-γ is fitted according to the gate voltage change value and current change at the Dirac point of the transfer curve measured by the sensor; The gate of the sensor is immersed in the sample solution to be tested, and the qualitative and quantitative detection of IFN-γ in the sample solution to be tested is achieved based on the standard curve according to the gate voltage change value and current change at the Dirac point of the transfer curve measured by the sensor.

8. The use according to claim 7, characterized in that The current change of the sensor in the gradient diluted IFN-γ standard in the sample solution environment is linearly related to the logarithm of the IFN-γ concentration; the concentration of the cytokine IFN-γ in the sample solution to be tested is between 5 fM and 50 nM.

9. The use according to claim 7, characterized in that: The sample solution environments to be tested are PBS solution, albumin and plasma.

Images