DNA polymerase and application thereof

Abstract

The invention provides DNA polymerase and application thereof. The amino acid sequence of the DNA polymerase comprises (1) a sequence as shown in SEQ ID NO: 2; (2) a sequence which is obtained by substituting, deleting or adding one or more residues to the sequence as shown in SEQ ID NO: 2 and has DNA polymerase activity; or (3) a sequence which has more than 80% of identity with the sequence as shown in SEQ ID NO: 2 and has DNA polymerase activity. The DNA polymerase provided by the invention is a novel DNA polymerase, has higher optimum reaction temperature and better thermal stability compared with the existing wild type phi29 DNA polymerase with rolling circle amplification capacity, can meet the requirements of related applications on reaction temperature and storage stability, and has wide application prospects in the aspects of isothermal amplification, WGA library establishment and the like.

Description

DNA polymerase and its application Technical Field

[0001] The present application belongs to the field of biotechnology, and specifically relates to a DNA polymerase and its application. Background Art

[0002] Phy29 DNA polymerase is a mesophilic DNA polymerase cloned from the Bacillus subtilis phage phi29. It belongs to the B family of DNA polymerases. The crystal structure of Phi29 DNA polymerase reveals that, in addition to the conserved palm, thumb, finger, and exodomains (which possess 3'→5' proofreading activity) common to B family DNA polymerases, Phi29 possesses two unique domains: TPR1 (terminal protein region 1) and TPR2 (terminal protein region 2). The TPR2 domain is involved in forming a narrow channel around the downstream template DNA strand, forcing the dissociation of the double-stranded DNA. Simultaneously, the Palm, Thumb, TPR1, and TPR2 domains form a ring-like structure that tightly binds to the double-stranded DNA formed by the upstream template strand.

[0003] The structural characteristics of Phi29 DNA polymerase give it exceptional high processivity, strong strand displacement, and high fidelity. It is commonly used in isothermal amplification techniques such as rolling circle amplification (RCA) of trace circular DNA and multiple strand displacement amplification of genomes.

[0004] However, the optimal reaction temperature of wild-type phi29 DNA polymerase is 34°C, and its activity decreases sharply at higher temperatures, making it difficult to meet the reaction temperature and storage stability requirements of related applications. Therefore, it is necessary to develop a DNA polymerase with higher thermal stability that can maintain high rolling circle amplification activity at higher reaction temperatures.

[0005] Summary of the Invention

[0006] The present application provides a DNA polymerase and its application. The DNA polymerase described in the present application is a novel DNA polymerase with a higher optimal reaction temperature than the wild-type phi29 DNA polymerase and better thermal stability. It can meet the reaction temperature and storage stability requirements of related applications and has broad application prospects in isothermal amplification, whole genome amplification (WGA) library construction, and other aspects.

[0007] In a first aspect, the present application provides a DNA polymerase, wherein the amino acid sequence of the DNA polymerase comprises:

[0008] (1) the sequence shown in SEQ ID NO: 2;

[0009] (2) a sequence obtained by substitution, deletion, or addition of one or more residues of the sequence shown in SEQ ID NO: 2, and having DNA polymerase activity; or

[0010] (3) A sequence having DNA polymerase activity that is 80% or more (e.g., 80%, 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98%, or 100%) identical to the sequence shown in SEQ ID NO: 2.

[0011] The DNA polymerase sequence described in this application is derived from deep-sea metagenomic sequencing data analysis. Researchers in this application have discovered that the DNA described in this application is a novel DNA polymerase with strong strand displacement and efficient continuous amplification capabilities, a higher optimal reaction temperature, and better thermal stability than the wild-type phi29 DNA polymerase with similar functions.

[0012] The DNA polymerase described in this application is named 27°N DNA polymerase. This enzyme has a strong rolling circle amplification ability.

[0013] The optimal reaction temperature of the novel DNA polymerase (27°N DNA polymerase) described in the present application is relatively high, approximately 40°C. Compared with the existing wild-type phi29 DNA polymerase, the optimal temperature is increased by more than 6°C, and the temperature range of activity is wider.

[0014] Preferably, the amino acid sequence of the DNA polymerase comprises a sequence having DNA polymerase activity that is 85% (for example, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98% or 100%, etc.) or more identical to the sequence shown in SEQ ID NO: 2, more preferably 90% (for example, 90%, 92%, 94%, 95%, 96%, 98% or 100%, etc.) or more identical, and most preferably, 95% (for example, 95%, 96%, 98% or 100%, etc.) or more identical.

[0015] Preferably, the optimal reaction temperature of the DNA polymerase is higher than 34°C.

[0016] Preferably, the optimal reaction temperature of the DNA polymerase is 35°C-50°C, for example, it can be 35°C, 37°C, 39°C, 40°C, 41°C, 43°C, 45°C, 47°C, 49°C or 50°C.

[0017] More preferably, the optimal reaction temperature of the DNA polymerase is 36°C-45°C, for example, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C or 45°C.

[0018] Preferably, the DNA polymerase has rolling circle amplification activity.

[0019] The novel DNA polymerase described in this application (27°N DNA polymerase) demonstrates superior rolling circle replication at higher temperatures compared to the existing wild-type phi29 DNA polymerase, and has potential applications in rolling circle replication and multiple strand displacement amplification. Compared to the commercially available phi29 DNA polymerase, the novel DNA polymerase described in this application exhibits a low sequence identity of only 46%.

[0020] In a second aspect, the present application provides a nucleic acid molecule encoding the DNA polymerase described in the first aspect.

[0021] Preferably, the nucleotide sequence of the nucleic acid molecule comprises:

[0022] (1) the sequence shown in SEQ ID NO: 1;

[0023] (2) a sequence obtained by substituting, deleting or adding one or more nucleotides from the sequence shown in SEQ ID NO: 1; or

[0024] (3) A sequence having 80% or more identity (e.g., 80%, 82%, 84%, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98%, or 100%) to the sequence shown in SEQ ID NO: 1.

[0025] Preferably, the nucleotide sequence of the nucleic acid molecule has 85% (for example, 85%, 86%, 88%, 90%, 92%, 94%, 95%, 96%, 98% or 100%, etc.) or more identity with the sequence shown in SEQ ID NO: 1, more preferably 90% (for example, 90%, 92%, 94%, 95%, 96%, 98% or 100%, etc.) or more identity, and most preferably, 95% (for example, 95%, 96%, 98% or 100%, etc.) or more identity.

[0026] It should be noted that due to the principle of codon degeneracy, the nucleotide sequence that translates the amino acid sequence is not a unique constant sequence. Any nucleotide sequence that can encode the same amino acid sequence is a nucleic acid sequence within the scope of this patent.

[0027] In a third aspect, the present application provides an expression vector comprising the nucleic acid molecule described in the second aspect.

[0028] Preferably, the backbone vector of the expression vector includes any one of a bacterial expression vector, a yeast expression vector, a mold expression vector and / or a mammalian expression vector.

[0029] Preferably, the bacterial expression vector comprises a pET28A expression vector.

[0030] In a fourth aspect, the present application provides a recombinant cell, wherein the recombinant cell expresses the DNA polymerase described in the first aspect.

[0031] Preferably, the recombinant cell contains the nucleic acid molecule described in the second aspect.

[0032] Preferably, the recombinant cell contains the expression vector described in the third aspect.

[0033] In a fifth aspect, the present application provides the use of any one or a combination of at least two of the DNA polymerase described in the first aspect, the nucleic acid molecule described in the second aspect, the expression vector described in the third aspect, or the recombinant cell described in the fourth aspect in nucleic acid amplification and / or preparation of reagents for nucleic acid amplification.

[0034] In a sixth aspect, the present invention provides a method for amplifying DNA, comprising: contacting the DNA polymerase described in the first aspect with the DNA, and performing amplification. In some specific embodiments, the method comprises: contacting the DNA polymerase with the DNA, and performing isothermal amplification, preferably performing isothermal amplification at 30°C-50°C, and more preferably performing isothermal amplification at 36°C-45°C. In some more specific embodiments, the isothermal amplification is rolling circle amplification or multiple strand displacement amplification. In some more specific embodiments, the DNA is gDNA or cDNA.

[0035] In the seventh aspect, the present application provides a method for constant temperature amplification, using the DNA polymerase described in the first aspect to perform constant temperature amplification at 30-50°C, and the amplification temperature can be, for example, 30°C, 31°C, 32°C, 34°C, 36°C, 38°C, 40°C, 42°C, 45°C, 46°C, 47°C, 48°C, 49°C or 50°C, etc.

[0036] Preferably, the DNA polymerase described in the first aspect is used for isothermal amplification at 35°C-50°C, more preferably 36°C-45°C.

[0037] The isothermal amplification method described in this application includes preparing an amplification mixture containing the DNA polymerase described above, and then adding a template, dNTPs, and primers to perform isothermal amplification. The isothermal amplification method described in this application has high amplification efficiency and, at higher temperatures, exhibits rolling circle replication capabilities superior to those of the existing wild-type phi29 DNA polymerase, thus possessing significant application prospects.

[0038] In an eighth aspect, the present application provides a nucleic acid amplification kit, wherein the kit contains the DNA polymerase described in the first aspect.

[0039] In a ninth aspect, the present application provides a nucleic acid isothermal amplification kit, which contains the DNA polymerase described in the first aspect.

[0040] In some specific embodiments, the kit of the present application further comprises other components for amplification, such as template, primers, dNTP, buffer, and sterile water.

[0041] In a tenth aspect, the present application provides an application of the DNA polymerase described in the first aspect, wherein the application comprises:

[0042] (1) Applied to single-cell genome amplification kits, suitable for single cells such as isolated tumor cells or bacterial cells, amplifying complex genomic DNA through multiple displacements, promoting unbiased amplification of all sites, and obtaining high-yield DNA;

[0043] (2) Applied to single-cell transcriptome amplification kits, multiple displacement amplification (MDA) technology is used to uniformly amplify cDNA across the entire transcriptome;

[0044] (3) catalyzing rolling circle amplification and / or catalyzing multiple strand displacement amplification;

[0045] (4) Applicable to whole genome and whole transcriptome library construction kits, effectively amplifying gDNA and cDNA;

[0046] (5) RCA library construction to generate periodic DNA nanotemplates;

[0047] (6) Genome amplification coverage detection.

[0048] In an eleventh aspect, the present application provides a use of the DNA polymerase described in the first aspect, the nucleic acid molecule described in the second aspect, the expression vector described in the third aspect, the recombinant cell described in the fourth aspect, or the nucleic acid isothermal amplification kit described in the ninth aspect, the use comprising:

[0049] (1) Preparing a kit product for catalyzing DNA replication and / or catalyzing DNA amplification;

[0050] (2) preparing products for catalyzing rolling circle amplification and / or catalyzing multiple strand displacement amplification;

[0051] (3) preparing products for performing DNA sequencing, RNA sequencing, or whole genome sequencing;

[0052] (4) Preparation of products for RCA library construction;

[0053] (5) Prepare products for genome amplification coverage detection.

[0054] The source and preparation method of the novel DNA polymerase described in this application are as follows:

[0055] (1) The novel DNA polymerase sequence is derived from the metagenomic sequencing data analysis of deep-sea hydrothermal sediment samples.

[0056] (2) The sequence was synthesized and inserted into the pET28a vector (with the insertion sites Nde I / Xho I), and heterologously expressed in Escherichia coli BL21 competent cells.

[0057] (3) Purification was performed using a nickel column-Q column-SP column.

[0058] (4) Activity determination and optimal reaction temperature determination were performed using rolling circle replication.

[0059] (5) The results showed that the new DNA polymerase has rolling circle replication ability, and the optimal reaction temperature is significantly higher than that of wild-type phi29 DNA polymerase.

[0060] (6) This enzyme has the potential to be applied in rolling circle replication and multiple strand displacement amplification.

[0061] The numerical range described in this application includes not only the point values ​​listed above, but also any point values ​​between the above numerical ranges that are not listed. Due to limited space and for the sake of simplicity, this application no longer exhaustively lists the specific point values ​​included in the range.

[0062] Compared with the prior art, this application has the following beneficial effects:

[0063] (1) The DNA polymerase described in this application (27°N DNA polymerase) overcomes the defects of the wild-type phi29 DNA polymerase, which has a low optimal reaction temperature and poor thermal stability. The novel DNA polymerase has a higher optimal reaction temperature and better thermal stability, which can meet the requirements of related applications for reaction temperature and storage stability.

[0064] (2) The novel DNA polymerase described in this application has better rolling circle replication ability than the existing wild-type phi29 DNA polymerase at higher temperatures, and has the potential to be applied in rolling circle replication and multiple strand displacement amplification, and has broad application prospects in the fields of constant temperature amplification, WGA library construction, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 is the result of amino acid sequence alignment;

[0066] Figure 2 is the SDS-PAGE electrophoresis result of the protein;

[0067] FIG3 is a schematic diagram of the polymerization activity detection principle;

[0068] Figure 4 is the principle of 3'-5' exo-activity detection;

[0069] Figure 5 is the result of 3'-5' exo-activation assay;

[0070] Figure 6 is a schematic diagram of the principle of rolling circle amplification activity detection;

[0071] FIG7 is a temperature and relative reactivity graph;

[0072] FIG8 is an electrophoresis gel image of nucleic acid of rolling circle replication products at different reaction temperatures. DETAILED DESCRIPTION

[0073] The technical solution of the present application is further described below through specific implementation methods. Those skilled in the art should understand that the embodiments are only used to help understand the present application and should not be regarded as specific limitations of the present application.

[0074] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0075] The nucleotide sequence and amino acid sequence involved in this application are as follows:

[0076] Nucleotide sequence of the novel DNA polymerase 27°N DNA polymerase (SEQ ID NO: 1) (5'-3'):

[0077]

[0078]

[0079] Amino acid sequence of the novel DNA polymerase 27°N DNA polymerase (SEQ ID NO: 2):

[0080]

[0081] Example 1 Sequence Alignment

[0082] The novel DNA polymerase (27°N DNA polymerase; SEQ ID NO: 2) and the wild-type phi29 DNA polymerase (SEQ ID NO: 5) were aligned using the Clustal Omega online sequence alignment website. The amino acid sequence alignment results are shown in FIG1 , which show that the sequence identity between the two is only 46%.

[0083] Example 2 Construction of recombinant plasmid, expression and purification

[0084] Beijing Liuhe BGI Genomics Co., Ltd. was commissioned to synthesize the 27°N DNA polymerase gene sequence and clone the gene into the pET28A expression vector with the cloning sites Nde I and Xho I. The recombinant plasmid was transformed into E. coli BL21 (DE3) competent cells and incubated at 37°C overnight for subsequent expression and purification. The specific steps are as follows:

[0085] (1) Pick 3-6 single colonies that grow well on the plate and inoculate them into a 50 / 250mL LB liquid conical flask. Incubate at 37℃ for 5-7h. OD 600 Then, the above bacterial solution was inoculated into 2L / 5L LB medium at a 1% inoculation volume and cultured at 37℃ for 2-4h. 600 Reach 0.8-1.0. Pre-cool the original shaker to 16°C. Add IPTG to each culture medium to a final concentration of 0.5 mM. Induce expression for 12-16 hours in a shaker at 220 rpm at 16°C.

[0086] (2) The cells were collected by centrifugation at 8000 g for 30 min. Ni-A buffer was then added to the cells at a ratio of 1:10 (1 g of cells to 10 mL of Ni-A buffer) to resuspend the cells. The cells were disrupted by ultrasound in an ice bath. The disrupted liquid was centrifuged at 12000 rpm at 4°C for 60 min. The supernatant was filtered through a 0.22 μm filter membrane and used as the sample for the purification column.

[0087] (3) The sample was loaded onto a pre-treated histidine-tagged protein purification column (HisTrap FF Crude) at a rate of 3 mL / min. After loading, the column was rinsed with Ni-A Buffer for 20 column volumes. A linear elution with a Ni-B buffer ratio of 0-70% was then performed over 10.5 CV. The eluted protein was collected when the UV absorption peak reached 200 mAu and stopped when the UV absorption peak dropped to 400 mAu.

[0088] (4) The collected eluate was loaded onto a pre-treated Q column (the Q column was pre-equilibrated with 41% SP-B Buffer for 10 column volumes), and the flow-through was collected when the UV absorption peak reached 200 mAu.

[0089] (5) The collected Q column flow-through was diluted with TE Buffer 2.33 times the amount and filtered through a 0.22 μm filter membrane before use for SP column purification. Specifically, the sample was flowed into the pretreated SP column at a flow rate of 5 mL / min. After the sample was loaded, 20 column volumes of SP-A Buffer were used for flushing, followed by linear elution. Sample collection began when the UV absorption peak was greater than 200 mAu.

[0090] (6) After the purified sample is dialyzed and its concentration is determined, it is stored in Storage Buffer for subsequent functional activity analysis.

[0091] The specific components of the buffer used in the purification process are as follows:

[0092] Ni-A Buffer: 20 mM Tris-HCl (2.42 g / L), 500 mM NaCl (29.22 g / L), 20 mM Imidazole (1.36 g / L), 5% Glycerol (62.5 g / L), pH 7.9.

[0093] Ni-B Buffer: 20 mM Tris-HCl (2.42 g / L), 500 mM NaCl (29.22 g / L), 500 mM Imidazole (34.04 g / L), 5% Glycerol (62.5 g / L), pH 7.9.

[0094] SP-A Buffer: 20 mM Tris-HCl (2.42 g / L), 150 mM NaCl (8.77 g / L), 5% Glycerol (62.5 g / L), pH 7.5.

[0095] SP-B Buffer: 20 mM Tris-HCl (2.42 g / L), 1 M NaCl (58.44 g / L), 5% Glycerol (62.5 g / L), pH 7.5.

[0096] 2×Dialysis Buffer: 23.75 mM Tris-HCl (2.877 g / L), 237.5 mM KCl (17.705 g / L), 1 mM DTT (dithiothreitol) (0.154 g / L), 0.2375 mM EDTA (ethylenediaminetetraacetic acid) (0.0884 g / L), 5% Glycerol (62.5 g / L), pH 7.5@25°C.

[0097] Storage Buffer: 10 mM Tris-HCl (1.2114 g / L), 100 mM KCl (7.455 g / L), 1 mM DTT (0.15425 g / L), 0.1 mM EDTA (0.037224 g / L), 50% Glycerol (625 g / L), pH 7.5 @ 25°C.

[0098] The SDS-PAGE electrophoresis results of the purified protein are shown in FIG2 . As can be seen from FIG2 , the target protein with high purity was obtained after purification.

[0099] Example 3 Polymerization activity determination

[0100] Polymerization activity was assayed using primed M13ssDNA (M13ssDNA with annealed primers) as a substrate. The principle of the polymerization activity assay is shown in Figure 3. In the presence of polymerization activity, the primers on the primed M13ssDNA extend along the ssDNA in a 5'-3' direction, producing dsDNA, which can be quantified using the Qubit dsDNA HS Assay Kits. The specific reaction system and components for the polymerization activity assay are shown in Table 1.

[0101] Table 1

[0102] Component Volume (μL) 10× Reaction Buffer 2.5 50 nM Primer-M13 ssDNA 4 10 mM dNTP Mix 127°N DNA Polymerase 1 NF16.5

[0103] The reaction mixture was incubated at 37°C, 55°C, and 72°C for 5 min, and then 2 μL of 0.5 M EDTA was added to terminate the reaction. The dsDNA concentration was then determined using a Qubit kit. The results are shown in Table 2.

[0104] Table 2

[0105] Reaction conditions dsDNA concentration (ng / μL) 72℃ / 5min 3.1655℃ / 5min 6.5437℃ / 5min 1.51

[0106] The above results show that the enzyme has polymerization activity, and the polymerization activity at 55°C is higher than that at 37°C. This indicates that the optimal temperature of the enzyme is at least greater than 37°C, which is higher than the optimal reaction temperature of wild-type phi29 DNA polymerase.

[0107] Example 4 Exo-activity assay

[0108] Exo-activity was determined using a terminal mismatched substrate probe method. The principle of 3'-5' exo-activity detection is shown in Figure 4. The fluorescent probe sequence used is: a primer with a quencher group at the 3' end (ATCAGCAGGCCACACGTTAAACTGT 3'-BHQ2) and a primer with a fluorescent group at the 5' end (TAGTCGTCCGGTGTGCAATTTCTGT 5'-Rox) are annealed and complementary to form a double-stranded substrate containing four mismatches at the end.

[0109] SEQ ID NO: 3: 5'-ATCAGCAGGCCACACGTTAAACTGT-3'.

[0110] SEQ ID NO: 4: 5'-TAGTCGTCCCGGTGTGCAATTTCTGT-3'.

[0111] The reaction system for detecting 3'-5' exo-cleavage activity is shown in Table 3, wherein the blank control is a reaction system without enzyme. The reaction was carried out at 30°C for 1 hour, and the fluorescence signal (FAM fluorescence, excitation peak at 492 nm, emission peak at 520 nm) was collected every 30 seconds:

[0112] Table 3

[0113] Component volume (μL) 27°N DNA polymerase 210 μM Fluorescent probe 0.255× Reaction buffer 5H2O 17.75

[0114] The results of 3'-5' exo-cleavage activity detection are shown in FIG5 , which shows that the fluorescence value gradually increases with reaction time, indicating that the novel DNA polymerase has 3'-5' exo-cleavage activity (the fluorescence data are corrected data obtained by subtracting the blank control).

[0115] Example 5 Rolling Circle Replication Activity Assay

[0116] The activity of the novel DNA polymerase was assayed using a rolling circle replication method. The schematic diagram of the rolling circle amplification activity assay is shown in FIG6 . The specific principle is: single-stranded circular DNA bound to a primer is used as a substrate for rolling circle replication, and the resulting ssDNA product is then detected using the Qubit ssDNA Assay Kit. The schematic diagram and activity assay steps are shown below:

[0117] (1) Take 0.6 mg / mL of the enzyme and dilute it 1000 times using the gradient dilution method (50×20).

[0118] (2) The above enzyme dilution solution was used to prepare the reaction system shown in Table 4.

[0119] Table 4

[0120] Component volume (μL) 10× reaction buffer 25 μM primer 0.1

[0121] 10mM dNTPs 1.251ng / μL single-stranded circular DNA 6NF H2O 10.6527°N DNA polymerase 2.5

[0122] The components of 10× reaction buffer are: 500 mM Tris-HCl, 100 mM MgCl2, 100 mM (NH4)2SO4, 40 mM DTT, pH 7.5 (25°C).

[0123] (3) Place the above reaction system in a PCR instrument and incubate at 30°C for 2 h with the heated lid set to 40°C.

[0124] (4) After the reaction was completed, 2 μL of 0.5 M EDTA was added to terminate the reaction, and the mixture was mixed by vortexing. TM Qubit TM ssDNA concentration was determined using the ssDNA Assay Kit.

[0125] The concentration of the single-stranded DNA product amplified by the above reaction was confirmed to be 2.3 ng / μL using a Qubit fluorometer, indicating that the novel DNA polymerase has rolling circle replication activity.

[0126] Example 6 Optimum Temperature Determination

[0127] Using the same reaction system as above, the rolling circle replication activity of the novel DNA polymerase and the wild-type phi29 DNA polymerase at different temperatures was tested, and a temperature and relative reaction activity curve was obtained, as shown in Figure 7. The results showed that the optimal reaction temperature of the 27°N DNA polymerase was about 40°C, which was higher than that of the wild-type phi29 DNA polymerase (optimum temperature around 34°C).

[0128] The rolling circle replication products at different reaction temperatures were subjected to electrophoresis. The nucleic acid electrophoresis gel images of the rolling circle replication products at different reaction temperatures are shown in FIG8 . The nucleic acid electrophoresis gel images show that the amplified single-stranded products all exhibit pore blocking, indicating that the new 27°N DNA polymerase also has good processivity.

[0129] In summary, the present application provides a DNA polymerase (27°N DNA polymerase), the sequence identity of the 27°N DNA polymerase with the wild-type phi29 DNA polymerase is only 46%; the 27°N DNA polymerase has a higher optimal reaction temperature than the wild-type phi29 DNA polymerase and better thermal stability, which can meet the requirements of related applications for reaction temperature and storage stability, and has broad application prospects in constant temperature amplification, WGA library construction, etc.

[0130] The applicant declares that the above is only a specific implementation method of the present application, but the protection scope of the present application is not limited thereto. Technical personnel in the relevant technical field should understand that any changes or substitutions that can be easily thought of by technical personnel in the relevant technical field within the technical scope disclosed in this application fall within the protection scope and disclosure scope of this application.

Claims

1. A DNA polymerase, the amino acid sequence of which comprises: (1) the sequence shown in SEQ ID NO: 2; (2) a sequence obtained by substitution, deletion, or addition of one or more residues of the sequence shown in SEQ ID NO: 2, and having DNA polymerase activity; or (3) A sequence having DNA polymerase activity that is 80% or more identical to the sequence shown in SEQ ID NO:

2.

2. The DNA polymerase according to claim 1, wherein The amino acid sequence of the DNA polymerase includes a sequence having DNA polymerase activity that is more than 85% identical to the sequence shown in SEQ ID NO: 2, more preferably more than 90% identical, and most preferably more than 95% identical.

3. The DNA polymerase according to claim 1 or 2, wherein The DNA polymerase has rolling circle amplification activity; Preferably, the optimal reaction temperature of the DNA polymerase is higher than 34°C; Preferably, the optimal reaction temperature of the DNA polymerase is 35°C-50°C; More preferably, the optimal reaction temperature of the DNA polymerase is 36°C-45°C.

4. A nucleic acid molecule encoding the DNA polymerase according to any one of claims 1 to 3; Preferably, the nucleotide sequence of the nucleic acid molecule comprises: (1) the sequence shown in SEQ ID NO: 1; (2) a sequence obtained by substituting, deleting or adding one or more nucleotides from the sequence shown in SEQ ID NO: 1; or (3) a sequence having 80% or greater identity with the sequence shown in SEQ ID NO: 1; Preferably, the nucleotide sequence of the nucleic acid molecule has more than 85% identity with the sequence shown in SEQ ID NO: 1, more preferably has more than 90% identity, and most preferably has more than 95% identity. An expression vector comprising the nucleic acid molecule according to claim 4 .

6. The expression vector according to claim 5, wherein The backbone vector of the expression vector includes any one of a bacterial expression vector, a yeast expression vector, a mold expression vector and / or a mammalian expression vector; Preferably, the bacterial expression vector comprises a pET28A expression vector.

7. A recombinant cell expressing the DNA polymerase according to any one of claims 1 to 3; or It contains the nucleic acid molecule according to claim 4; or It contains the expression vector according to claim 5.

8. Use of any one or a combination of at least two of the DNA polymerase according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, the expression vector according to claim 5 or 6, or the recombinant cell according to claim 7 in nucleic acid amplification and / or preparation of a reagent for nucleic acid amplification.

9. A method for amplifying DNA, comprising: The DNA polymerase according to any one of claims 1 to 3 is brought into contact with the DNA, and amplification is performed.

10. The method according to claim 9, comprising: The DNA polymerase is contacted with the DNA, and isothermal amplification is performed, preferably at 30°C-50°C, more preferably at 36°C-45°C.

11. The method according to claim 10, wherein: The isothermal amplification is rolling circle amplification or multiple strand displacement amplification.

12. The method according to claim 9, wherein The DNA is gDNA or cDNA. 13 . A nucleic acid amplification kit comprising the DNA polymerase according to claim 1 .

14. Use of the DNA polymerase according to any one of claims 1 to 3, wherein The applications include: (1) Applied to single-cell genome amplification kits; (2) Application in single-cell transcriptome amplification kits; (3) catalyzing rolling circle amplification and / or catalyzing multiple strand displacement amplification; (4) Whole genome and whole transcriptome library kits; (5) RCA library construction to generate periodic DNA nanotemplates; or (6) Genome amplification coverage detection.

15. Use of the DNA polymerase according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, the expression vector according to claim 5 or 6, the recombinant cell according to claim 7, or the nucleic acid amplification kit according to claim 13, wherein: The applications include: (1) Preparing a kit product for catalyzing DNA replication and / or catalyzing DNA amplification; (2) preparing products for catalyzing rolling circle amplification and / or catalyzing multiple strand displacement amplification; (3) preparing products for performing DNA sequencing, RNA sequencing, or whole genome sequencing; (4) preparing products for RCA library construction; or (5) Prepare products for genome amplification coverage detection.

Images