Specific modified RNAi reagents and compositions

Abstract

One aspect of the invention relates to RNAi (dsRNA) duplex agents capable of inhibiting expression of a target gene. The dsRNA duplex has an F-modified nucleotide at a specific position in an antisense strand or a sense strand. Other aspects of the invention relate to pharmaceutical compositions comprising these dsRNA agents suitable for therapeutic use and methods of inhibiting the expression of a target gene by administering these dsRNA agents, e.g., for the treatment of various disease conditions.

Description

Specific modified RNAi reagents and compositions Technical Field

[0001] The present invention relates to RNAi agents with specific motifs that can be used to inhibit target gene expression and RNAi compositions for treating diseases; in particular, the present invention provides various diseases that can be treated by administering RNAi agents to inhibit target gene expression. Background Art

[0002] RNA interference, or "RNAi," technology, originally proposed by Fair et al., is already known in the art as an effective means of treating diseases. The RNAi mechanism is initiated by the Dicer enzyme-mediated production of longer non-coding RNAs, which are loaded into the RNA-induced silencing complex (RISC), where the sense strand or passenger strand is discarded and the antisense strand or guide strand hybridizes to a fully or partially complementary mRNA sequence, which then induces mRNA silencing via Ago2-mediated degradation or translational inhibition. Oligonucleotides have been developed that reduce gene expression through the RNA interference (RNAi) pathway, such as, but not limited to, double-stranded RNAi oligonucleotides (also known as dsRNA), including short interfering RNAs (siRNAs), microRNAs (miRNAs), and short hairpin RNAs (shRNAs) with a size of 19-25 nucleotides; and antisense oligonucleotides (also known as ASOs) with a size of 16-53 nucleotides. Advances in RNAi technology and delivery methods have resulted in increasingly positive results for RNAi-based therapies. This type of therapy represents a promising approach for treating a class of diseases, particularly those that are considered undruggable by small molecule or biological approaches. However, this technology has been hampered by inherent metabolic challenges of natural RNA, such as targeting and in vivo stability, which hinder its widespread application.

[0003] In the past 20 years, great progress has been made in overcoming the inherent metabolic problems of natural RNA by developing various chemical modifications and improved delivery methods for RNAi oligonucleotides. Such chemical modifications of RNAi oligonucleotides are crucial for fully utilizing the potential of such therapeutic regimens, which can improve their pharmacokinetic and pharmacodynamic properties (Deleavey & Damha, Chem, Biol, 19:937-954, 2012) and prevent innate immune activation. For example, Choung et al. used siRNA duplexes comprising alternative modifications, obtained stable siRNA in serum by 2′-OMe (2′-O-methyl), 2′-F (2′-fluoro) and phosphorothioate modified nucleotides and their different combinations (2006, Biochemical and Biophysical Research Communications, 342, 919-927); further including modification of other nucleotide positions to LNA, UNA and the like; recently, Nair et al. used N-acetylgalactamide (GalNAc)-conjugated chemically modified siRNA to mediate delivery to liver hepatocytes in vivo and showed effectiveness (J.AM.Chem, Soc, 136: 16958-16961, 2014). These chemically modified siRNAs have entered clinical development for the treatment of various human diseases.

[0004] Among these modifications, one of the most common chemical modifications is the replacement of the 2'-OH of the furanose sugar of the ribonucleotide, including but not limited to fully chemically modified siRNAs using a combination of 2'-O-methyl (2'-OMe) and 2'-fluoro (2'-F) throughout the duplex. For example, Morrissey et al. used siRNA duplexes containing 2'-F modified residues at the Ago2 cleavage site in addition to other sites and modifications, and achieved silencing comparable to that of unmodified siRNAs. However, the positions of these 2'-F modifications were not determined, and whether they had a substantial effect on gene silencing activity was uncertain. Choung et al. proposed that 2'-OMe should not be used at specific sites to increase siRNA stability. Janas et al. pointed out that to date, there is no evidence that 2'-F modifications are regular in siRNAs (NUCLEIC ACID THER., 26:363-371, 2016; NUCLEIC ACID THER., 27:11-22, 2016). Although modifications such as 2'-F siRNA have been well tolerated in clinical trials, the main concern with the use of chemically modified nucleoside analogs in oligonucleotide therapeutics is the potential toxicity associated with non-natural oligonucleotide analogs; it has been reported that 2'-F modified fully phosphorothioated antisense oligonucleotides lead to cellular protein reduction and double-strand DNA breaks, resulting in acute hepatotoxicity in vivo (NUCLEIC ACID RES., 46:2204-2217, 2018). Furthermore, it is known that the larger, naturally derived 2'-OMe modification has better metabolic stability and tolerance than the smaller 2'-F modification; however, there is uncertainty about whether replacing the smaller 2'-F modification with 2'-OMe can interfere with RNA protein binding and inhibit RNAi activity (Chiu et al., RNA, 9:1034-1048, 2003; Prakash et al., J.MED.CHEM., 48:4247-4253, 2005; Zheng et al., FASEB J., 27:4017-4026, 2013).

[0005] Therefore, in order to improve stability and tolerance while reducing the toxic side effects of non-natural nucleotide agents without affecting RNAi activity, the prior art discloses further reducing the content of 2'-F and accompanying 2'-OME adjustment. These 2'-OME and 2'-F positions have shown good efficacy and duration. Recent reports have attempted to optimize the modification pattern of 21 / 23 length siRNA and Galnac conjugation platform (Mol.Ther.26:708-717,2018). In international patent application WO2021067744, the effects of the 2'-F position and number of hairpin RNA (shRNA) were studied, and it was determined that the specific 2'-F position and number of shRNA had a certain effect on RNAi activity. However, these have not really recognized the reusability of the specific 2'-F modification position and number while retaining RNAi activity and being beneficial to stability, tolerance and reducing toxic side effects.

[0006] While significant progress has been made in overcoming the inherent metabolic challenges of natural RNA through the development of chemical modifications and improved delivery methods, there remains a need in the art for RNAi agents with enhanced in vivo efficacy and stability suitable for therapeutic administration. Furthermore, it remains desirable to minimize the use of non-natural nucleoside analogs, such as 2'-F modified nucleosides, in therapeutic RNAi and to determine the effects of specific positions and numbers of these nucleosides on activity, stability, and toxic side effects, particularly in double-stranded RNAs and antisense oligonucleotides.

[0007] Summary of the Invention

[0008] The present invention is based in part on the design of chemical modification patterns for RNAi agents that improve the potency and / or duration of the in vivo gene silencing activity of RNAi agents. The modification patterns described herein can be generally applied to a variety of RNAi agents with different sequences and targets. RNAi agents can be used to inhibit target gene expression in vivo, for example, to achieve therapeutic purposes.

[0009] Therefore, according to one aspect of the present invention, RNAi agents for inhibiting target gene expression are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising a compound represented by formula (X) listed in the 3′ to 5′ direction: 3′-(N X ) n N X N X N X N X N F N X NX N X N X N X N X N X N X N X N X N X N F N X -5′ formula (X)

[0010] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0011] Each N X Each independently represents a modified or unmodified nucleotide, N X There are no more than three 2′-fluoro modified nucleotides in the

[0012] n can be an integer from 0 to 7.

[0013] In some embodiments, RNAi agents for inhibiting target gene expression are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising a compound represented by formula (I) listed in the 3′ to 5′ direction: 3′-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5′ Formula (I)

[0014] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0015] Each N X Each independently represents a modified or unmodified nucleotide, N X There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide;

[0016] n can be an integer from 0 to 7.

[0017] In some embodiments, RNAi agents for inhibiting target gene expression are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising the formula (I-1) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (I-1)

[0018] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0019] N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide;

[0020] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0021] n can be an integer from 0 to 7.

[0022] In some embodiments, in the antisense strand of the dsRNA agent represented by formula (I-1), N M1 、N M2 、N M3 、N M4 、N M6 、N M7 and N M8 There are only three 2′-fluorinated nucleotides in N M5 Not a 2'-fluoro modified nucleotide.

[0023] In some embodiments, the antisense strand of the dsRNA agent comprises a compound represented by Formula (II) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5′ Formula (II)

[0024] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0025] N M1 、N M2 、N M3 、N M4 、N M5 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 and N M4 There are only two 2′-fluoro modified nucleotides in N M5 、N M7 and N M8 Not a 2′-fluorine-modified nucleotide;

[0026] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0027] n can be an integer from 0 to 7.

[0028] In some embodiments, the antisense strand of the dsRNA agent comprises a compound represented by Formula (III) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N F N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (III)

[0029] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0030] N M1 、N M2 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M6 and N M7 There are only two 2′-fluoro modified nucleotides in N M4 、N M5 and N M8 Not a 2′-fluorine-modified nucleotide;

[0031] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0032] n can be an integer from 0 to 7.

[0033] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides. In these embodiments, the dsRNA agent at positions N M1 、N M3 and N M7The nucleotides are 2'-fluoro modified nucleotides.

[0034] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides. In these embodiments, the dsRNA agent at positions N M2 、N M3 and N M6 The nucleotides are 2'-fluoro modified nucleotides.

[0035] In some more specific embodiments, the nucleotides at positions 2, 4, 10, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides.

[0036] In some more specific embodiments, the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides.

[0037] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides.

[0038] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides.

[0039] In some more specific embodiments, the nucleotides at positions 2, 5, 10, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides.

[0040] It is understood that in these embodiments, the dsRNA agent has only five 2'-fluoro modified nucleotides in the antisense strand represented by Formula (I-1), Formula (II) or Formula (III).

[0041] In some embodiments, the dsRNA agent is in the antisense strand of formula (I-1), N M1 、N M2 、N M3 、N M5 、N M6 and N M8There is only one 2′-fluorinated nucleotide in N M4 、N M7 Not a 2'-fluoro modified nucleotide.

[0042] In some embodiments, the antisense strand of the dsRNA agent is represented by Formula (IV) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (IV)

[0043] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0044] N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M5 、N M6 and N M8 There is only one 2′-fluorinated nucleotide in N M4 、N M7 Not a 2′-fluorine-modified nucleotide;

[0045] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0046] n can be an integer from 0 to 7.

[0047] In some more specific embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides.

[0048] In some more specific embodiments, the nucleotides at positions 2, 8, and 14 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

[0049] In some more specific embodiments, the nucleotides at positions 2, 7, and 14 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides.

[0050] In some more specific embodiments, the nucleotides at positions 2, 12, and 14 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (IV) are 2′-fluoro-modified nucleotides.

[0051] In some more specific embodiments, the nucleotides at positions 2, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides.

[0052] In some more specific embodiments, the nucleotides at positions 2, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA agent represented by formula (IV) are 2'-fluoro-modified nucleotides.

[0053] In some more specific embodiments, the nucleotides at positions 2, 6, and 14 of the antisense strand of the dsRNA agent (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

[0054] It is understood that in these embodiments, the dsRNA agent has only three 2'-fluoro modified nucleotides in the antisense strand of Formula (I-1) or Formula (IV).

[0055] In some embodiments, RNAi agents capable of inhibiting target gene expression are included, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising the formula (I-2) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L NM2 N L N F N L N M3 N M9 N M4 N M10 N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (I-2)

[0056] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0057] N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 There are only three 2′-fluoro modified nucleotides;

[0058] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0059] n can be an integer from 0 to 7.

[0060] In some more specific embodiments, in the antisense strand of the dsRNA agent represented by formula (I-2), N M6 and N M9 Each independently represents a 2′-fluorine-modified nucleotide, N M1 and N M2 There is only one 2′-fluorinated nucleotide in N M3 、 N M4 、N M5 、N M7 、N M8 and NM10 are not 2'-fluorinated nucleotides. M6 and N M9 All are 2′-fluorinated nucleotides, N M1 and N M2 There is only one 2′-fluorinated nucleotide in N M3 、N M4 、N M5 、N M7 and N M8 None of them are 2′-fluorine-modified nucleotides. In these embodiments, it means that positions 2, 7, 11, 14 and 16 in the antisense chain are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides; or positions 2, 7, 11, 14 and 18 are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides.

[0061] In some more specific embodiments, in the antisense strand of the dsRNA agent represented by formula (I-2), N M2 and N M3 Each independently represents a 2′-fluorine-modified nucleotide, N M5 、N M6 and N M10 There is only one 2′-fluorinated nucleotide in N M1 、N M4 、N M7 、N M8 and N M9 are not 2'-fluorinated nucleotides. M2 and N M3 All are 2′-fluorinated nucleotides, N M5 、N M6 and N M10 There is only one 2′-fluorinated nucleotide in N M1 、N M4 、N M7 、N M8 and N M9 None of them are 2′-fluorine-modified nucleotides. In these embodiments, it means that positions 2, 7, 12, 14 and 16 in the antisense chain are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides; or positions 2, 8, 12, 14 and 16 are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides; or positions 2, 9, 12, 14 and 16 are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides.

[0062] In some embodiments, RNAi agents capable of inhibiting target gene expression are included, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising a 3′ to 5′ direction represented by formula (I′): 3′-(N L ) n N M1 N L N F N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5′ Formula (I')

[0063] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0064] N M1 、N M3 、N M4 、N M5 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M3 、N M4 、N M5 、N M7 and N M8 No more than one 2′-fluoro-modified nucleotide;

[0065] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0066] n can be an integer from 0 to 7.

[0067] In some more specific embodiments, the dsRNA agent comprises an antisense strand represented by formula (I'), N M1 、N M3 、N M4 、N M5 、N M7 and N M8There is only one 2'-fluoro modified nucleotide. It is understood by those skilled in the art that positions 2, 7, 14 and 16 in the antisense strand are 2'-fluoro modified nucleotides. M1 、N M3 、N M4 、N M5 、N M7 and N M8 Among them, only one is a 2′-fluorine-modified nucleotide, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides, with a total of 5 2′-fluorine-modified nucleotides. By way of non-limiting example, nucleotides at positions 2, 5, 7, 14, and 16 are 2′-fluorine-modified nucleotides, while nucleotides at other positions are not 2′-fluorine-modified nucleotides; nucleotides at positions 2, 4, 7, 14, and 16 are 2′-fluorine-modified nucleotides, while nucleotides at other positions are not 2′-fluorine-modified nucleotides; nucleotides at positions 2, 7, 8, 14, and 16 are 2′-fluorine-modified nucleotides, while nucleotides at other positions are not 2′-fluorine-modified nucleotides; nucleotides at positions 2, 7, 10, 14, and 16 are 2′-fluorine-modified nucleotides, while nucleotides at other positions are not 2′-fluorine-modified nucleotides; nucleotides at positions 2, 7, 12, 14, and 16 are 2′-fluorine-modified nucleotides, while nucleotides at other positions are not 2′-fluorine-modified nucleotides; nucleotides at positions 2, 7, 14, 16, and 18 are 2′-fluorine-modified nucleotides, while nucleotides at other positions are not 2′-fluorine-modified nucleotides.

[0068] In some more specific embodiments, the dsRNA agent comprises an antisense strand represented by formula (I'), N M1 、N M3 、N M4 、N M5 、N M7 and N M8 The antisense strand does not contain 2'-fluoro modified nucleotides. It can be understood by those skilled in the art that only positions 2, 7, 14 and 16 of the antisense strand are 2'-fluoro modified nucleotides, while the nucleotides at other positions are not 2'-fluoro modified nucleotides, for a total of 4 2'-fluoro modified nucleotides. In some embodiments, the dsRNA agent has N in the antisense strand represented by formula (I) and / or formula (X). XOne or more of the nucleotides is independently selected from the following modified nucleotides: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides (MOE), abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural base containing nucleotides. In some embodiments, the dsRNA agent is N of the antisense strand represented by Formula (I-1), Formula (I-2), Formula (I'), Formula (II), Formula (III) and / or Formula (IV). L One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides (MOE), abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural bases containing nucleotides. In some embodiments, N in the dsRNA agent L The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, or Invab.

[0069] In some embodiments, the dsRNA agent includes an E-vinylphosphonate nucleotide at the 5' end of the antisense strand in the antisense strand represented by Formula (I) / or Formula (I').

[0070] In some embodiments, the dsRNA agent has N in the antisense strand of Formula (I-1), Formula (I-2), Formula (I'), Formula (II), Formula (III) and / or Formula (IV). M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 Each of the modified nucleotides is independently selected from the following: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), open ring nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some embodiments, when the dsRNA agent is in the antisense strand shown in Formula (I) / or Formula (I'), N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 In the case of non-2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides are preferred.

[0071] In some embodiments, all or substantially all nucleotides in the sense and antisense strands of the dsRNA agent are modified nucleotides.

[0072] In some embodiments, the dsRNA agent has a sense strand that is complementary or substantially complementary to the antisense strand of Formula (X), (I), (I-1), (I-2), (I'), (II), (III), and / or (IV), and the region of complementarity or substantial complementarity is between 18 and 25 nucleotides in length. In some embodiments, the dsRNA agent has a sense strand that is complementary or substantially complementary to the antisense strand of Formula (I), and the region of complementarity or substantial complementarity is between 18 and 25 nucleotides in length. In some embodiments, the dsRNA agent has a sense strand that is complementary or substantially complementary to the antisense strand of Formula (I'), and the region of complementarity or substantial complementarity is between 18 and 25 nucleotides in length. In some embodiments, the region of complementarity or substantial complementarity is between 18-23 nucleotides in length. In some embodiments, the region of complementarity or substantial complementarity is between 19-21 nucleotides in length. In some embodiments, the region of complementarity or substantial complementarity is 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, there is a sense strand that is fully complementary to the antisense strand of Formula (I). In some embodiments, there is a sense strand that is fully complementary to the antisense strand of Formula (I').

[0073] In some embodiments, n in the dsRNA agent is 7, and it is understood that the antisense strand complementary pair is 25 nucleotides in length. In some specific embodiments, n in the dsRNA agent is 0, 1, 2, 3, 4, 5 or 6.

[0074] In one embodiment, the dsRNA agent of the present invention may include one or more overhang regions of the dsRNA agent at the 3'-end or 5'-end or both ends of a chain, and the overhang may have a length of 1-5 nucleotides. In a specific embodiment, the dsRNA agent of the present invention may have an overhang of 1-5 nucleotides at the 3'-end of the antisense strand. In a specific embodiment, the dsRNA agent of the present invention may have an overhang of 1-5 nucleotides at the 5'-end of the sense strand. In a more specific embodiment, the dsRNA agent of the present invention may have an overhang of 1 or 2 nucleotides.

[0075] In one embodiment, the dsRNA agents of the invention are blunt ended at the 5'-end of the antisense strand or the 3'-end of the sense strand.

[0076] In some embodiments, the sense strand of the dsRNA agent is no more than 40 nucleotides in length. In some embodiments, the length of each strand of the dsRNA agent is no more than 30 nucleotides in length. In some embodiments, the length of each strand of the dsRNA agent is no more than 25 nucleotides in length. In some embodiments, the length of each strand of the dsRNA agent is no more than 23 nucleotides in length. In some embodiments, the length of each strand of the dsRNA agent is 19, 20, or 21 nucleotides.

[0077] In some embodiments, the dsRNA agent comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand of the dsRNA agent comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand of the dsRNA agent comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand and / or antisense strand of the dsRNA agent comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the dsRNA agent contains 1 or 2 phosphorothioate internucleoside linkages at the 3'-terminus and / or 5'-terminus of the sense strand and / or antisense strand.

[0078] In some embodiments, the dsRNA agent further comprises one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups of the dsRNA agent of the present invention are the same or different. The targeting group or linking group can be attached to the sense strand, antisense strand or both strands at the 3' end, the 5' end or both ends. In some embodiments, the one or more targeting groups or linking groups in the dsRNA agent are conjugated to the sense strand. The targeting ligand can change the distribution, targeting or lifespan of the dsRNA agent into which it is incorporated, the endosomal solubility properties, improved transport, hybridization and specific properties, such as, but not limited to, lectins, glycoproteins, lipids or proteins, thyroid stimulating hormone, melanocyte stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polymannose, polyhalose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic, or an aptamer, other examples include dyes, intercalating agents (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases, or a chelating agent (e.g., EDTA), lipophilic molecules, such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O 3-(Oleoyl) cholic acid, O3-(Oleoyl) cholenic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphates, amino groups, sulfhydryl groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino groups, alkyl groups, substituted alkyl groups, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / adsorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazoles, bisimidazoles, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl groups, HRP or AP. In some embodiments, the targeting group or linking group includes a group selected from: N-acetyl-galactosamine (GalNAc), a lipophilic molecule. The lipophilic molecule can be used for delivery in the neural field. In some embodiments, the targeting group or linking group of the dsRNA agent is conjugated to the 3'-end and / or 5'-end of the sense strand. In some embodiments, the targeting group of the dsRNA agent has the following structure:

[0079] In some embodiments, the antisense strand of Formula (I) and / or Formula (I') in the dsRNA agent comprises an inverted abasic residue at the 3'-terminus. In some embodiments, the sense strand in the dsRNA agent comprises one or two inverted abasic residues at the 3' or / and 5' termini.

[0080] In some embodiments, the dsRNA agent is an inhibitory factor FXII (F12) gene sequence. In some embodiments, the dsRNA agent has a sequence shown in Table 2 below.

[0081] In some embodiments, the dsRNA agent is siRNA.

[0082] According to another aspect of the present invention, an RNAi agent for inhibiting target gene expression is provided, wherein the RNAi agent is a double-stranded ribonucleic acid (dsRNA) agent, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the sense strand having 18 to 40 nucleotides, the sense strand comprising a 5′ to 3′ direction represented by formula (V): 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V)

[0083] Among them, each N′ F represents 2′-fluorine-modified nucleotides;

[0084] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′N3 , N′ N4 , N′ N5 and N′ N6 at least two 2′-fluoro-modified nucleotides;

[0085] In formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) does not contain more than six 2′-fluorine-modified nucleotides in total;

[0086] Each N′ L independently represent modified or unmodified nucleotides;

[0087] n' may be an integer from 0 to 7.

[0088] In some embodiments, RNAi agents for inhibiting target gene expression are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the sense strand having 18 to 40 nucleotides, the sense strand comprising a 5′ to 3′ direction represented by formula (V′): 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ formula (V′)

[0089] Among them, each N′ F represents 2′-fluorine-modified nucleotides;

[0090] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5and N′ N6 There are only two 2′-fluoro modified nucleotides;

[0091] Each N′ L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0092] n' may be an integer from 0 to 7.

[0093] In some embodiments, the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA agent represented by formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro modified nucleotides. In these embodiments, the dsRNA agent at positions N′ of the sense strand represented by formula (V′) is 2′-fluoro modified nucleotides. N3 and N′ N5 The nucleotides are 2′-fluorine modified nucleotides.

[0094] In some embodiments, the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA agent represented by formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro modified nucleotides. In these embodiments, the dsRNA agent at positions N′ of the sense strand represented by formula (V′) is 2′-fluoro modified nucleotides. N3 and N′ N6 The nucleotides are 2′-fluorine modified nucleotides.

[0095] In some embodiments, the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V') are 2'-fluoro-modified nucleotides.

[0096] In some embodiments, the nucleotides at positions 11, 12, and 14 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V') are 2'-fluoro-modified nucleotides.

[0097] In some embodiments, the nucleotides at positions 11, 12, and 15 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V') are 2'-fluoro-modified nucleotides.

[0098] It will be understood that in these embodiments, the dsRNA agent has only three 2'-fluoro modified nucleotides in the sense strand of formula (V').

[0099] In some embodiments, the nucleotides at positions 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) of the dsRNA agent of formula (V) are 2′-fluoro modified nucleotides. N3 and N′ N5 The nucleotides are 2′-fluorine modified nucleotides.

[0100] In some embodiments, the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) of the dsRNA agent of formula (V) are 2′-fluoro modified nucleotides. N3 and N′ N6 The nucleotides are 2′-fluorine modified nucleotides.

[0101] In some embodiments, the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V) are 2'-fluoro-modified nucleotides.

[0102] In some embodiments, the nucleotides at positions 11, 12, and 14 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V) are 2'-fluoro-modified nucleotides.

[0103] In some embodiments, the nucleotides at positions 11, 12, and 15 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V) are 2'-fluoro-modified nucleotides.

[0104] It will be understood that in these embodiments, the dsRNA agent contains three 2′-fluoro-modified nucleotides in the sense strand represented by formula (V), but the total number of 2′-fluoro-modified nucleotides in the sense strand represented by formula (V) does not exceed 6, and there is no motif of 3 or more consecutive 2′-fluoro-modified nucleotides.

[0105] According to another aspect of the present invention, an RNAi agent for inhibiting target gene expression is provided, wherein the RNAi agent is a double-stranded ribonucleic acid (dsRNA) agent, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the sense strand having 18 to 40 nucleotides, the sense strand comprising a residue represented by formula (IX) listed in the 5′ to 3′ direction: 5′-(N′ L ) n′ N′ L N′ L N′L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ N7 N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (IX)

[0106] Among them, each N′ F represents 2′-fluorine-modified nucleotides;

[0107] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and N′ N7 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and N′ N7 at least two 2′-fluoro-modified nucleotides;

[0108] In formula (IX), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (IX) does not contain more than six 2′-fluorine-modified nucleotides in total;

[0109] Each N′ L independently represent modified or unmodified nucleotides;

[0110] n' may be an integer from 0 to 7.

[0111] In some embodiments, the N′ in the sense strand of the dsRNA agent represented by Formula (V) and / or Formula (IX) is LOne or more of the nucleotides are independently selected from the following modified nucleotides: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides (MOE), abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates, or non-natural bases containing nucleotides. In some embodiments, the dsRNA agent is wherein N' shown in Formula (V) and / or Formula (IX) L The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, or Invab.

[0112] In some embodiments, the dsRNA agent includes an E-vinylphosphonate nucleotide at the 5' end in the antisense strand.

[0113] In some embodiments, the N′ in the sense strand of the dsRNA agent represented by Formula (V) and / or Formula (IX) is N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and N′ N7Each of the modified nucleotides is independently selected from the following: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), open ring nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some embodiments, when the dsRNA agent is in the sense strand of formula (V) N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 In the case of non-2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides are preferred.

[0114] In some embodiments, all or substantially all nucleotides of the sense and antisense strands of the dsRNA agent are modified nucleotides.

[0115] In some embodiments, the dsRNA agent has an antisense strand that is complementary or substantially complementary to the sense strand shown in formula (V), and the length of the complementary region is between 18 and 25 nucleotides. In some embodiments, the complementary or substantially complementary region is between 18 and 23 nucleotides in length. In some embodiments, the complementary or substantially complementary region is between 19 and 21 nucleotides in length. In some embodiments, the complementary or substantially complementary region is 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, there is an antisense strand that is completely complementary to the sense strand shown in formula (V).

[0116] In some embodiments, n' in the dsRNA agent is 7, and it is understood that the sense strand complementary pairing is 25 nucleotides in length. In some specific embodiments, n' in the dsRNA agent is 0, 1, 2, 3, 4, 5 or 6.

[0117] In one embodiment, the dsRNA agent of the present invention may include one or more overhang regions of the dsRNA agent at the 3′-end or 5′-end or both ends of a chain, and the overhang may have a length of 1-5 nucleotides. These overhangs may be the result of one chain being longer than the other, or the result of two chains of the same length being staggered. The overhang may form a mismatch with the target mRNA, or it may be complementary to the targeted gene sequence or may be another sequence. In a specific embodiment, the dsRNA agent of the present invention may have an overhang of 1-5 nucleotides in length at the 3′-end of the antisense chain. In a specific embodiment, the dsRNA agent of the present invention may have an overhang of 1-5 nucleotides in length at the 5′-end of the sense chain. In a more specific embodiment, the dsRNA agent of the present invention may have an overhang of 1 or 2 nucleotides in length.

[0118] In one embodiment, the dsRNA agents of the invention are blunt ended at the 5'-end of the antisense strand or the 3'-end of the sense strand.

[0119] In some embodiments, the antisense strand of the dsRNA agent is no more than 30 nucleotides in length. In some embodiments, each strand of the dsRNA agent is no more than 30 nucleotides in length. In some embodiments, each strand of the dsRNA agent is no more than 25 nucleotides in length. In some embodiments, each strand of the dsRNA agent is no more than 23 nucleotides in length. In some embodiments, each strand of the dsRNA agent is 19, 20, or 21 nucleotides in length.

[0120] In some embodiments, the dsRNA agent comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand of the dsRNA agent comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand of the dsRNA agent comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand and / or antisense strand of the dsRNA agent comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the dsRNA agent contains 1 or 2 phosphorothioate internucleoside linkages at the 3′-terminus and / or 5′-terminus of the sense strand and / or antisense strand.

[0121] In some embodiments, the dsRNA agent further comprises one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups of the dsRNA agent of the present invention are the same or different. The targeting group or linking group can be attached to the sense strand, antisense strand or both strands at the 3' end, the 5' end or both ends. In some embodiments, the one or more targeting groups or linking groups in the dsRNA agent are conjugated to the sense strand. The targeting ligand can change the distribution, targeting or lifespan, endosomal solubility properties, improve transport, hybridization and specificity properties of the dsRNA agent into which it is incorporated, such as, but not limited to, lectins, glycoproteins, lipids or proteins, thyroid stimulating hormone, melanocyte stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent trehalose, glycosylated polyamino acids , polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic or an aptamer, other examples include dyes, intercalating agents (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., such as phenazine, dihydrophenazine), artificial endonucleases or a chelating agent (such as EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, camphenol, menthol, 1,3-propylene glycol, heptadecanol, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (such as antennapedia peptide, Tat peptide), alkylating agents, phosphates, amino groups, sulfhydryl groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino groups, alkyl groups, substituted alkyl groups, radiolabeled markers, enzymes, haptens (e.g., biotin), carrier / adsorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl groups, HRP, or AP. In some embodiments, the targeting group or linking group includes a group selected from: N-acetyl-galactosamine (GalNAc), a lipophilic molecule. The lipophilic molecule can be used for delivery in the neural field. In some embodiments, the targeting group or linking group in the dsRNA agent is conjugated to the 5′-end of the sense chain. In some embodiments, the targeting group of the dsRNA agent has the following structure:

[0122] In some embodiments, the sense strand of the dsRNA agent of Formula (V) and / or Formula (IX) comprises an inverted abasic residue at the 3'-terminus. In some embodiments, the sense strand of the dsRNA agent of Formula (V) and / or Formula (IX) comprises one or two inverted abasic residues at the 3'- or / and 5'-terminus.

[0123] In some embodiments, the dsRNA agent is an inhibitory factor FXII (F12) gene sequence. In some embodiments, the dsRNA agent has a sequence shown in Table 2 below.

[0124] In some embodiments, the dsRNA agent is siRNA.

[0125] In another aspect of the present invention, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the sense strand having 18 to 40 nucleotides, the dsRNA agents comprising an antisense strand having a nucleotide sequence represented by formula (I) herein and a sense strand having a nucleotide sequence represented by formula (V) herein,

[0126] The antisense strand comprises the compound represented by formula (I) listed in the 3′ to 5′ direction: 3′-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5′ Formula (I)

[0127] The sense strand comprises the residue represented by formula (V) listed in the 5' to 3' direction: 5'-(N' L ) n′ N′ L N′ L N′ L N′ N1 N′N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V)

[0128] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0129] Each N X Each independently represents a modified or unmodified nucleotide, N X There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide;

[0130] Each N′ F represents 2′-fluorine-modified nucleotides;

[0131] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 at least two 2′-fluoro-modified nucleotides;

[0132] In the sense strand of formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) contains no more than six 2′-fluorine-modified nucleotides in total;

[0133] Each N′ L independently represent modified or unmodified nucleotides;

[0134] Each of n and n' independently can be an integer from 0 to 7.

[0135] It is understood that the dsRNA agent includes a combination of an antisense strand having any of the modifications described herein by formula (I) and a sense strand having any of the modifications described herein by formula (V).

[0136] Including, but not limited to, in some embodiments, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein these RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the sense strand having 18 to 40 nucleotides, the dsRNA agent comprising an antisense strand having a nucleotide sequence represented by formula (I-1) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0137] The antisense strand comprises the following represented by formula (I-1) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (I-1)

[0138] The sense strand comprises the residue represented by formula (V) listed in the 5' to 3' direction: 5'-(N' L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V)

[0139] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0140] NM1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide;

[0141] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0142] Each N′ F represents 2′-fluorine-modified nucleotides;

[0143] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 at least two 2′-fluoro-modified nucleotides;

[0144] In the sense strand of formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) contains no more than six 2′-fluorine-modified nucleotides in total;

[0145] Each N′ L independently represent modified or unmodified nucleotides;

[0146] Each of n and n' independently can be an integer from 0 to 7.

[0147] In some embodiments, the dsRNA agent includes an antisense strand having a nucleotide sequence represented by formula (I-1) herein and a sense strand having a nucleotide sequence represented by formula (V') herein. In some embodiments, the dsRNA agent includes an antisense strand having a nucleotide sequence represented by formula (II) herein and a sense strand having a nucleotide sequence represented by formula (V) herein. In some embodiments, the dsRNA agent includes an antisense strand having a nucleotide sequence represented by formula (III) herein and a sense strand having a nucleotide sequence represented by formula (V) herein. In some embodiments, the dsRNA agent includes an antisense strand having a nucleotide sequence represented by formula (IV) herein and a sense strand having a nucleotide sequence represented by formula (V) herein. In some embodiments, the dsRNA agent includes an antisense strand having a nucleotide sequence represented by formula (II) herein and a sense strand having a nucleotide sequence represented by formula (V') herein. In some embodiments, the dsRNA agent includes an antisense strand having a nucleotide sequence represented by formula (III) herein and a sense strand having a nucleotide sequence represented by formula (V') herein. In some embodiments, the dsRNA agent comprises an antisense strand having a nucleotide sequence represented by formula (IV) herein and a sense strand having a nucleotide sequence represented by formula (V′) herein. In some embodiments, the dsRNA agent comprises an antisense strand having a nucleotide sequence represented by formula (I-2) herein and a sense strand having a nucleotide sequence represented by formula (V′) herein. In some embodiments, the dsRNA agent comprises an antisense strand having a nucleotide sequence represented by formula (I′) herein and a sense strand having a nucleotide sequence represented by formula (V′) herein.

[0148] In some more specific embodiments, the dsRNA agent has 2′-fluoro modified nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5′ end); and 2′-fluoro modified nucleotides at positions 9, 11, and 13 of the sense strand of formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand). In some more specific embodiments, the dsRNA agent has 2′-fluoro modified nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5′ end); and 2′-fluoro modified nucleotides at positions 9, 11, and 12 of the sense strand of formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand). In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; and the nucleotides at positions 11, 12, and 14 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluoro-modified nucleotides; and the nucleotides at positions 11, 12, and 15 of the sense strand of formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0149] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 12 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; and the nucleotides at positions 11, 12, and 14 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14 and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; and the nucleotides at positions 11, 12 and 15 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0150] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 12 of the sense strand of formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0151] In some more specific embodiments, the nucleotides at positions 2, 4, 10, 14 and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11 and 12 of the sense strand of formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0152] In some more specific embodiments, the nucleotides at positions 2, 7, 10, 14 and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11 and 12 of the sense strand of formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0153] In some more specific embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA agent represented by formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0154] In some more specific embodiments, the nucleotides at positions 2, 8, and 14 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand represented by formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 7, and 14 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand represented by formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 12, and 14 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand represented by formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand represented by formula (V) or formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 14, and 18 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; the nucleotides at positions 8, 11, and 13 of the sense strand represented by formula (V) or (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 6, and 14 of the antisense strand of the dsRNA agent (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; the nucleotides at positions 8, 11, and 13 of the sense strand represented by formula (V) or (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0155] In another aspect of the present invention, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein these RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the sense strand having 18 to 40 nucleotides, the dsRNA agent comprising an antisense strand having a nucleotide sequence represented by formula (I-2) herein and a sense strand having a nucleotide sequence represented by formula (V) herein,

[0156] The antisense strand comprises the following represented by formula (I-2) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N M10 N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (I-2)

[0157] The sense strand comprises the residue represented by formula (V) listed in the 5' to 3' direction: 5'-(N' L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V)

[0158] Among them, each N F and N′ F Each independently represents a 2′-fluoro modified nucleotide;

[0159] NM1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 There are only three 2′-fluoro modified nucleotides;

[0160] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 at least two 2′-fluoro-modified nucleotides;

[0161] In the sense strand of formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) contains no more than six 2′-fluorine-modified nucleotides in total;

[0162] Each N L and N′ L Each independently represents a modified or unmodified nucleotide;

[0163] Each of n and n' independently can be an integer from 0 to 7.

[0164] In another aspect of the present invention, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the sense strand having 18 to 40 nucleotides, the dsRNA agents comprising an antisense strand having a nucleotide sequence represented by formula (I') herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0165] The antisense strand comprises the compound represented by formula (I') listed in the 3' to 5' direction: 3'-(N L ) n N M1 N L N F N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5′ Formula (I')

[0166] The sense strand comprises the residue represented by formula (V) listed in the 5' to 3' direction: 5'-(N' L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V)

[0167] Among them, each N F and N′ F Each independently represents a 2′-fluorine-modified nucleotide;

[0168] N M1 、N M3 、N M4 、N M5 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M3 、N M4 、N M5 、N M7 and N M8No more than one 2′-fluoro-modified nucleotide;

[0169] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 at least two 2′-fluoro-modified nucleotides;

[0170] In the sense strand of formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) contains no more than six 2′-fluorine-modified nucleotides in total;

[0171] Each N L and N′ L Each independently represents a modified or unmodified nucleotide;

[0172] Each of n and n' independently can be an integer from 0 to 7.

[0173] It is understood that the dsRNA agent includes a combination of an antisense strand having any modification described herein by Formula (X), Formula (I), Formula (I'), Formula (I-1), Formula (I-2), Formula (II), Formula (III), Formula (IV) and a sense strand having any modification described herein by Formula (V), (IX) or Formula (V'). It is further understood that the dsRNA agent includes a combination of an antisense strand having any modification described herein by Formula (X) and a sense strand having any modification described herein by Formula (V) or Formula (IX).

[0174] Another aspect of the present invention provides a composition comprising any embodiment of the above-mentioned dsRNA of the present invention.

[0175] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. Such compositions typically include one or more RNAi and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents compatible with drug administration. It is well known in the art that such media and reagents are used for pharmaceutically active substances. Unless any conventional media or reagents are incompatible with the active compound, their use in these compositions is encompassed.

[0176] Depending on whether local or systemic treatment is desired and depending on the area to be treated, the compositions of the present invention can be given in a variety of ways. Administration can be local (including through the eye, vagina, rectum, nasal, transdermal), oral or parenteral. In certain embodiments, parenteral administration includes subcutaneous administration, intravenous drip, intraarterial, intralymphatic, intrabronchial, intrapleural, intraperitoneal, cerebrospinal or intramuscular injection, intrathecal or intraventricular administration. In certain embodiments, the approach and position of administration can be selected to enhance targeting. For example, in order to target myocytes, intramuscular injection into the muscle of interest would be a logical choice. In certain embodiments, targeting of lung cells can be achieved by administering RNAi in aerosol form.

[0177] In some embodiments, the composition further comprises one or more additional therapeutic agents.

[0178] In some embodiments, the composition is packaged in a kit, container, package, dispenser, prefilled syringe, or vial.

[0179] In another aspect of the present invention, a cell is provided, comprising any of the embodiments of the dsRNA agent described above in some embodiments of the present invention.

[0180] In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0181] Another aspect of the present invention provides a method for inhibiting target gene expression in a cell, the method comprising: delivering a dsRNA agent comprising any of the embodiments of the present invention described above into a subject or object, such that the dsRNA agent is delivered to a specific target in the subject. The dsRNA agent of the present invention can be used to treat or alleviate a condition, disease, or disorder associated with abnormal target gene expression or activity, for example, overexpression of the gene product leading to a pathological phenotype. Exemplary target genes include, but are not limited to, LPA, PNPLA3, ASGR1, F7, F12, FXI, APOCIII, APOB, APOL1, TTR, PCSK9, SCAP, KRAS, CD274, PDCD1, C5, ALAS1, HAO1, LDHA, ANGPTL3, SERPINA1, AGT, HAMP, LECT2, EGFR, VEGF, KIF11, AT3, CTNNB1, HMGB1, HIF1A, APP, ATXN2, C9orf72, TARDBP, MAPT (Tau), HTT, SNCA, FUS, ATXN3, SCN9A, SCN10A, CACNA1B, ATXN1, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, and STAT3. Target genes may also include viral genes, such as hepatitis B and hepatitis C virus genes, human immunodeficiency virus genes, herpes virus genes, etc. Exemplary diseases include, but are not limited to, viral diseases (such as HIV, HBV), neuromuscular diseases, bacterial infections, inflammatory and immune diseases, metabolic diseases, liver diseases, kidney diseases, cardiovascular diseases, ophthalmic diseases, lung diseases, and rare diseases.

[0182] A composition comprising a dsRNA can be delivered to a subject by a variety of routes. Exemplary routes include ocular, vaginal, rectal, intranasal, transdermal, subcutaneous administration, intravenous infusion, intraarterial, translymphatic, intrabronchial, intrapleural, intraperitoneal, cerebrospinal or intramuscular injection, pulmonary, intrathecal or intraventricular. The RNAi molecules of the invention can be incorporated into pharmaceutical compositions suitable for administration.

[0183] In some embodiments, the subject is within the body and the dsRNA agent is administered subcutaneously to the subject.

[0184] In some embodiments, the subject is in vivo and the dsRNA agent is administered to the subject by intravenous administration.

[0185] Sequence description or description of the drawings

[0186] SEQ ID NO: 1 is FXII mRNA [NCBI Reference Sequence: NM_021489.3; duplex AD# of the present invention is shown in Table 1 and shows its unmodified sense and antisense strand sequences; duplex AD# of the present invention is shown in Table 2 and shows its modified sense and antisense strand sequences, chemical modifications are indicated as follows: uppercase indicates 2'-fluorine modified nucleotides; lowercase indicates 2'-OMe modified nucleotides; "*" indicates phosphorothioate inter-linkages; delivery molecules used in in vivo studies are indicated as "GLX-n" at the 3' or 5' end of each sense strand; "Invab" indicates inverted abasic;

[0187] FIG1 is a schematic diagram of the position of the dsRNA sequence of the present invention;

[0188] FIG2 is a schematic diagram of the position of a dsRNA sequence containing a mismatched base according to the present invention;

[0189] Figures 3-1 and 3-2 are schematic diagrams of the position of dsRNA sequences containing an overhang of the present invention;

[0190] FIG4 shows the FXII silencing effect of AD00127 of the present invention and positive controls AD00198 and AD00199 in mice after 14 days of use. DETAILED DESCRIPTION

[0191] Some embodiments of the present invention, for example but not limited to, include, on the one hand, RNAi agents capable of inhibiting target gene expression, wherein these RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising a compound represented by formula (X) listed in the 3′ to 5′ direction: 3′-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5′ formula (X)

[0192] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0193] Each N X Each independently represents a modified or unmodified nucleotide, N X No more than three 2′-fluoro-modified nucleotides;

[0194] n can be an integer from 0 to 7.

[0195] In some embodiments, RNAi agents for inhibiting target gene expression are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising a compound represented by formula (I) listed in the 3′ to 5′ direction: 3′-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5′ Formula (I)

[0196] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0197] Each N X Each independently represents a modified or unmodified nucleotide, N X There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide;

[0198] n can be an integer from 0 to 7.

[0199] In some embodiments, RNAi agents capable of inhibiting target gene expression are included, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising the formula (I-1) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 NL N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (I-1)

[0200] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0201] N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide;

[0202] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0203] n can be an integer from 0 to 7.

[0204] In some embodiments, in the antisense strand of the dsRNA agent represented by formula (I-1), N M1 、N M2 、N M3 、N M4 、N M6 、N M7 and N M8 There are only three 2′-fluorinated nucleotides in N M5 It is not a 2'-fluoro modified nucleotide. It will be understood by those skilled in the art that, for example but not limited to, in some non-limiting embodiments, N M1 、NM2 、N M3 are 2′-fluorinated nucleotides, N M4 、N M5 、N M6 、N M7 and N M8 are not 2'-fluorinated nucleotides. It will be understood by those skilled in the art that positions 2, 12, 14, 16, and 18 in the antisense strand are 2'-fluorinated nucleotides, while the nucleotides at other positions are not 2'-fluorinated nucleotides. In other non-limiting embodiments, N M2 、N M3 、N M6 All are 2′-fluorinated nucleotides, N M1 、N M4 、N M5 、N M7 and N M8 Those skilled in the art will appreciate that positions 2, 7, 12, 14, and 16 of the antisense strand are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides; in other non-limiting embodiments, N M1 、N M3 、N M7 All are 2′-fluorinated nucleotides, N M2 、N M4 、N M5 、N M6 and N M8 Those skilled in the art will appreciate that positions 2, 5, 12, 14, and 18 in the antisense strand are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides; in other non-limiting embodiments, N M1 、N M3 、N M6 All are 2′-fluorinated nucleotides, N M2 、N M4 、N M5 、N M7 and N M8 Those skilled in the art will appreciate that positions 2, 7, 12, 14, and 18 in the antisense strand are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides; in other non-limiting embodiments, N M2 、N M3 、N M7 All are 2′-fluorinated nucleotides, N M1 、N M4 、N M5 、N M6 and NM8 Those skilled in the art will appreciate that positions 2, 5, 12, 14, and 16 of the antisense strand are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides; in other non-limiting embodiments, N M2 、N M4 、N M7 All are 2′-fluorinated nucleotides, N M1 、N M3 、N M5 、N M6 and N M8 None of them are F-modified nucleotides. Those skilled in the art will understand that positions 2, 5, 10, 14 and 16 in the antisense chain are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides.

[0205] In some embodiments, the antisense strand of the dsRNA agent comprises a molecule represented by Formula (II) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5′ Formula (II)

[0206] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0207] N M1 、N M2 、N M3 、N M4 、N M5 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 and N M4 There are only two 2′-fluoro modified nucleotides in N M5 、N M7 and N M8Not a 2′-fluorine-modified nucleotide;

[0208] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0209] n can be an integer from 0 to 7.

[0210] In some non-limiting embodiments, in the antisense strand of the dsRNA agent represented by formula (II), N M1 、N M2 、N M3 、N M4 、N M5 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 and N M4 There are only two 2′-fluoro modified nucleotides in N M5 、N M7 and N M8 It is not a 2'-fluoro modified nucleotide. It will be understood by those skilled in the art that, for example but not limited to, in some non-limiting embodiments, N M1 、N M2 All are 2′-fluorinated nucleotides, N M3 、N M4 、N M5 、N M7 and N M8 are not 2'-fluorinated nucleotides. It will be understood by those skilled in the art that positions 2, 7, 14, 16, and 18 in the antisense strand are 2'-fluorinated nucleotides, while the nucleotides at other positions are not 2'-fluorinated nucleotides. In other non-limiting embodiments, N M2 、N M3 All are 2′-fluorinated nucleotides, N M1 、N M4 、N M5 、N M7 and N M8 are not 2'-fluorinated nucleotides. It will be understood by those skilled in the art that positions 2, 7, 12, 14, and 16 in the antisense strand are 2'-fluorinated nucleotides, while the nucleotides at other positions are not 2'-fluorinated nucleotides. In other non-limiting embodiments, N M1 、N M3 It is a 2′-fluorinated nucleotide, N M2 、N M4 、N M5 、N M7and N M8 are not 2'-fluorinated nucleotides. It will be understood by those skilled in the art that positions 2, 7, 12, 14, and 18 in the antisense strand are 2'-fluorinated nucleotides, while the nucleotides at other positions are not 2'-fluorinated nucleotides. In other non-limiting embodiments, N M2 、N M4 It is a 2′-fluorinated nucleotide, N M1 、N M3 、N M5 、N M7 and N M8 None of them are 2′-fluorine modified nucleotides. Those skilled in the art will understand that positions 2, 7, 10, 14 and 16 in the antisense chain are 2′-fluorine modified nucleotides, while the nucleotides at other positions are not 2′-fluorine modified nucleotides.

[0211] In some embodiments, the antisense strand of the dsRNA agent comprises a compound represented by Formula (III) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N F N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (III)

[0212] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0213] N M1 、N M2 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M6 and N M7 There are only two 2′-fluoro modified nucleotides in N M4 、N M5 and N M8Not a 2′-fluorine-modified nucleotide;

[0214] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0215] n can be an integer from 0 to 7.

[0216] In some non-limiting embodiments, the dsRNA agent has N in the antisense strand of formula (III). M1 、N M2 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M6 and N M7 There are only two 2′-fluoro modified nucleotides in N M4 、N M5 and N M8 It is not a 2'-fluoro modified nucleotide. It can be understood by those skilled in the art that, for example but not limited to, in some non-limiting embodiments, the dsRNA agent is N in the antisense strand shown in formula (III). M1 、N M7 All are 2′-fluorinated nucleotides, N M2 、N M4 、N M5 、N M6 and N M8 The nucleotides at positions 2, 5, 12, 14 and 18 in the antisense strand are not 2'-fluorinated nucleotides. It can be understood by those skilled in the art that the nucleotides at positions 2, 5, 12, 14 and 18 in the antisense strand are 2'-fluorinated nucleotides, while the nucleotides at other positions are not 2'-fluorinated nucleotides. In other non-limiting embodiments, it means that the dsRNA agent has N in the antisense strand shown in formula (III). M2 、N M6 All are 2′-fluorinated nucleotides, N M1 、N M4 、N M5 、N M7 and N M8 are not 2'-fluorinated nucleotides. It will be understood by those skilled in the art that positions 2, 7, 12, 14, and 16 in the antisense strand are 2'-fluorinated nucleotides, while the nucleotides at other positions are not 2'-fluorinated nucleotides. In other non-limiting embodiments, it refers to that the dsRNA agent has N in the antisense strand shown in formula (III). M3 、N M7All are 2′-fluorinated nucleotides, N M1 、N M4 、N M5 、N M6 and N M8 The nucleotides at positions 2, 5, 12, 14 and 16 in the antisense strand are not 2'-fluorinated nucleotides. It can be understood by those skilled in the art that the nucleotides at positions 2, 5, 12, 14 and 16 in the antisense strand are 2'-fluorinated nucleotides, while the nucleotides at other positions are not 2'-fluorinated nucleotides. In other non-limiting embodiments, it means that the dsRNA agent has N in the antisense strand shown in formula (III). M4 、N M7 All are 2′-fluorinated nucleotides, N M1 、N M3 、N M5 、N M6 and N M8 None of them are 2′-fluorine modified nucleotides. Those skilled in the art will understand that positions 2, 5, 10, 14 and 16 in the antisense chain are 2′-fluorine modified nucleotides, while the nucleotides at other positions are not 2′-fluorine modified nucleotides.

[0217] In some non-limiting embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides. It will be understood that the dsRNA agent no longer contains 2′-fluoro-modified nucleotides at other positions in the antisense strand.

[0218] As used herein, the position of the dsRNA agent in formula (I-1) counting from the first paired nucleotide of the antisense strand from the 5' end generally refers to the first paired nucleotide N from the 5' end of the antisense strand. L Counting starts from the paired blunt end, a non-limiting example, as shown in formula (Ia), 3′-(N L ) n N M1 N L N F N L N F N L N F N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L(1st position)-5′ formula (Ia); It is more understandable that the first mismatch in the dsRNA agent is also a pairing, also known as the 1st position.

[0219] In some specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2′-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 4, 10, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; those skilled in the art will understand that in these specific embodiments, the dsRNA agent has and only has five 2′-fluoro-modified nucleotides in the antisense strand represented by formula (I-1).

[0220] In some embodiments, the dsRNA agent is in the antisense strand of formula (I-1), N M1 、N M2 、N M3 、N M5 、N M6 and N M8 There is only one 2′-fluorinated nucleotide in N M4 、N M7 Not a 2′-fluoro modification.

[0221] In some non-limiting embodiments, in the antisense strand of the dsRNA agent represented by formula (I-1), N M1 、N M2 、N M3 、N M5 、N M6 and N M8 There is only one 2′-fluorinated nucleotide in N M4 、N M7 It is not a modified nucleotide of F. It will be understood by those skilled in the art that, for example but not limited to, in some non-limiting embodiments, NM2 It is a 2′-fluorinated nucleotide, N M1 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Those skilled in the art will understand that the nucleotides at positions 2, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide at the 5′ end) are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides; in other non-limiting embodiments, N M3 It is a 2′-fluorinated nucleotide, N M1 、N M2 、N M4 、N M5 、N M6 、N M7 and N M8 are not 2'-fluoro modified nucleotides. It will be understood by those skilled in the art that the nucleotides at positions 2, 12 and 14 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the RNAi agent shown in formula (I-1) are 2'-fluoro modified nucleotides, while the nucleotides at other positions are not 2'-fluoro modified nucleotides; in other non-limiting embodiments, it refers to that N M5 All are 2′-fluorinated nucleotides, N M1 、N M2 、N M3 、N M4 、N M6 、N M7 and N M8 are not 2'-fluoro modified nucleotides. It will be understood by those skilled in the art that the nucleotides at positions 2, 8 and 14 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides, while the nucleotides at other positions are not 2'-fluoro modified nucleotides; in other non-limiting embodiments, it refers to that N M8 All are 2′-fluorinated nucleotides, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 and N M7None of the nucleotides are 2′-fluoro-modified nucleotides. It will be understood by those skilled in the art that the nucleotides at positions 2, 4, and 14 of the antisense strand of Formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides, while the nucleotides at other positions are not 2′-fluoro-modified nucleotides. It will be understood by those skilled in the art that in these specific embodiments of dsRNA reagents, there are only three 2′-fluoro-modified nucleotides in the antisense strand of Formula (I-1).

[0222] In some embodiments, the antisense strand of the dsRNA agent comprises a 3′ to 5′ direction represented by Formula (IV): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (IV)

[0223] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0224] N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M5 、N M6 and N M8 There is only one 2′-fluorinated nucleotide in N M4 、N M7 Not a 2′-fluorine-modified nucleotide;

[0225] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0226] n can be an integer from 0 to 7.

[0227] In some embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand of Formula (IV) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluoro-modified nucleotides. In some embodiments, the nucleotides at positions 2, 8, and 14 of the antisense strand of Formula (IV) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluoro-modified nucleotides. In some embodiments, the nucleotides at positions 2, 12, and 14 of the antisense strand of Formula (IV) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluoro-modified nucleotides. In some embodiments, the nucleotides at positions 2, 14, and 16 of the antisense strand of Formula (IV) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluoro-modified nucleotides. In some specific embodiments, the nucleotides at positions 2, 14, and 18 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides. In some specific embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand of the dsRNA agent represented by formula (IV) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides. It will be understood by those skilled in the art that in these specific embodiments, the dsRNA agent has and only has three 2′-fluoro-modified nucleotides in the antisense strand of formula (IV). In some more specific embodiments, the nucleotides at positions 2, 6, and 14 of the antisense strand of the dsRNA agent (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides.

[0228] In some embodiments, RNAi agents capable of inhibiting target gene expression are included, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising the formula (I-2) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N M10 N M5 N M6 NL N M7 N M8 N L N F N L -5′ Formula (I-2)

[0229] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0230] N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 There are only three 2′-fluoro modified nucleotides;

[0231] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0232] n can be an integer from 0 to 7.

[0233] In some specific embodiments, the nucleotides at positions 2, 7, 11, 14, and 16 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluorinated nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 11, 14, and 18 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluorinated nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 11, 14, and 18 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluorinated nucleotides; in some specific embodiments, The nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 8, 12, 14, and 16 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 9, 12, 14, and 16 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides.

[0234] In some embodiments, RNAi agents capable of inhibiting target gene expression are included, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising a 3′ to 5′ direction represented by formula (I′): 3′-(N L ) n N M1 N L N F N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5′ Formula (I')

[0235] Among them, each N Frepresents 2′-fluorine-modified nucleotides;

[0236] N M1 、N M3 、N M4 、N M5 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M3 、N M4 、N M5 、N M7 and N M8 No more than one 2′-fluoro-modified nucleotide;

[0237] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0238] n can be an integer from 0 to 7.

[0239] In some more specific embodiments, in the antisense strand of the dsRNA agent represented by formula (I'), N M1 、N M3 、N M4 、N M5 、N M7 and N M8 No more than one 2'-fluoro modified nucleotide, it will be understood by those skilled in the art that N M1 、N M3 、N M4 、N M5 、N M7 and N M8There is only one or no 2′-fluoro modified nucleotide, i.e., there are only four or five 2′-fluoro modified nucleotides in formula (I′), and positions 2, 7, 14 and 16 in the antisense strand of formula (I′) have a common 2′-fluoro modified nucleotide. In some specific embodiments, the nucleotides at positions 2, 5, 7, 14, and 16 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 4, 7, 14, and 16 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 8, 14, and 16 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 8, 14, and 16 of the antisense strand of formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; In some embodiments, the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand of Formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; in some embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of Formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides; in some embodiments, the nucleotides at positions 2, 7, 14, 16, and 18 of the antisense strand of Formula (I-2) (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides. In some embodiments, the nucleotides at positions 2, 7, 14, and 16 of the antisense strand of Formula (I-2) of the dsRNA agent (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides. XOne or more of the nucleotides is independently selected from the following modified nucleotides: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides (MOE), abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural base containing nucleotides.

[0240] In some embodiments, N of Formula (I-1), (I-2), (I′), Formula (II), Formula (III) and / or Formula (IV) in the dsRNA agents of the present invention is L One or more of the nucleotides is a modified nucleotide independently selected from the group consisting of a 2'-O-methyl modified nucleotide, a 2'-deoxy nucleotide, a 2',3'-seco nucleotide mimetic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxy nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate group modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidate, or an unnatural base containing nucleotide.

[0241] In some embodiments, in the dsRNA agents of the present invention, N in the antisense strand of Formula (I-1), (I-2), (I′), (II), (III), and / or (IV) LThe nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, GNA, LNA, UNA or Invab. In some preferred embodiments, the N in the antisense strand of the dsRNA agent of the present invention is L One or more of the nucleotides are modified nucleotides independently selected from the group consisting of 2'-O-methyl modified nucleotides.

[0242] In some embodiments, the dsRNA agents of the present invention are N in the antisense strand of Formula (I-1), (I-2), (I′), (II), (III), and / or (IV). M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 Each of the modified nucleotides is independently selected from the following: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), open ring nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some embodiments, the dsRNA agent of the present invention has N in the antisense strand of formula (I-1) M1 、N M2 、N M4 、N M5 、N M6 、N M7 and / or N M8 When it is not a 2'-fluoro modified nucleotide, it is preferably a 2'-O-methyl modified nucleotide, UNA, GNA, or LNA.

[0243] In some non-limiting embodiments, in the antisense strand of the dsRNA agent of the present invention, N M1 、N M7 It is a 2′-fluorinated nucleotide, N M2 、N M4、N M5 、N M6 and / or N M8 The modified or unmodified nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some preferred embodiments, the N in the dsRNA agent is M2 、N M4 、N M5 、N M6 and / or N M8 One or more of the modified or unmodified nucleotides are independently preferably selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, N in the dsRNA agent M2 、N M4 、N M5 、N M6 and / or N M8 It represents a modified or unmodified nucleotide, and more preferably a 2'-O-methyl modified nucleotide.

[0244] In some non-limiting embodiments, in the antisense strand of the dsRNA agent of the present invention, N M2 、N M6 It is a 2′-fluorinated nucleotide, N M1 、N M4 、N M5 、N M7 and / or N M8The modified or unmodified nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some preferred embodiments, the N in the dsRNA agent is M1 、N M4 、N M5 、N M7 and / or N M8 One or more of the nucleotides are independently selected from the group consisting of 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. M1 、N M4 、N M5 、N M7 and / or N M8 Among the nucleotides, 2'-O-methyl-modified nucleotides are more preferred.

[0245] It is understood that the dsRNA agent of the present invention has N in the antisense strand represented by formula (II) or formula (III). M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 All have such modifying properties.

[0246] In some non-limiting embodiments, in the dsRNA agent of the present invention, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、NM7 and / or N M8 Each independently represents a modified or unmodified nucleotide, N M1 is a 2′-fluorinated nucleotide, N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 Not 2′-fluorine modified, N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some preferred embodiments, the dsRNA agent is N in the antisense strand of formula (IV) M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, the dsRNA agent has N in the antisense strand of formula (IV) M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 The nucleotides are 2'-O-methyl modified nucleotides.

[0247] In some non-limiting embodiments, in the dsRNA agent of the present invention, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 Each independently represents a modified or unmodified nucleotide, N M2 is a 2′-fluorinated nucleotide, N M1 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 Not a 2′-fluorinated nucleotide, N M1 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some preferred embodiments, the dsRNA agent has N in the antisense strand of formula (IV) M1 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, the dsRNA agent has N in the antisense strand of formula (IV) M1 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 The nucleotides are 2'-O-methyl modified nucleotides.

[0248] In some non-limiting embodiments, the dsRNA agent has N in the antisense strand of formula (IV). M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 Each independently represents a modified or unmodified nucleotide, N M3 is a 2′-fluorinated nucleotide, N M1 、N M2 、N M4 、N M5 、N M6 、N M7 and / or N M8 Not a 2′-fluorinated nucleotide, N M1 、N M2 、N M4 、N M5 、N M6 、N M7 and / or N M8The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some preferred embodiments, the dsRNA agent has N in the antisense strand of formula (IV) M1 、N M2 、N M4 、N M5 、N M6 、N M7 and / or N M8 One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, the dsRNA agent has N in the antisense strand of formula (IV) M1 、N M2 、N M4 、N M5 、N M6 、N M7 and / or N M8 The nucleotides are 2'-O-methyl modified nucleotides.

[0249] In some non-limiting embodiments, the dsRNA agent has N in the antisense strand of formula (IV). M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 Each independently represents a modified or unmodified nucleotide, N M6 is a 2′-fluorinated nucleotide, N M1 、N M2 、N M3 、N M4 、NM5 、N M7 and / or N M8 Not a 2′-fluorinated nucleotide, N M1 、N M2 、N M4 、N M5 、N M6 、N M7 and / or N M8 The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some preferred embodiments, the dsRNA agent has N in the antisense strand of formula (IV) M1 、N M2 、N M4 、N M5 、N M6 、N M7 and / or N M8 One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, the dsRNA agent has N in the antisense strand of formula (IV) M1 、N M2 、N M4 、N M5 、N M6 、N M7 and / or N M8 The nucleotides are 2'-O-methyl modified nucleotides.

[0250] It is understood that the dsRNA agent of the present invention has N in the antisense strand represented by formula (IV). M1 、N M2 、N M3 、N M4 、N M5 、NM6 、N M7 and / or N M8 All have such modifying properties.

[0251] In some non-limiting embodiments, in the dsRNA agent of the present invention, N in the antisense strand of formula (I-2) M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and / or N M10 Each independently represents a modified or unmodified nucleotide, N M2 、N M6 、N M9 are a 2′-fluorinated nucleotide, N M1 、N M3 、N M4 、N M5 、N M7 、N M8 and / or N M10 The nucleotides other than 2'-fluoro modified nucleotides are selected from the group consisting of 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates, or non-natural bases containing nucleotides. In some preferred embodiments, the dsRNA agent has N in the antisense strand shown in (I-2). M1 、N M3 、N M4 、N M5 、N M7 、N M8 and / or N M10One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, the dsRNA agent has N in the antisense strand shown in (I-2). M1 、N M3 、N M4 、N M5 、N M7 、N M8 and / or N M108 The nucleotides are 2'-O-methyl modified nucleotides. It is understood that the dsRNA agent of the present invention has such modification characteristics in the antisense strand represented by formula (I-2).

[0252] In some non-limiting embodiments, in the dsRNA agent of the present invention, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or and / or N M8 Each independently represents a modified or unmodified nucleotide, wherein the modified nucleotide is selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some preferred embodiments, the

[0253] The dsRNA reagent is in the antisense strand shown in (I') M1 、N M3 、N M4 、N M5 、N M7 and / or N M8One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, the dsRNA agent has N in the antisense strand shown in (I'). M1 、N M3 、N M4 、N M5 、N M7 and / or N M8 In some non-limiting embodiments, in the dsRNA agent of the present invention, N in the antisense strand shown in formula (I') is 2'-O-methyl modified nucleotide. M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or and / or N M8 Each independently represents a modified or unmodified nucleotide, wherein the modified nucleotide is selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2', 3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some preferred embodiments, the dsRNA agent is in the antisense strand shown in (I'), N M7 are a 2′-fluorinated nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 and / or N M8 Not a 2′-fluorinated nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、NM6 and / or N M8 One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, the dsRNA agent has N in the antisense strand shown in (I'). M1 、N M2 、N M3 、N M4 、N M5 、N M6 and / or N M8 The nucleotides are 2'-O-methyl modified nucleotides.

[0254] In some embodiments, the dsRNA agent wherein the sense strand complementary or substantially complementary to the antisense strand of Formula (I) is entirely or substantially modified nucleotides. In some embodiments, the dsRNA agent wherein the sense strand is entirely modified nucleotides. The nucleotides of the sense strand are selected from the following modified nucleotides: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural base containing nucleotides.

[0255] In some embodiments, the dsRNA agent wherein the sense strand complementary or substantially complementary to the antisense strand of Formula (I') is entirely or substantially modified nucleotides. In some embodiments, the dsRNA agent wherein the sense strand is entirely modified nucleotides. The nucleotides of the sense strand are selected from the following modified nucleotides: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural base containing nucleotides.

[0256] In some embodiments, the dsRNA agents of the invention are those in which all or substantially all nucleotides of the sense and antisense strands are modified nucleotides.

[0257] In some embodiments, the dsRNA agent has a sense strand that is complementary or substantially complementary to the antisense strand of Formula (I), and the length of the complementary or substantially complementary strand is between 18 and 25 nucleotides. In some embodiments, the length of the complementary or substantial region of the dsRNA agent is 18-23 nucleotides. In some embodiments, the length of the complementary or substantial region of the dsRNA agent is 19-21 nucleotides. In other embodiments, for example, the length of the complementary or substantial region can be 18-25 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, or 19-21 nucleotides in length. In another example, in some embodiments, the length of the complementary or substantial region is 18, 19, 20, or 21 nucleotides.

[0258] In some embodiments, the dsRNA agent has a sense strand that is complementary or substantially complementary to the antisense strand of Formula (X), and the length of the complementary or substantially complementary strand is between 18 and 25 nucleotides. In some embodiments, the length of the complementary or substantial region of the dsRNA agent is 18-23 nucleotides. In some embodiments, the length of the complementary or substantial region of the dsRNA agent is 19-21 nucleotides. In other embodiments, for example, the length of the complementary or substantial region can be 18-25 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, or 19-21 nucleotides in length. In another example, in some embodiments, the length of the complementary or substantial region is 18, 19, 20, or 21 nucleotides.

[0259] In some embodiments, the dsRNA agent has a sense strand that is fully complementary to the antisense strand of Formula (X).

[0260] In some embodiments, the dsRNA agent has a sense strand that is fully complementary to the antisense strand of Formula (I).

[0261] In some embodiments, the antisense strand of the dsRNA agent formula (X) is fully or substantially complementary to the target gene.

[0262] In some embodiments, the antisense strand of the dsRNA agent of Formula (I) is fully or substantially complementary to the target gene.

[0263] In some embodiments, the dsRNA reagent of the present invention does not comprise mismatches. In certain embodiments, the target gene dsRNA reagent of the present invention comprises no more than 1 mismatch (such mismatches do not affect the counting starting position of the pairing). In some embodiments, the dsRNA reagent of the present invention comprises no more than 2 mismatches. In certain embodiments, the dsRNA reagent of the present invention comprises no more than 3 mismatches. In some embodiments of the present invention, the antisense strand of the dsRNA reagent comprises a mismatch with a target sequence that is not located at the center of the complementary region. In some embodiments, the antisense strand of the dsRNA reagent comprises 1, 2, 3, 4 or 5 more mismatches, which are located within the last 5, 4, 3, 2 or 1 nucleotides of one or both of the 5' or 3' ends of the complementary region.

[0264] In some embodiments, each strand of a dsRNA agent of the invention is no more than 30 nucleotides in length.

[0265] In some embodiments, each strand of a dsRNA agent of the invention is no more than 25 nucleotides in length.

[0266] In some embodiments, each strand of a subject dsRNA agent is no more than 23 nucleotides in length.

[0267] In some embodiments, each strand of a subject dsRNA agent is 19, 20, or 21 nucleotides in length.

[0268] In one embodiment, both ends of the sense strand and the antisense strand of the dsRNA agent of the present invention have two blunt ends. For example, each strand of the dsRNA agent is completely paired to form a blunt-end structure.

[0269] In one embodiment, the antisense strand of the dsRNA agent of formula (I) has 1-5 unpaired nucleotide overhangs at the 3'-end, such as overhangs of 1, 2, 3, 4 or 5 unpaired nucleotides. These overhangs can be the result of one chain being longer than the other, or the result of two chains having the same length being staggered. The overhang can form a mismatch with the target mRNA, or it can be complementary to the targeted gene sequence or can be other sequences. The first and second chains can also, for example, be connected by additional bases to form a hairpin or by other non-basic linkers.

[0270] In certain embodiments, the antisense strand of the dsRNA agent is complementary or partially complementary to the sense strand of formula (I) and has blunt ends at the 3'-end and / or the 5'-end.

[0271] In some embodiments, the sense strand of the dsRNA agent that is complementary or partially complementary to the antisense strand of formula (I) has an overhang of 1-5 unpaired nucleotides at the 3'-end and / or 5'-end, such as an overhang of 1, 2, 3, 4 or 5 unpaired nucleotides. In certain embodiments, the sense strand of the dsRNA agent that is complementary or partially complementary to the antisense strand of formula (I) has a blunt end at the 3'-end and / or 5'-end.

[0272] In some embodiments, the overhang of unpaired nucleotides of the sense and / or antisense strands of the dsRNA agents of the invention are 2-5 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length.

[0273] In one embodiment, the nucleotides in the overhang region of the dsRNA agent of the invention can each independently be one or more modified or unmodified nucleotides, and the modified nucleotides include but are not limited to: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural base containing nucleotides.

[0274] In one embodiment, both ends of the overhang on the sense strand, the antisense strand, or both strands of the overhang region of the dsRNA agent of the invention may be phosphorylated.

[0275] In one embodiment, the overhang of a dsRNA agent of the present invention is present at the 3' or 5' end of the sense strand, the antisense strand, or both strands. In one embodiment, the 3'-overhang is present in the antisense strand. In one embodiment, the 5'-overhang is present in the sense strand.

[0276] In one embodiment, the dsRNA agent of the present invention may include only a single overhang, which can enhance the interference activity of the dsRNA without affecting its overall stability. For example, the single-stranded overhang is located at the 5'-end of the sense strand, or alternatively, at the 3' end of the antisense strand. The corresponding dsRNA may also have a blunt end located at the 5' end of the antisense strand (or the 3' end of the sense strand), or vice versa.

[0277] In one embodiment, the dsRNA agents of the invention are blunt ended at the 5'-end of the antisense strand or the 3'-end of the sense strand.

[0278] In some embodiments, the dsRNA agents of the invention comprise at least one phosphorothioate internucleoside linkage.

[0279] In some embodiments, the sense strand of a dsRNA agent of the invention comprises at least one phosphorothioate internucleoside linkage.

[0280] In some embodiments, the antisense strand of a dsRNA agent of the invention comprises at least one phosphorothioate internucleoside linkage.

[0281] In some embodiments, the sense and / or antisense strands of the dsRNA agents of the invention comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphorothioate internucleoside linkages.

[0282] In one embodiment, the sense strand of a dsRNA agent of the invention comprises 1-10 blocks having two to ten phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages, or an antisense strand comprising either phosphorothioate or phosphate linkages.

[0283] In one embodiment, the antisense strand of a dsRNA agent of the invention comprises 1-10 blocks having two to ten phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages, or a sense strand comprising either phosphorothioate or phosphate linkages.

[0284] In one embodiment, the dsRNA agent of the invention further comprises one or more phosphorothioate internucleotide linkage modifications in 1-10 duplex internal regions of each of the sense strand and / or antisense strand. For example, at positions 8-16 of the duplex region, counted from the 3' end of the sense strand, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be linked via phosphorothioate internucleotide linkages; the dsRNA may optionally further comprise one or more phosphorothioate internucleotide linkage modifications in 1-10 terminal positions.

[0285] In one embodiment, the dsRNA agent of the invention further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modifications in positions 1-5 of the sense strand and further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modifications in positions 18-23 (as used herein counting from the paired 3' end of the sense strand), and further comprises one to two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and further comprises one to five in positions 18-23 (as used herein counting from the blunt 5' end of the antisense strand). In one embodiment, the dsRNA agent of the invention contains 1 or 2 phosphorothioate internucleotide linkage modifications at the 3'-terminal and or 5'-terminal positions of the sense or antisense strand. It is understood in the art that the 3'-end and / or 5'-end positions refer to the counting of the first nucleotide at the 3'-end or 5'-end of the sense strand or antisense strand of any length. For example, without limitation, the 5'-end of the antisense strand has two phosphorothioate internucleotide linkage modifications, which means that the first nucleotide and the second nucleotide, and the second nucleotide and the third nucleotide of the antisense strand paired from the 5'-end have phosphorothioate internucleotide linkage modifications, respectively.

[0286] In one embodiment, the dsRNA agent of the present invention includes the phosphorothioate internucleotide linkage modification in the overhang region. For example, the overhang region includes two nucleotides with a phosphorothioate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications can also be made so that the overhang nucleotide is linked to a terminal paired nucleotide in the duplex region. It should be understood in the art that unless otherwise specified, the overhang nucleotide is linked to the terminal N-terminal ... L or N L ' linkage. For example, at least 2, 3, 4 or all of the overhang nucleotides can be linked by phosphorothioate inter-nucleotide linkages, and optionally, there can be additional phosphorothioate inter-nucleotide linkages that link the overhang nucleotide to a paired nucleotide next to the overhang nucleotide. For example, there can be at least two phosphorothioate inter-nucleotide linkages between the terminal three nucleotides, two of which are overhang nucleotides and the third is a paired nucleotide next to the overhang nucleotide. Preferably, these three terminal nucleotides can be at the 3' end of the antisense strand. In one embodiment, the dsRNA agent of the present invention includes this phosphorothioate inter-nucleotide linkage modification in the sense strand overhang region.

[0287] In some embodiments, the sense strand and / or antisense strand of a dsRNA agent of the present invention has 1 or 2 reversed abasic residue nucleotides. In some embodiments, the sense strand and / or antisense strand of a dsRNA agent of the present invention comprises 1 or 2 reversed abasic residues at the 3' or / and 5' ends. In some embodiments, the sense strand of a dsRNA agent of the present invention comprises a reversed abasic residue at the 3'-end.

[0288] In some embodiments, SEQ ID NO: 1 is FXII mRNA [NCBI Reference Sequence: NM_021489.3; unmodified duplex AD00127.um sense strand: AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 2), antisense strand: UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 3), complementary Pos (20) in NM_021489.3 is at position 1938; unmodified duplex AD00549.um sense strand: GCCCAAGAAAGUGAAAGACCA (SEQ ID NO: 4), antisense strand: UGGUCUUUCACUUUCUUGGGC (SEQ ID NO: 5), complementary Pos (20) in NM_021489.3 is at position 307.

[0289] According to another aspect of the present invention, another RNAi agent for inhibiting target gene expression is provided, wherein the RNAi agent is a double-stranded ribonucleic acid (dsRNA) agent, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the sense strand having 18 to 40 nucleotides, and the sense strand comprising a 5′ to 3′ direction represented by formula (V): 5′-(N′ L ) n 'N' L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V)

[0290] Among them, each N′ Frepresents 2′-fluorine-modified nucleotides;

[0291] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 There are at least two 2′-fluoro modified nucleotides;

[0292] In formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and the total number of 2′-fluorine-modified nucleotides does not exceed six;

[0293] Each N′ L independently represent modified or unmodified nucleotides;

[0294] n' may be an integer from 0 to 7.

[0295] In some embodiments, RNAi agents for inhibiting target gene expression are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the sense strand having 18 to 40 nucleotides, the sense strand comprising a 5′ to 3′ direction represented by formula (V′): 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ formula (V′)

[0296] Among them, each N′ F represents 2′-fluorine-modified nucleotides;

[0297] N′N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 There are only two 2′-fluoro modified nucleotides;

[0298] Each N′ L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0299] n' may be an integer from 0 to 7.

[0300] In some non-limiting embodiments, the dsRNA agent has N′ in the sense strand of formula (V). N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and / or N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 are all 2'-fluoro modified nucleotides. It is understood by those skilled in the art that the nucleotides at positions 11, 14, and 15 of the sense strand (counting from the first paired nucleotide at the 3' end) of the dsRNA agent shown in formula (V) are 2'-fluoro modified nucleotides. It is understood that nucleotides containing 2'-fluoro modifications may also be present at other positions of the sense strand of the dsRNA agent, but the total number of nucleotides containing 2'-fluoro modifications does not exceed 6, and there is no motif of 3 or more consecutive 2'-fluoro modified nucleotides. In some non-limiting embodiments, the dsRNA agent has N' in the sense strand shown in formula (V') N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and / or N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 All are 2′-fluorinated nucleotides, N′ N3 , N′ N4 , N′ N5 and N′ N6None of them are 2′-fluorine-modified nucleotides. It will be understood by those skilled in the art that the nucleotides at positions 11, 14, and 15 of the positive strand (counting from the first paired nucleotide from the 3′ end) of the dsRNA agent shown in formula (V) are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides.

[0301] In some non-limiting embodiments, the dsRNA agent is in the sense strand of formula (V), N′ N3 , N′ N6 are all 2'-fluoro modified nucleotides. It can be understood by those skilled in the art that the nucleotides at positions 8, 11 and 13 of the sense strand (counting from the first paired nucleotide from the 3' end) of the dsRNA agent shown in formula (V) are 2'-fluoro modified nucleotides. There may also be 2'-fluoro modified nucleotides at other positions of the sense strand of the dsRNA agent, but the total number of 2'-fluoro modified nucleotides does not exceed 6, and there is no motif of 3 or more consecutive 2'-fluoro modified nucleotides. In some non-limiting embodiments, the dsRNA agent has N' in the sense strand shown in formula (V') N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and / or N′ N6 Each independently represents a modified or unmodified nucleotide, N' N3 , N′ N6 All are 2′-fluorinated nucleotides, N′ N1 , N′ N2 , N′ N4 and N′ N5 None of them are 2′-fluorine-modified nucleotides. It can be understood by those skilled in the art that the nucleotides at positions 8, 11 and 13 of the positive strand (counting from the first paired nucleotide from the 3′ end) of the dsRNA agent shown in formula (V) are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides.

[0302] In some non-limiting embodiments, the dsRNA agent has N′ in the sense strand of formula (V). N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and / or N′ N6 Each independently represents a modified or unmodified nucleotide, N' N3 , N′ N5are all 2'-fluoro modified nucleotides. It can be understood by those skilled in the art that the nucleotides at positions 9, 11 and 13 of the sense strand (counting from the first paired nucleotide from the 3' end) of the dsRNA agent shown in formula (V) are 2'-fluoro modified nucleotides. There may also be 2'-fluoro modified nucleotides at other positions of the sense strand of the dsRNA agent, but the total number of 2'-fluoro modified nucleotides does not exceed 6, and there is no motif of 3 or more consecutive 2'-fluoro modified nucleotides. In some non-limiting embodiments, the dsRNA agent has N' in the sense strand shown in formula (V') N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and / or N′ N6 Each independently represents a modified or unmodified nucleotide, N' N3 , N′ N5 All are 2′-fluorinated nucleotides, N′ N1 , N′ N2 , N′ N4 and N′ N6 None of them are 2′-fluorine-modified nucleotides. It can be understood by those skilled in the art that the nucleotides at positions 9, 11, and 13 of the positive strand (counting from the first paired nucleotide from the 3′ end) of the dsRNA agent shown in formula (V) are 2′-fluorine-modified nucleotides, while the nucleotides at other positions are not 2′-fluorine-modified nucleotides.

[0303] In some specific embodiments, the nucleotides at positions 9, 11, and 13 of the sense strand of Formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent are 2'-fluoro modified nucleotides. It is understood that the dsRNA agent may also contain 2'-fluoro modified nucleotides at other positions in the sense strand, but the total number does not exceed 6 nucleotides containing 2'-fluoro modified nucleotides, and there is no motif of 3 consecutive 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 9, 11, and 13 of the sense strand of Formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent are 2'-fluoro modified nucleotides. It is understood that the dsRNA agent does not contain 2'-fluoro modified nucleotides at other positions in the sense strand.

[0304] The motif of three consecutive 2′-fluorine-modified nucleotides can be understood as meaning that three consecutive nucleotides in one chain of the dsRNA agent are simultaneously 2′-fluorine-modified. For example, in the sequence XYYYX, Y is a 2′-fluorine-modified nucleotide, while X can be differently modified.

[0305] As used herein, the position of the dsRNA agent in formula (V) starting from the first paired nucleotide at the 3' end of the sense chain generally refers to the first paired nucleotide N' at the 3' end of the sense chain. L Counting starts from the paired blunt end, and a non-limiting example is shown in formula (Va), Np'-5'-(N' L ) n N L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L (First position)-3′ formula (Va); It is more understandable that the first mismatch in the dsRNA agent is also a pairing, also known as the first position.

[0306] In some embodiments, the nucleotides at positions 9, 11, and 13 of the sense strand of Formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) of the dsRNA agent are 2′-fluoro-modified nucleotides. In some embodiments, the nucleotides at positions 9, 11, and 12 of the sense strand of Formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) of the dsRNA agent are 2′-fluoro-modified nucleotides. In some embodiments, the nucleotides at positions 8, 11, and 13 of the sense strand of Formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) of the dsRNA agent are 2′-fluoro-modified nucleotides. In some embodiments, the nucleotides at positions 11, 12, and 14 of the sense strand of Formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) of the dsRNA agent are 2′-fluoro-modified nucleotides. In some specific embodiments, the nucleotides at positions 11, 12, and 15 of the sense strand of the dsRNA agent of formula (V′) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides. Those skilled in the art will appreciate that in these specific embodiments, the dsRNA agent has only three 2′-fluoro-modified nucleotides in the sense strand of formula (V′).

[0307] According to another aspect of the present invention, an RNAi agent for inhibiting target gene expression is provided, wherein the RNAi agent is a double-stranded ribonucleic acid (dsRNA) agent, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the sense strand having 18 to 40 nucleotides, the sense strand comprising a residue represented by formula (IX) listed in the 5′ to 3′ direction: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ N7 N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (IX)

[0308] Among them, each N′ F represents 2′-fluorine-modified nucleotides;

[0309] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and N′ N7 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and N′ N7 at least two 2′-fluoro-modified nucleotides;

[0310] In formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) does not contain more than six 2′-fluorine-modified nucleotides in total;

[0311] Each N′ L independently represent modified or unmodified nucleotides;

[0312] n' may be an integer from 0 to 7.

[0313] In some embodiments, the nucleotides at positions 7, 9, 11, and 13 of the sense strand of the dsRNA agent of Formula (IX) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. It will be understood by those skilled in the art that in these embodiments, the dsRNA agent has only four 2'-fluoro-modified nucleotides in the sense strand of Formula (IX).

[0314] In some embodiments, the N′ in the sense strand of the dsRNA agent represented by Formula (V) and / or Formula (IX) is L One or more of the nucleotides is a modified nucleotide independently selected from the group consisting of a 2'-fluoro modified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-deoxy nucleotide, a 2',3'-seco nucleotide mimetic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxy nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate group modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidate, or an unnatural base containing nucleotide. In some embodiments, the N' in the dsRNA agent is L The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, or Invab.

[0315] In some embodiments, the dsRNA agent is in the sense strand of Formula (V) and / or Formula (IX). In some non-limiting embodiments, the dsRNA agent is in the sense strand of Formula (V). N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and / or N′ N7Each independently represents a modified or unmodified nucleotide, and the modified nucleotide is independently selected from the following modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), open ring nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some embodiments, the dsRNA agent of the present invention has N' in the sense strand of formula (V') N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and / or N′ N6 When it is not a 2'-fluoro modified nucleotide, it is preferably a 2'-O-methyl modified nucleotide, UNA, GNA, or LNA.

[0316] In some non-limiting embodiments, the dsRNA agent has N′ in the sense strand of formula (V′). N3 , N′ N6 All are 2′-fluorinated nucleotides, N′ N1 , N′ N2 , N′ N4 and N′ N5 None of them are 2′-fluorinated nucleotides. N1 , N′ N2 , N′ N4 and N′ N5The modified nucleotides are independently selected from the group consisting of 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates, or non-natural bases containing nucleotides. In some preferred embodiments, the N' in the dsRNA agent is N1 , N′ N2 , N′ N4 and N′ N5 One or more of the modified or unmodified nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, N' in the dsRNA agent N1 , N′ N2 , N′ N4 and N′ N5 Represents a 2'-O-methyl modified nucleotide among modified or unmodified nucleotides.

[0317] In some non-limiting embodiments, the dsRNA agent has N′ in the sense strand of formula (V′). N3 , N′ N5 All are 2′-fluorinated nucleotides, N′ N1 , N′ N2 , N′ N4 and N′ N6 None of them are 2′-fluorinated nucleotides. N1 , N′ N2 , N′ N4 and N′ N6The modified nucleotides are independently selected from the group consisting of 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates, or non-natural bases containing nucleotides. In some preferred embodiments, the N' in the dsRNA agent is N1 , N′ N2 , N′ N4 and N′ N6 One or more of the modified or unmodified nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, GNA, LNA. In some preferred embodiments, N' in the dsRNA agent N1 , N′ N2 , N′ N4 and N′ N6 Represents a 2'-O-methyl modified nucleotide among modified or unmodified nucleotides.

[0318] In some embodiments, the dsRNA agent wherein the antisense strand that is complementary or substantially complementary to the sense strand of Formula (V) is entirely or substantially modified nucleotides. In some embodiments, the dsRNA agent wherein the antisense strand is entirely modified nucleotides. The nucleotides of the antisense strand are selected from the following modified nucleotides: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural base containing nucleotides.

[0319] In some embodiments, the dsRNA agents of the invention are those in which all or substantially all nucleotides of the sense and antisense strands are modified nucleotides.

[0320] In some embodiments, the nucleotides modified with phosphate groups in the sense strand of the dsRNA agent of the present invention as shown in formula (V) are nucleotides with phosphorothioate groups; in some embodiments, the nucleotides modified with phosphate groups in the sense strand of the dsRNA agent of the present invention as shown in formula (V) are nucleotides with 5'-phosphorothioate groups.

[0321] In some embodiments, the dsRNA agents of the invention include in the sense strand of formula (V) an E-vinylphosphonate nucleotide at the 5' end of the sense strand.

[0322] In some embodiments, the dsRNA reagent of the present invention has a complementary or substantially complementary antisense strand to the sense strand shown in formula (V), and the length of the complementary region is between 18 and 25 nucleotides. In some embodiments, the length of the complementary region is 18-23 nucleotides. In some embodiments, the length of the complementary region is 19-21 nucleotides. In other embodiments, for example, the length of the complementary region can be 18-25 nucleotides length, 19-25 nucleotides length, 19-23 nucleotides length, 19-21 nucleotides length. In another example, in some embodiments, the length of the complementary region is 18, 19, 20 or 21 nucleotides.

[0323] In some embodiments, n' in the dsRNA agent is 7, and it is understood that the sense strand complementary pairing is 25 nucleotides in length. In some specific embodiments, n' in the dsRNA agent is 0, 1, 2, 3, 4, 5, 6 or 7.

[0324] In some embodiments, the dsRNA agent has an antisense strand that is fully complementary to the sense strand of Formula (V).

[0325] In some embodiments, the dsRNA reagent of the present invention does not comprise mismatching. In certain embodiments, the target gene dsRNA reagent of the present invention comprises no more than 1 mismatching (such mismatching does not affect the counting starting position of pairing). In some embodiments, the dsRNA reagent of the present invention comprises no more than 2 mismatchings. In certain embodiments, the dsRNA reagent of the present invention comprises no more than 3 mismatchings. In some embodiments of the present invention, the antisense strand of the dsRNA reagent comprises a mismatch with a target sequence that is not located at the center of the complementary region. In some embodiments, the antisense strand of the dsRNA reagent comprises 1, 2, 3, 4 or more mismatchings, which are located within the last 5, 4, 3, 2 or 1 nucleotides of one or both of the 5' or 3' ends of the complementary region.

[0326] In some embodiments, the antisense strand of the dsRNA agent of the present invention is no more than 30 nucleotides in length. In some embodiments, the length of each strand of the dsRNA agent of the present invention is no more than 30 nucleotides. In some embodiments, the length of each strand of the dsRNA agent of the present invention is no more than 25 nucleotides. In some embodiments, the length of each strand of the dsRNA agent of the present invention is no more than 23 nucleotides. In some embodiments, the length of each strand of the dsRNA agent of the present invention is 19, 20, or 21 nucleotides.

[0327] In some embodiments, the dsRNA agent has a blunt end at the 5'-end of the sense strand. In one embodiment, the sense strand and the antisense strand of the dsRNA agent of the present invention each have two blunt ends at both ends. For example, each strand of the dsRNA agent is completely paired to form a blunt-end structure.

[0328] In some embodiments, the RNAi agent has an overhang of 1-5 unpaired nucleotides at the 5' end of the sense strand of formula (V), such as an overhang of 1, 2, 3, 4 or 5 unpaired nucleotides.

[0329] In some embodiments, the dsRNA agent has an antisense strand complementary or partially complementary to that of Formula (V) with 1-5 unpaired nucleotide overhangs at the 3′-terminus and / or 5′-terminus, such as overhangs of 1, 2, 3, 4, or 5 unpaired nucleotides. In some embodiments, the dsRNA agent has a blunt end at the 3′-terminus and / or 5′-terminus, such as an overhang of 1, 2, 3, 4, or 5 unpaired nucleotides.

[0330] In certain embodiments, the overhang of the unpaired nucleotide of the sense strand and / or antisense strand of dsRNA reagent of the present invention has 2-5 nucleotide length, 1-5 nucleotide length, 1-4 nucleotide length, 2-4 nucleotide length, 1-3 nucleotide length, 2-3 nucleotide length or 1-2 nucleotide length.These overhangs can be the result that a chain is longer than another chain, or the result that two chains with the same length are staggered.These overhangs can form a mispairing with this target mRNA, or it can be complementary to the gene sequence of targeting or can be other sequences.This first and this second chain can also be connected to form a hairpin or be connected by other non-base joints, for example, by other base.

[0331] In one embodiment, the nucleotides in the overhang region of the dsRNA agent of the invention can each independently be one or more modified or unmodified nucleotides, and the modified nucleotides include but are not limited to: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural base containing nucleotides.

[0332] In one embodiment, both ends of the overhang on the sense strand, the antisense strand, or both strands of the overhang region of the dsRNA agent of the invention may be phosphorylated.

[0333] In one embodiment, the overhang of a dsRNA agent of the present invention is present at the 5' or 3' end of the sense strand, the antisense strand, or both strands. In one embodiment, the overhang is present at the 3' end of the antisense strand. In one embodiment, the overhang is present at the 5' end of the sense strand.

[0334] In one embodiment, the dsRNA agent of the present invention may include only a single overhang, which can enhance the interference activity of the dsRNA without affecting its overall stability. For example, the single-stranded overhang is located at the 5' end of the sense strand, or alternatively, at the 3' end of the antisense strand, and the corresponding dsRNA may also have a blunt end located at the 5' end of the antisense strand (or the 3' end of the sense strand), or vice versa.

[0335] In one embodiment, the dsRNA agents of the invention are blunt ended at the 5'-end of the antisense strand or the 3'-end of the sense strand.

[0336] In some embodiments, the dsRNA agents of the invention comprise at least one phosphorothioate internucleoside linkage.

[0337] In some embodiments, the sense strand of a dsRNA agent of the invention comprises at least one phosphorothioate internucleoside linkage.

[0338] In some embodiments, the antisense strand of a dsRNA agent of the invention comprises at least one phosphorothioate internucleoside linkage.

[0339] In some embodiments, the sense and / or antisense strands of the dsRNA agents of the invention comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphorothioate internucleoside linkages.

[0340] In one embodiment, the sense strand of a dsRNA agent of the invention comprises 1-10 blocks having two to ten phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages, or an antisense strand comprising either phosphorothioate or phosphate linkages.

[0341] In one embodiment, the antisense strand of a dsRNA agent of the invention comprises 1-10 blocks having two to ten phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages, or a sense strand comprising either phosphorothioate or phosphate linkages.

[0342] In one embodiment, the dsRNA agent of the invention further comprises one or more phosphorothioate internucleotide linkage modifications in 1-10 duplex internal regions of each of the sense strand and / or antisense strand. For example, at positions 8-16 of the duplex region, counted from the 3' end of the sense strand, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides may be linked via phosphorothioate internucleotide linkages; the dsRNA may optionally further comprise one or more phosphorothioate internucleotide linkage modifications in 1-10 terminal positions.

[0343] In one embodiment, the dsRNA agent of the invention further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modifications in positions 1-5 of the sense strand, and further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modifications in positions 18-23 (as used herein counting from the blunt 3' end of the sense strand), and further comprises one to two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and further comprises one to five in positions 18-23 (as used herein counting from the blunt 5' end of the antisense strand). In one embodiment, the dsRNA agent of the invention contains 1 or 2 phosphorothioate internucleotide linkage modifications at the 3'-terminal and / or 5'-terminal positions of the sense or antisense strand.

[0344] In one embodiment, the dsRNA agent of the present invention includes the phosphorothioate internucleotide linkage modification in the overhang region. It should be understood in the art that, unless otherwise specified, the dsRNA agent of the present invention in the overhang region refers to an unpaired nucleotide motif in this application. For example, the overhang region includes two nucleotides with a phosphorothioate internucleotide linkage between the two nucleotides. Internucleotide linkage modification can also be made so that the overhang nucleotide is linked to a terminal paired nucleotide in the duplex region. It should be understood in the art that, unless otherwise specified, the overhang nucleotide is linked to a terminal paired nucleotide in the duplex region, which refers to the N-terminal ... L or N L ' linkage. For example, at least 2, 3, 4 or all of the overhang nucleotides can be linked by phosphorothioate inter-nucleotide linkages, and optionally, there can be additional phosphorothioate inter-nucleotide linkages that link the overhang nucleotide to a paired nucleotide next to the overhang nucleotide. For example, there can be at least two phosphorothioate inter-nucleotide linkages between the terminal three nucleotides, two of which are overhang nucleotides and the third is a paired nucleotide next to the overhang nucleotide. Preferably, these three terminal nucleotides can be at the 3' end of the antisense strand. In one embodiment, the dsRNA agent of the present invention includes this phosphorothioate inter-nucleotide linkage modification in the sense strand overhang region.

[0345] In some embodiments, the sense strand and / or antisense strand of a dsRNA agent of the present invention has 1 or 2 reversed abasic residue nucleotides. In some embodiments, the sense strand and / or antisense strand of a dsRNA agent of the present invention comprises 1 or 2 reversed abasic residues at the 3' or / and 5'-end. In some embodiments, the sense strand of a dsRNA agent of the present invention comprises a reversed abasic residue at the 3'-end.

[0346] In some embodiments, the dsRNA agent of the present invention further comprises one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups of the dsRNA agent of the present invention are the same or different. The targeting group or linking group can be attached to the sense strand, antisense strand or both strands at the 3' end, the 5' end or both ends. In some embodiments, the RNAi agent wherein the one or more targeting groups or linking groups are conjugated to the sense strand. The targeting ligand can change the distribution, targeting or lifespan of the RNAi agent into which it is incorporated, endosomal solubility properties, improved transport, hybridization and specificity properties, such as, but not limited to, lectins, glycoproteins, lipids or proteins, thyroid stimulating hormone, melanocyte stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent trehalose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, an RGD peptide mimetic or an aptamer, other examples include dyes, intercalating agents (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or a chelating agent (e.g., EDTA), lipophilic molecules, such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, camphenol, menthol, 1,3-propylene glycol, heptadecanol, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphates, amino groups, sulfhydryl groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino groups, alkyl groups, substituted alkyl groups, radiolabeled markers, enzymes, haptens (e.g., biotin), delivery / adsorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl groups, HRP, or AP. In some embodiments, the targeting group or linking group comprises a group selected from: N-acetyl-galactosamine (GalNAc) and a lipophilic molecule. The lipophilic molecule can be used for delivery in the neural field. In some embodiments, the targeting group or linking group is conjugated to the 5′-end of the sense strand.

[0347] Another non-limiting example of a delivery agent that can be used in embodiments of the present invention to deliver the dsRNA agent of the present invention to cells, tissues and / or objects is: a reagent comprising GalNAc, which is connected to the dsRNA agent of the present invention and delivers the dsRNA agent to cells, tissues and / or objects. PCT application WO2020191183A1 discloses examples of other delivery agents that can be used in certain embodiments of the methods and compositions of the present invention. A non-limiting example of a GalNAc targeting ligand that can be used in the compositions and methods of the present invention to deliver the dsRNA agent to cells is a targeting ligand cluster. Examples of the targeting ligand clusters proposed here are: a GalNAc ligand (GLO) with a phosphodiester bond and a GalNAc ligand (GLS) with a phosphorothioate bond. The term "GLX-n" may be used herein to refer to an attached GalNAC-containing compound, for example but not limited to, the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, the structure of each of which is shown below. It will be understood that any RNAi and dsRNA molecules of the present invention can be linked to GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. In some preferred embodiments, the targeting group is GLS-5 or GLS-15 as described herein.

[0348] In some embodiments, the targeting group has the following structure:

[0349] n" are each independently selected from integers 1 or 2.

[0350] In some embodiments, the dsRNA comprises an inverted abasic residue at the 3'-terminus of the sense strand of formula (V'). In some embodiments, the dsRNA comprises one or two inverted abasic residues at the 3' or / and 5'-terminus of the sense strand of formula (V').

[0351]

[0352]

[0353]

[0354]

[0355] In some embodiments, SEQ ID NO: 1 is FXII mRNA [NCBI Reference Sequence: NM_021489.3; for example, AD00540, AD00548, etc. are specific modified nucleotide sequences of the unmodified duplex AD00127.um sense strand: AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 2), antisense strand: UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 3), wherein the complementary Pos (20) in NM_021489.3 is at position 1938; for example, AD00549, AD00558, etc. are specific modified nucleotide sequences of the unmodified duplex AD00549.um sense strand (SEQ ID NO: 4): GCCCAAGAAAGUGAAAGACCA, antisense strand: UGGUCUUUCACUUUCUUGGGC (SEQ ID The specific modified nucleotide sequence of NO:5) is complementary to Pos(20) at position 307 in NM_021489.3.

[0356] In another aspect of the present invention, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein these RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the sense strand having 18 to 40 nucleotides, the dsRNA agent comprising an antisense strand having a nucleotide sequence represented by formula (X) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0357] The antisense strand comprises the compound represented by formula (X) listed in the 3′ to 5′ direction: 3′-(N X ) n N X N X N X N XN F N X N X N X N X N X N X N X N X N X N X N X N F N X -5′ formula (X)

[0358] The sense strand comprises the residue represented by formula (V) listed in the 5' to 3' direction: 5'-(N' L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V)

[0359] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0360] Each N X Each independently represents a modified or unmodified nucleotide, N X No more than three 2′-fluoro-modified nucleotides;

[0361] Each N′ F represents 2′-fluorine-modified nucleotides;

[0362] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′N6 at least two 2′-fluoro-modified nucleotides;

[0363] In the sense strand of formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) contains no more than six 2′-fluorine-modified nucleotides in total;

[0364] Each N′ L independently represent modified or unmodified nucleotides;

[0365] Each of n and n' independently can be an integer from 0 to 7.

[0366] In some embodiments, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, the sense strand having 18 to 40 nucleotides, the dsRNA agent comprising an antisense strand having a nucleotide sequence represented by formula (I) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0367] The antisense strand comprises the compound represented by formula (I) listed in the 3′ to 5′ direction: 3′-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5′ Formula (I)

[0368] The sense strand comprises the residue represented by formula (V) listed in the 5' to 3' direction: 5'-(N' L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V)

[0369] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0370] Each N X Each independently represents a modified or unmodified nucleotide, N X There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide;

[0371] Each N′ F represents 2′-fluorine-modified nucleotides;

[0372] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 at least two 2′-fluoro-modified nucleotides;

[0373] In the sense strand of formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) contains no more than six 2′-fluorine-modified nucleotides in total;

[0374] Each N′ L independently represent modified or unmodified nucleotides;

[0375] Each of n and n' independently can be an integer from 0 to 7.

[0376] It is understood that the dsRNA agent includes a combination of an antisense strand having any of the modifications described herein by formula (I) and a sense strand having any of the modifications described herein by formula (V).

[0377] In some embodiments, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agents comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA of the target gene, the antisense strand having 18 to 30 nucleotides, the sense strand having 18 to 40 nucleotides, the dsRNA agents comprising an antisense strand having a nucleotide sequence represented by formula (I-1) herein and a sense strand having a nucleotide sequence represented by formula (V) herein,

[0378] The antisense strand comprises the following represented by formula (I-1) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (I-1)

[0379] The sense strand comprises the residue represented by formula (V) listed in the 5' to 3' direction: 5'-(N' L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V)

[0380] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0381] N M1 、NM2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide;

[0382] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0383] Each N′ F represents 2′-fluorine-modified nucleotides;

[0384] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 at least two 2′-fluoro-modified nucleotides;

[0385] In the sense strand of formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) contains no more than six 2′-fluorine-modified nucleotides in total;

[0386] Each N′ L independently represent modified or unmodified nucleotides;

[0387] Each of n and n' independently can be an integer from 0 to 7.

[0388] In some embodiments, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, the sense strand having 18 to 40 nucleotides, the dsRNA agent comprising an antisense strand having a nucleotide sequence represented by formula (I-1) herein and a sense strand having a nucleotide sequence represented by formula (V') herein,

[0389] The antisense strand comprises the following represented by formula (I-1) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (I-1)

[0390] The sense strand comprises the compound represented by formula (V') listed in the 5' to 3' direction: 5'-(N' L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ formula (V')

[0391] Among them, each N F represents 2′-fluorine-modified nucleotides;

[0392] N M1 、NM2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide;

[0393] Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0394] Each N′ F represents 2′-fluorine-modified nucleotides;

[0395] N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 There are only two 2′-fluoro modified nucleotides;

[0396] Each N′ L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide;

[0397] Each of n and n' independently can be an integer from 0 to 7.

[0398] In some embodiments, the dsRNA agent comprises an antisense strand having a nucleotide sequence represented herein by Formula (II) and a sense strand having a nucleotide sequence represented herein by Formula (V).

[0399] In some embodiments, the dsRNA agent comprises an antisense strand having a nucleotide sequence represented herein by Formula (III) and a sense strand having a nucleotide sequence represented herein by Formula (V).

[0400] In some embodiments, the dsRNA agent comprises an antisense strand having a nucleotide sequence represented herein by Formula (IV) and a sense strand having a nucleotide sequence represented herein by Formula (V).

[0401] In some embodiments, the dsRNA agent comprises an antisense strand having a nucleotide sequence represented herein by Formula (II) and a sense strand having a nucleotide sequence represented herein by Formula (V').

[0402] In some embodiments, the dsRNA agent comprises an antisense strand having a nucleotide sequence represented herein by formula (III) and a sense strand having a nucleotide sequence represented herein by formula (V').

[0403] In some embodiments, the dsRNA agent comprises an antisense strand having a nucleotide sequence represented herein by Formula (IV) and a sense strand having a nucleotide sequence represented herein by Formula (V').

[0404] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluorine-modified nucleotides; the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA agent represented by formula (V) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluorine-modified nucleotides, and there is no motif of three or more consecutive 2′-fluorine-modified nucleotides in the sense strand, and the total number of 2′-fluorine-modified nucleotides does not exceed six. In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14 and 16 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent shown in formula (I-1) are 2′-fluorine-modified nucleotides; and the nucleotides at positions 9, 11 and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) shown in formula (V′) are 2′-fluorine-modified nucleotides. It will be understood that other positions of the sense strand shown in formula (V′) do not contain 2′-fluorine-modified nucleotides.

[0405] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluorine-modified nucleotides; the nucleotides at positions 9, 11, and 12 of the sense strand of the dsRNA agent represented by formula (V) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluorine-modified nucleotides, and there is no motif of three or more consecutive 2′-fluorine-modified nucleotides in the sense strand, and the total number of 2′-fluorine-modified nucleotides does not exceed six. In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14 and 16 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent shown in formula (I-1) are 2′-fluorine-modified nucleotides; and the nucleotides at positions 9, 11 and 12 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) shown in formula (V′) are 2′-fluorine-modified nucleotides. It will be understood that other positions of the sense strand shown in formula (V′) do not contain 2′-fluorine-modified nucleotides.

[0406] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; the nucleotides at positions 8, 11, and 13 of the sense strand represented by formula (V) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides, and there is no motif of three or more consecutive 2′-fluoro-modified nucleotides in the sense strand, and the total number of 2′-fluoro-modified nucleotides does not exceed six. In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14 and 16 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent shown in formula (I-1) are 2′-fluorine-modified nucleotides; and the nucleotides at positions 8, 11 and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) shown in formula (V′) are 2′-fluorine-modified nucleotides. It will be understood that other positions of the sense strand shown in formula (V′) do not contain 2′-fluorine-modified nucleotides.

[0407] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 11, 12, and 14 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0408] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 11, 12, and 15 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0409] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand represented by formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand represented by formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0410] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA agent represented by formula (V) (counting from the first paired nucleotide from the 3' end) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA agent represented by formula (V') (counting from the first paired nucleotide from the 3' end) are 2'-fluoro-modified nucleotides.

[0411] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0412] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA agent represented by formula (I-1) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA agent represented by formula (V) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0413] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14 and 18 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 8, 11 and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V′) are 2′-fluoro-modified nucleotides.

[0414] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 11, 12, and 14 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0415] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 11, 12, and 15 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0416] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0417] In some more specific embodiments, the nucleotides at positions 2, 4, 10, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0418] In some more specific embodiments, the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0419] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (I-1) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0420] In some embodiments, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, the sense strand having 18 to 40 nucleotides, the dsRNA agent comprising an antisense strand having a nucleotide sequence represented by formula (I-2) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0421] In some embodiments, RNAi agents for inhibiting the expression of target gene sequences are provided, wherein the RNAi agents are double-stranded ribonucleic acid (dsRNA) agents, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of the mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, the sense strand having 18 to 40 nucleotides, the dsRNA agent comprising an antisense strand having a nucleotide sequence represented by formula (I′) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0422] In some more specific embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (IV) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0423] In some more specific embodiments, the nucleotides at positions 2, 8, and 14 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (IV) are 2′-fluorinated nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluorinated nucleotides.

[0424] In some more specific embodiments, the nucleotides at positions 2, 7, and 14 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (IV) are 2′-fluorinated nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluorinated nucleotides.

[0425] In some more specific embodiments, the nucleotides at positions 2, 12, and 14 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (IV) are 2′-fluorinated nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluorinated nucleotides.

[0426] In some more specific embodiments, the nucleotides at positions 2, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (IV) are 2′-fluorinated nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluorinated nucleotides.

[0427] In some more specific embodiments, the nucleotides at positions 2, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent represented by formula (IV) are 2′-fluorinated nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluorinated nucleotides.

[0428] In some more specific embodiments, the nucleotides at positions 2, 6, and 14 of the antisense strand (counting from the first paired nucleotide from the 5′ end) of the dsRNA agent are 2′-fluoro-modified nucleotides; and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) represented by formula (V) are 2′-fluoro-modified nucleotides.

[0429] In some more specific embodiments, the nucleotides at positions 2, 7, 11, 14, and 16 of the antisense strand of the dsRNA agent of formula (I-2) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0430] In some more specific embodiments, the nucleotides at positions 2, 7, 11, 14, and 18 of the antisense strand of the dsRNA agent of formula (I-2) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0431] In some more specific embodiments, the nucleotides at positions 2, 9, 12, 14, and 16 of the antisense strand of the dsRNA agent of formula (I-2) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0432] In some more specific embodiments, the nucleotides at positions 2, 8, 12, 14, and 16 of the antisense strand of the dsRNA agent of formula (I-2) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0433] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA agent of formula (I-2) (counting from the first paired nucleotide from the 5′ end) are 2′-fluoro-modified nucleotides; and the nucleotides at positions 9, 11, and 12 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3′ end of the sense strand) are 2′-fluoro-modified nucleotides.

[0434] In some embodiments, the dsRNA agent comprises an antisense strand of a nucleotide sequence represented by formula (X) herein and a sense strand of a nucleotide sequence represented by formula (V) herein, in combination with any of the technical solutions, including but not limited to other methods for modifying dsRNA described herein.

[0435] It is understood that the dsRNA agents herein include any combination of an antisense strand having a nucleotide sequence as described herein and a sense strand having a nucleotide sequence as described herein, including but not limited to other dsRNA modification methods described herein. For example, including but not limited to: Formula (X) combined with Formula (V), Formula (V'), and Formula (IX); Formula (IX) combined with Formula (X), Formula (I), Formula (I'), Formula (I-1), Formula (I-2), Formula (II), Formula (III), and Formula (IV).

[0436] In some embodiments, the dsRNA agent comprises an antisense strand of a nucleotide sequence represented by formula (I) herein and a sense strand of a nucleotide sequence represented by formula (V) herein, in combination with any of the technical solutions, including but not limited to other methods for modifying dsRNA described herein.

[0437] In some embodiments, the antisense strand of the dsRNA agent is N of Formula (I-1), Formula (I'), Formula (I-2), Formula (II), Formula (III) and / or Formula (IV). L One or more of the nucleotides is a modified nucleotide independently selected from the group consisting of a 2'-O-methyl modified nucleotide, a 2'-deoxy nucleotide, a 2',3'-seco nucleotide mimetic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxy nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate group modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidate, or an unnatural base containing nucleotide. In some embodiments, the N' in the dsRNA agent is L The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, or Invab.

[0438] In some embodiments, the N′ of Formula (V) and / or Formula (IX) in the sense strand of the dsRNA agent is L One or more of the nucleotides is a modified nucleotide independently selected from the group consisting of a 2'-fluoro modified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-deoxy nucleotide, a 2',3'-seco nucleotide mimetic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxy nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate group modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidate, or an unnatural base containing nucleotide. In some embodiments, the N' in the dsRNA agent is L The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, or Invab.

[0439] In some embodiments, the antisense strand of the dsRNA agent is N X One or more of the nucleotides is a modified nucleotide independently selected from the group consisting of a 2'-fluoro modified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-deoxy nucleotide, a 2',3'-seco nucleotide mimetic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxy nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate group modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidate, or an unnatural base containing nucleotide. In some embodiments, the N' in the dsRNA agent is LThe nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, or Invab.

[0440] In some embodiments, the dsRNA agent has N′ in the sense strand. In some non-limiting embodiments, the dsRNA agent has N′ in the sense strand. N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and / or N′ N6 , and N in the antisense strand M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 The modified nucleotides independently selected from the following independently represent modified or unmodified nucleotides, and the modified nucleotides are independently selected from the following modified nucleotides, 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), open ring nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides. In some embodiments, the dsRNA agent of the present invention has N' in the sense strand of formula (V) N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and / or N′ N6 , and N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and / or N M8 When it is not a 2'-fluoro modified nucleotide, it is preferably a 2'-O-methyl modified nucleotide, UNA, GNA, or LNA.

[0441] In some embodiments, the antisense strand of formula (I) in the dsRNA agent is complementary or substantially complementary to the sense strand of formula (V). In some embodiments, the sense strand or antisense strand in the dsRNA agent is entirely modified nucleotides.

[0442] In some embodiments, the nucleotides modified with phosphate groups in the antisense strand of formula (I) and the sense strand of formula (V) of the dsRNA agent of the present invention are nucleotides with phosphorothioate groups.

[0443] In some embodiments, the dsRNA agents of the invention have an E-vinylphosphonate nucleotide at the 5' end of the antisense strand.

[0444] In some embodiments, the sense strand of a dsRNA agent of the present invention is complementary or substantially complementary to the antisense strand. In some embodiments, the length of the complementary or substantially complementary region of a dsRNA agent of the present invention is between 18 and 25 nucleotides. In some embodiments, the length of the complementary region is 18-23 nucleotides. In some embodiments, the length of the complementary region is 19-21 nucleotides. In other embodiments, for example, the length of the complementary region can be 18-25 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, or 19-21 nucleotides in length. In another example, in some embodiments, the length of the complementary region is 18, 19, 20, or 21 nucleotides.

[0445] In some embodiments, the dsRNA agent has an antisense strand that is fully complementary to the sense strand.

[0446] In some embodiments, the dsRNA reagent of the present invention does not comprise mismatching. In certain embodiments, the target gene dsRNA reagent of the present invention comprises no more than 1 mismatching (such mismatching does not affect the counting starting position of pairing). In some embodiments, the dsRNA reagent of the present invention comprises no more than 2 mismatchings. In certain embodiments, the dsRNA reagent of the present invention comprises no more than 3 mismatchings. In some embodiments of the present invention, the antisense strand of the dsRNA reagent comprises a mismatch with a target sequence that is not located at the center of the complementary region. In some embodiments, the antisense strand of the dsRNA reagent comprises 1, 2, 3, 4 or more mismatchings, which are located within the last 5, 4, 3, 2 or 1 nucleotides of one or both of the 5' or 3' ends of the complementary region.

[0447] In some embodiments, the length of each strand of the dsRNA agent of the present invention does not exceed 30 nucleotides. In some embodiments, the length of each strand of the dsRNA agent of the present invention does not exceed 25 nucleotides. In some embodiments, the length of each strand of the dsRNA agent of the present invention does not exceed 23 nucleotides. In some embodiments, the length of each strand of the dsRNA agent of the present invention is 19, 20, or 21 nucleotides.

[0448] In some embodiments, the dsRNA agent has a blunt end at the 5'-end of the sense strand. In one embodiment, both the sense strand and the antisense strand of the dsRNA agent of the present invention have two blunt ends at both ends. For example, each strand of the dsRNA agent is fully paired to form a blunt-end structure.

[0449] In some embodiments, the RNAi agent has an overhang of 1-5 unpaired nucleotides at the 5' end of the sense strand of formula (V), such as an overhang of 1, 2, 3, 4 or 5 unpaired nucleotides.

[0450] In some embodiments, the dsRNA agent has an antisense strand complementary or partially complementary to that of Formula (V) with 1-5 unpaired nucleotide overhangs at the 3'-end and / or 5'-end, such as overhangs of 1, 2, 3, 4, or 5 unpaired nucleotides. In some embodiments, the dsRNA agent has a blunt end at the 3'-end and / or 5'-end, which is complementary or partially complementary to the antisense strand of Formula (V).

[0451] In certain embodiments, the overhang of the unpaired nucleotide of the sense strand and / or antisense strand of dsRNA reagent of the present invention has 2-5 nucleotide length, 1-5 nucleotide length, 1-4 nucleotide length, 2-4 nucleotide length, 1-3 nucleotide length, 2-3 nucleotide length or 1-2 nucleotide length.These overhangs can be the result that a chain is longer than another chain, or the result that two chains with the same length are staggered.These overhangs can form a mispairing with this target mRNA, or it can be complementary to the gene sequence of targeting or can be other sequences.This first and this second chain can also be connected to form a hairpin or be connected by other non-base joints, for example, by other base.

[0452] In one embodiment, the nucleotides in the overhang region of the dsRNA agent of the invention can each independently be one or more modified or unmodified nucleotides, and the modified nucleotides include but are not limited to: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural base containing nucleotides.

[0453] In one embodiment, both ends of the overhang on the sense strand, the antisense strand, or both strands of the overhang region of the dsRNA agent of the invention may be phosphorylated.

[0454] In one embodiment, the overhang of a dsRNA agent of the present invention is present at the 5' or 3' end of the sense strand, the antisense strand, or both strands. In one embodiment, the overhang is present at the 3' end of the antisense strand. In one embodiment, the overhang is present at the 5' end of the sense strand.

[0455] In one embodiment, the dsRNA agents of the invention are blunt ended at the 5' end of the antisense strand or the 3' end of the sense strand.

[0456] In some embodiments, the dsRNA agents of the invention comprise at least one phosphorothioate internucleoside linkage.

[0457] In some embodiments, the sense strand of a dsRNA agent of the invention comprises at least one phosphorothioate internucleoside linkage.

[0458] In some embodiments, the antisense strand of a dsRNA agent of the invention comprises at least one phosphorothioate internucleoside linkage.

[0459] In some embodiments, the sense and / or antisense strands of the dsRNA agents of the invention comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphorothioate internucleoside linkages.

[0460] In one embodiment, the sense or antisense strand of a dsRNA agent of the invention comprises 1-10 blocks having two to ten phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages, or an antisense strand comprising phosphorothioate or phosphate linkages.

[0461] In one embodiment, the dsRNA agent of the invention further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modifications in positions 1-5 of the sense strand, and further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modifications in positions 18-23 (as used herein counting from the blunt 3' end of the sense strand), and further comprises one to two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and further comprises one to five in positions 18-23 (as used herein counting from the blunt 5' end of the antisense strand). In one embodiment, the dsRNA agent of the invention contains 1 or 2 phosphorothioate internucleotide linkage modifications at the 3'-terminal and / or 5'-terminal positions of the sense or antisense strand.

[0462] In one embodiment, the dsRNA agents of the invention include this phosphorothioate inter-linkage modification in the overhang region.

[0463] In some embodiments, the sense strand and / or antisense strand of a dsRNA agent of the present invention has 1 or 2 reversed abasic residue nucleotides. In some embodiments, the sense strand and / or antisense strand of a dsRNA agent of the present invention comprises 1 or 2 reversed abasic residues at the 3' or / and 5' ends. In some embodiments, the sense strand of a dsRNA agent of the present invention comprises a reversed abasic residue at the 3'-end.

[0464] In certain embodiments, the dsRNA reagent of the present invention further comprises one or more targeting groups or linking groups. In certain embodiments, the RNAi reagent wherein said one or more targeting groups or linking groups are put together with said sense strand. In certain embodiments, said targeting group or linking groups include N-acetyl-galactosamine (GalNAc). In certain embodiments, said targeting group or linking groups are put together with said sense strand 5'-end.

[0465] Another non-limiting example of a delivery agent that can be used in embodiments of the present invention to deliver the dsRNA agents of the present invention to cells, tissues, and / or subjects is a GalNAc-containing agent that is linked to the dsRNA agents of the present invention and delivers the dsRNA agents to cells, tissues, and / or subjects. Examples of targeting ligand clusters proposed herein include GalNAc ligands with phosphodiester bonds (GLO) and GalNAc ligands with phosphorothioate bonds (GLS). The term "GLX-n" may be used herein to refer to an attached GalNAC-containing compound, for example but not limited to, the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, the structure of each of which is shown herein. It will be understood that any RNAi and dsRNA molecules of the present invention can be linked to GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. In some preferred embodiments, the targeting group is GLS-5 or GLS-15 as described herein.

[0466] In some embodiments, the sense and antisense strands of the dsRNA agents of the invention are partially or fully complementary.

[0467] Another aspect of the present invention provides a composition comprising any embodiment of the above-mentioned dsRNA agent of the present invention.

[0468] carrier

[0469] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of a dsRNA agent or antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. The term explicitly excludes cell culture media. For orally administered drugs, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients, such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid, or talc. If desired, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. The agents included in the pharmaceutical formulations are further described below.

[0470] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, while other carriers are known to those skilled in the art. Such preparations may typically contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the present invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, and the like. In addition, pharmaceutically acceptable salts can be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.

[0471] Therapeutic formulations of dsRNA agents or target gene antisense polynucleotide agents can be prepared for storage by mixing the molecule or compound having the desired purity with optional pharmaceutically acceptable carriers, excipients or stabilizers [Remington's Pharmaceutical Sciences 21st edition, (2006)] in the form of a lyophilized formulation or an aqueous solution. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphates, citrates, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., zinc-protein complexes); and / or nonionic surfactants, such as or polyethylene glycol (PEG).

[0472] Dosage

[0473] In some embodiments, the tissue to which the compound is administered is a tissue in which a target gene-related disease or condition is present or may occur, a non-limiting example of which is the liver or kidney. Direct tissue administration can be achieved by direct injection or other means. Many compounds delivered orally naturally enter and pass through the liver and kidney, and some embodiments of the therapeutic methods of the present invention include oral administration of one or more target gene dsRNA reagents to the subject. dsRNA reagents or target gene antisense polynucleotide agents, alone or in combination with other therapeutic agents, can be administered once, or they can be administered multiple times. If administered multiple times, target gene dsRNA reagents or target gene antisense polynucleotide agents can be administered by different routes. For example, although not intended to limit, the first (or first several) administration can be performed subcutaneously, and one or more additional administrations can be oral and / or systemic administration.

[0474] For embodiments of the present invention in which systemic administration of a target gene dsRNA agent or a target gene antisense polynucleotide agent is desired, the target gene dsRNA agent or the target gene antisense polynucleotide agent can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Injectable formulations can be in unit dosage form, such as ampoules or multi-dose containers, with or without preservatives. Target gene dsRNA agent formulations (also referred to as pharmaceutical compositions) can be in the form of suspensions, solutions, or emulsions in oily or aqueous carriers, and can contain preparatants, such as suspending agents, stabilizers, and / or dispersants.

[0475] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose solution, glucose and sodium chloride solution, lactated Ringer's solution or fixed oils. Intravenous excipients include fluid and nutritional supplements, electrolyte supplements (such as those based on Ringer's dextrose solution), etc. Preservatives and other additives, such as antimicrobials, antioxidants, chelating agents and inert gases, etc., may also be present. Other forms of administration, such as intravenous administration, will result in lower dosages. If the subject's response under the initial dose is insufficient, a higher dosage (or effectively increasing the dosage by different, more localized delivery routes) can be adopted within the scope allowed by patient tolerance. Multiple doses per day can be used as needed to achieve appropriate systemic or local levels of one or more target gene dsRNA agents or target gene antisense polynucleotide agents and to achieve appropriate reduction in target gene activity.

[0476] In other embodiments, the methods of the present invention include the use of a delivery vehicle, such as a biocompatible microparticle, nanoparticle, or implant suitable for implantation into a recipient, such as a subject. Exemplary biodegradable implants that can be used according to this method are described in PCT Publication WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix for containing biomacromolecules.

[0477] Both non-biodegradable and biodegradable polymer matrices can be used in the methods of the present invention to deliver one or more target gene dsRNA agents or target gene antisense polynucleotide agents to a subject. In some embodiments, the matrix can be biodegradable. The matrix polymer can be a natural or synthetic polymer. The polymer can be selected based on the time period of the desired release, typically on the order of a few hours to a year or longer. Typically, release over a period of time between a few hours and three to twelve months can be used. The polymer is optionally in the form of a hydrogel that can absorb up to about 90% of its weight in water and is optionally cross-linked with multivalent ions or other polymers.

[0478] Typically, target gene dsRNA reagent or target gene antisense polynucleotide reagent can be delivered by diffusion or by degradation of a polymer matrix using a biodegradable implant in some embodiments of the present invention. Exemplary synthetic polymers for such purposes are well known in the art. Using methods known in the art, biodegradable polymers and non-biodegradable polymers can be used for delivering target gene dsRNA reagent or target gene antisense polynucleotide reagent. Bioadhesive polymers such as bioerodible hydrogels (HS Sawhney, CP Pathak and JA Hubell in Macromolecules, 1993, 26, 581-587) can also be used for delivering target gene sRNA reagent or target gene antisense polynucleotide reagent to treat target gene related diseases or illness. Other suitable delivery systems can include timed release, delayed release or sustained release delivery systems. Such systems can avoid repeated administration of target gene dsRNA reagent or target gene antisense polynucleotide agent, thereby improving the convenience of object and healthcare professionals. Many types of release delivery systems are available and known to those of ordinary skill in the art. See, for example, U.S. Patent Nos. 5,075,109, 4,452,775, 4,675,189, 5,736,152, 3,854,480, 5,133,974, and 5,407,686. Additionally, pump-based hardware delivery systems may be used, some of which are also suitable for implantation.

[0479] The use of long-term sustained release implants can be applicable to the preventative treatment of objects and objects with the risk of recurrent target gene) related diseases or conditions. As used herein, long-term release refers to that implants are constructed and arranged to deliver target gene dsRNA reagents or target gene antisense polynucleotide reagents at least up to 10 days, 20 days, 30 days, 60 days, 90 days, six months, one year or longer treatment levels. Long-term sustained release implants are well known to those of ordinary skill in the art and include some of the above-mentioned release systems.

[0480] effective dose

[0481] In some aspects, the methods of the present invention include contacting cells with an effective amount of a dsRNA agent or an antisense polynucleotide agent to reduce gene expression in the contacted cells. Certain embodiments of the methods of the present invention include administering a dsRNA agent or an antisense polynucleotide agent to a subject in an amount that effectively reduces gene expression and treats the relevant disease or condition of the subject. In terms of reduced expression and / or for treating relevant diseases or conditions, the "effective amount" used is the amount necessary or sufficient to achieve the desired biological effect. For example, the effective amount of a dsRNA agent or an antisense polynucleotide agent for treating a relevant disease or condition can be: (i) the amount required to slow down or stop the progression of the disease or condition; (ii) reversing, reducing or eliminating one or more symptoms of the disease or condition. In some aspects of the present invention, an effective amount is the amount of a dsRNA agent or an antisense polynucleotide agent that results in a therapeutic response to the prevention and / or treatment of the disease or condition when applied to a subject in need of treating a relevant disease or condition. According to some aspects of the invention, an effective amount is the amount of a dsRNA agent or antisense polynucleotide agent of the invention that, when combined or co-administered with another therapeutic treatment for a related disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. In some embodiments of the invention, the biological effect of treating a subject with a dsRNA agent or antisense polynucleotide agent of the invention can be an improvement and / or complete elimination of symptoms caused by the related disease or condition. In some embodiments of the invention, the biological effect is the complete elimination of the related disease or condition, as demonstrated, for example, by a diagnostic test indicating that the subject does not have the related disease or condition. In some embodiments, an effective amount is an amount that results in a desired response, such as a reduction in the amount of the related disease or condition in cells, tissues, and / or subjects with the disease or condition. Some embodiments of the invention include methods for determining the efficacy of a target gene dsRNA agent or target gene antisense polynucleotide agent of the invention administered to a subject to treat a target gene-related disease or condition by evaluating and / or monitoring one or more "physiological characteristics" of the target gene-related disease or condition in the subject. Non-limiting examples of physiological characteristics of target gene-related diseases or conditions are that many patients have

[0482] It should be appreciated that gene silencing can be performed constitutively or by genomic engineering in any cell expressing and determined by any suitable assay. In some embodiments of the invention, target gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% by administering a dsRNA agent of the invention. In some embodiments of the invention, target gene expression is reduced by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100% or 50% to 100% by administering a dsRNA agent of the invention.

[0483] In the present invention, dsRNA agents and antisense polynucleotide agents are delivered in a pharmaceutical composition at a dosage sufficient for target gene expression. In certain embodiments of the present invention, the dosage of the dsRNA agent or antisense polynucleotide agent is 0.01 to 200.0 mg per kilogram of recipient body weight per day, generally 1 to 50 mg / kg body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, 4 to 15 mg / kg body weight, including end values. For example, each single administration of a dsRNA agent or antisense polynucleotide agent can be at a dosage of from about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2 .8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3 .7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4. 6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5m g / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / k g, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg , 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg to 50mg / kg body weight.

[0484] In determining the delivery dosage and time of the dsRNA reagent of the present invention, various factors can be considered. The absolute amount of the dsRNA reagent or antisense polynucleotide agent delivered will depend on various factors, including co-treatment, dosage number and individual subject parameters, including age, physical condition, size and body weight. These are factors well known to those of ordinary skill in the art and can be solved by routine experiments. In some embodiments, a maximum dose can be used, i.e., the highest safe dose according to reasonable medical judgment.

[0485] In some embodiments, the methods of the present invention may include administering 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of an agent or antisense polynucleotide agent to a subject. In some cases, a dose of the pharmaceutical compound may be administered to a subject at least daily, every other day, weekly, every other week, monthly, etc., and may be administered once a day or more than once a day, for example, 2, 3, 4, 5 or more times within a 24-hour cycle. The pharmaceutical composition of the present invention may be administered once a day; or the dsRNA agent or antisense polynucleotide agent may be administered in two, three or more sub-doses at appropriate intervals throughout the day, or even using continuous infusion or delivered by a controlled release formulation. In some embodiments of the methods of the present invention, the pharmaceutical composition of the present invention is administered to a subject once a day or more, once a week or more, once a month or more, or once a year or more.

[0486] Certain embodiments of the present invention include the use of pharmaceutical compositions containing dsRNA agents or antisense polynucleotide agents and pharmaceutically acceptable carriers. Pharmaceutical compositions comprising dsRNA agents or antisense polynucleotide agents can be used in the methods of the present invention to reduce gene expression and activity in cells, and can be used to treat related diseases or conditions. Such pharmaceutical compositions can be formulated based on the mode of delivery. Non-limiting examples of formulations for delivery modes are: compositions formulated for subcutaneous delivery, compositions formulated for systemic administration by parenteral delivery, compositions formulated for intravenous (IV) delivery, compositions formulated for intrathecal delivery, compositions formulated for direct delivery to the brain, etc. The pharmaceutical compositions of the present invention can be administered using one or more modes to deliver dsRNA agents or antisense polynucleotide agents to cells, for example: surface (e.g., by transdermal patch); lungs, for example, by inhalation or blowing into powder or aerosol, including by a nebulizer; intra-airway, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subcutaneous, for example, by implantation; or intracranial, for example, by intraparenchymal; intrathecal or intraventricular administration. dsRNA agents or antisense polynucleotide agents can also be delivered directly to target tissues, for example, directly to the liver, directly to the kidneys, etc. It will be understood that "delivering a dsRNA agent" or "antisense polynucleotide agent" to a cell includes delivering a dsRNA agent or antisense polynucleotide agent, expressing the dsRNA agent directly in the cell, and expressing the dsRNA agent from an encoding vector delivered to the cell, or any suitable means for causing the dsRNA or antisense polynucleotide agent to appear in the cell. The preparation and use of the formulations and the means for delivering inhibitory RNA are well known in the art and commonly used.

[0487] In some embodiments, composition also comprises one or more other therapeutic agents. The composition of the present invention can comprise one or more dsRNA reagents and optional one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, etc., and the non-limiting examples of available targeting agents according to some embodiments of the inventive method are reagents that the dsRNA reagents of the present invention are guided to and / or enter cells to be treated. The selection of targeting agents will depend on the following key factors: the nature of the relevant disease or illness, and the target cell type. In a non-limiting example, in some embodiments of the present invention, it may be necessary to target the dsRNA reagent to and / or enter hepatocytes. It should be understood that in some embodiments of the inventive method, therapeutic agent comprises a dsRNA reagent only with a delivery agent, such as a delivery agent comprising N-acetylgalactosamine (GalNAc), without any additional connecting elements. For example, in some aspects of the present invention, a dsRNA reagent can be connected to a delivery compound comprising GalNAc, and is included in a composition containing a pharmaceutically acceptable carrier, and is administered to a cell or object without any detectable label or targeting agent connected to the dsRNA reagent.

[0488] In the case where the dsRNA reagent of the present invention is administered together with one or more delivery agents, targeting agents, labeling agents, etc. and / or is connected thereto, those skilled in the art will be able to understand and be able to select and use suitable reagents for use in the methods of the present invention. In certain methods of the present invention, labeling agents can be used to determine the position of the dsRNA reagent in cells and tissues, and can be used to determine the cell, tissue or organ position of the therapeutic composition comprising the dsRNA reagent administered in the methods of the present invention. The means of attaching and using labeling agents such as enzyme labels, dyes, radioactive labels, etc. are well known in the art. It should be understood that in some embodiments of the compositions and methods of the present invention, the labeling agent is connected to one or both of the sense polynucleotides and antisense polynucleotides contained in the dsRNA reagent.

[0489] In some embodiments, the composition is packaged in a medicine box, container, packaging, dispenser, prefilled syringe or bottle. A medicine box comprising one or more target gene dsRNA reagents and / or target gene antisense polynucleotide reagents and their instructions for use in the methods of the present invention is also within the scope of the present invention. The medicine box of the present invention may include one or more target gene dsRNA reagents, target gene sense polynucleotides and target gene antisense polynucleotide reagents that can be used to treat target gene related diseases or conditions. A medicine box comprising one or more target gene dsRNA reagents, target gene sense polynucleotides and target gene antisense polynucleotide reagents can be prepared for use in the therapeutic methods of the present invention. The components of the medicine box of the present invention can be packaged in aqueous medium or lyophilized form. The medicine box of the present invention can include a carrier that is separated to enclose one or more container devices or a series of container devices (e.g., test tubes, vials, flasks, bottles, syringes, etc.) therein. The first container device or a series of container devices can include one or more compounds, such as target gene) dsRNA reagents and / or target gene sense or antisense polynucleotide reagents. The second container means or series of container means may contain targeting agents, labeling agents, delivery agents, etc., which may be included as part of the target gene (dsRNA) reagents and / or target gene antisense polynucleotides administered in embodiments of the treatment methods of the present invention.

[0490] The kit of the present invention may also include instructions. The instructions are typically in written form and will provide guidance for performing the treatment embodied by the kit and for making decisions based on the treatment.

[0491] Cells, subjects, and controls

[0492] The methods of the present invention can be used in conjunction with cells, tissues, organs, and / or subjects. In some aspects of the present invention, the subject is a human or a vertebrate mammal, including but not limited to dogs, cats, horses, cows, goats, mice, rats, and primates, such as monkeys. Thus, the present invention can be used to treat target gene-related diseases or conditions in both human and non-human subjects.

[0493] In some aspects of the invention, the subject can be a farm animal, a zoo animal, a domesticated animal, or a non-domesticated animal, and the methods of the invention can be used in veterinary prevention and treatment regimens. In some embodiments of the invention, the subject is a human and the methods of the invention can be used in human prevention and treatment regimens.

[0494] Non-limiting examples of subjects to which the present invention can be applied are subjects diagnosed with, suspected of having, or at risk of having a disease or condition associated with higher than desired target gene expression and / or activity, also referred to as "elevated target gene expression levels." Non-limiting examples of diseases and conditions associated with higher than desired target gene expression and / or activity are described elsewhere herein. The methods of the present invention can be applied to subjects who have been diagnosed with the disease or condition at the time of treatment, subjects associated with higher than desired target gene expression and / or activity, or subjects who are believed to be at risk of having or developing a disease or condition associated with higher than desired target gene expression and / or activity. In some aspects of the invention, the disease or condition associated with higher than desired target gene expression and / or activity levels is an acute disease or condition; in certain aspects of the invention, the disease or condition associated with higher than desired target gene expression and / or activity levels is a chronic disease or condition.

[0495] In another non-limiting example, the target gene dsRNA agent of the present invention is administered to treat a disease or disorder caused by or associated with the activation of the target gene, or a disease or disorder whose symptoms or progression respond to the inactivation of the target gene. The term "target gene-associated disease" includes diseases, disorders, or conditions that benefit from reduced expression of the target gene.

[0496] The cell that can be applied the method of the present invention includes in vitro, in vivo, in vitro cell.Cell can be in object, in culture and / or in suspension, or in any other suitable state or condition.The cell that can be applied the method of the present invention can be: liver cell (liver cell), liver cell (hepatocyte), heart cell, pancreatic cell, cardiovascular cell, kidney cell or other types of vertebrate cells, including human and non-human mammalian cells.In some aspects of the present invention, the cell that can be applied the method of the present invention is healthy normal cell, which is not known to be disease cell.In some embodiments of the present invention, the method and composition of the present invention are applied to the cell of liver cell, liver cell, heart cell, pancreatic cell, cardiovascular cell and / or kidney cell.In some aspects of the present invention, control cell is normal cell, but it should be understood that the cell with disease or illness can also be used as control cell in specific cases, for example, when comparing the treated cell with disease or illness and the result of untreated cell with disease or illness etc.

[0497] According to the method of the present invention, the level of target gene polypeptide activity can be determined and compared with a control level of target gene polypeptide activity. The control can be a predetermined value, which can take many forms. It can be a single cutoff value, such as a median or mean value. It can be established based on a comparison group, for example, in a group with normal levels of target gene polypeptide and / or target gene polypeptide activity and a group with increased target gene polypeptide and / or target gene polypeptide activity levels. Another non-limiting example of a comparison group can be a group with one or more symptoms or diagnoses of a target gene-related disease or condition and a group without one or more symptoms or diagnoses of a disease or condition; a group of subjects to whom the siRNA of the present invention has been administered and a group of subjects to whom the siRNA of the present invention has not been administered. Typically, the control can be based on apparently healthy normal individuals or apparently healthy cells in an appropriate age group. It should be understood that, in addition to the predetermined value, the control according to the present invention can be a material sample tested in parallel with the experimental material. Examples include samples from a control group or control samples produced by manufacturing for parallel testing with the experimental sample. In some embodiments of the present invention, a control may include cells or subjects that have not been contacted or treated with a target gene dsRNA agent of the present invention. In this case, the control level of the target gene polypeptide and / or target gene polypeptide activity can be compared with the level of the target gene polypeptide and / or target gene polypeptide activity in cells or subjects contacted with a target gene dsRNA agent or a target gene antisense polynucleotide agent of the present invention.

[0498] In some embodiments of the present invention, the control level can be a target gene polypeptide level determined for a subject, wherein the target gene polypeptide level determined for the same subject at different times is compared to the control level. In one non-limiting example, the target gene level is determined in a biological sample obtained from a subject that has never received the targeted gene therapy of the present invention. In some embodiments, the biological sample is a serum sample. The target gene polypeptide level measured in the sample obtained from the subject can serve as the baseline or control value for the subject. After administering one or more targeted gene dsRNA agents to a subject in the treatment methods of the present invention, one or more additional serum samples can be obtained from the subject, and the target gene polypeptide level in the subsequent one or more samples can be compared to the control / baseline level of the subject. Such comparisons can be used to assess the onset, progression, or regression of a target gene (target gene)-related disease or condition in a subject. For example, if the level of a target gene (target gene) polypeptide in a baseline sample obtained from a subject is higher than the level obtained from the same subject after administering the target gene dsRNA agent of the present invention or the target gene (target gene) antisense polynucleotide agent to the subject, then this indicates regression of the target gene-related disease or condition and indicates the efficacy of the administered target gene dsRNA agent of the present invention in treating the target gene-related disease or condition.

[0499] In certain aspects of the present invention, one or more values ​​of the target gene polypeptide and / or target gene polypeptide activity level determined for a subject can be used as a control value and used to compare the target gene polypeptide and / or target gene activity level in the same subject at a later time, thereby allowing the assessment of changes in the "baseline" target gene polypeptide activity in the subject. Therefore, when the initial level is used as the control level for the subject, the initial target gene polypeptide level and / or the initial target gene polypeptide activity level can be used to demonstrate and / or determine that the methods and compounds of the present invention are capable of reducing the level of the target gene polypeptide and / or target gene polypeptide activity in the subject in the subject.

[0500] Using the methods of the present invention, the target gene dsRNA agents and / or target gene antisense polynucleotide agents of the present invention can be administered to a subject. Such dsRNAi agents include the efficacy of the administration and treatment of the present invention can be assessed as follows: the level of the target gene polypeptide in the serum sample obtained from the subject after administration and treatment is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to the pre-administration level of the target gene polypeptide in the serum sample obtained from the subject at a previous time point, or compared to the level of the target gene polypeptide in the control serum sample (e.g., the level of the target gene polypeptide in the control serum sample). It should be understood that the level of the target gene polypeptide and the level of the target gene polypeptide activity are both related to the level of target gene expression. Certain embodiments of the methods of the present invention include administering the target gene dsRNA of the present invention to the subject in an amount effective to inhibit the expression of the target gene. A and / or target gene antisense agents, thereby reducing the level of target gene polypeptide in the subject and reducing the level of target gene polypeptide activity. In some embodiments of the methods of the present invention, contacting a cell with an siRNA agent of the present invention (also referred to herein as treatment) results in at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 111 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100%, for example, to below the level of detection in an assay.

[0501] Some embodiments of the present invention include determining the presence, absence, and / or amount (also referred to herein as level) of a target gene polypeptide in one or more biological samples obtained from one or more subjects. This assay can be used to evaluate the efficacy of the therapeutic methods of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of a target gene polypeptide in a biological sample obtained from a subject previously treated with a target gene dsNA reagent and / or a target gene antisense agent of the present invention. When the level of the target gene polypeptide in a serum sample obtained from the subject after administration and treatment is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to the pre-dose level of the target gene polypeptide in a serum sample obtained from the subject at a previous time point, or compared to a non-contact control level (e.g., the target gene polypeptide level in a control serum sample), it indicates the efficacy level of the treatment administered to the subject.

[0502] In some embodiments of the present invention, the physiological characteristics of the target gene-related disease or condition determined for the object can be used as a control result, and the determination results of the physiological characteristics of the same object at different times are compared with the control results. In a non-limiting example, the pathological feature hemolysis is measured from an object that has never been treated with the target gene therapy of the present invention, which can be used as the baseline or control value of the object. After the target gene dsRNA reagent is applied to the object once or more in the treatment method of the present invention, the blood cells are compared with the control / baseline levels of the object respectively. Such comparisons can be used to assess the onset, progression or regression of the target gene-related disease or condition in the object. For example, the baseline blood cells obtained from the object are higher than the thrombus measured from the same object after the target gene dsRNA reagent or target gene antisense polynucleotide reagent of the present invention is applied to the object, indicating the regression of the target gene-related disease or condition and indicating the efficacy of the target gene dsRNA reagent of the present invention in treating the target gene-related disease or condition.

[0503] Some embodiments of the present invention include determining the presence, absence, and / or changes in physiological characteristics of a target gene associated with a disease or condition using, for example, but not limited to, the following methods: (1) measuring blood cells of a subject; (2) evaluating physiological characteristics of one or more biological samples obtained from one or more subjects; (3) or performing a physical examination of the subject. This determination can be used to evaluate the efficacy of the treatment methods of the present invention.

[0504] the term

[0505] As used herein, the term "RNAi" is also known in the art, and can be referred to as "siRNA" is also a short-chain "RNAi". As used herein, the term "RNAi" refers to an agent comprising RNA and mediating the targeted cutting of RNA transcripts by RNA-induced silencing complex (RISC) pathway. As known in the art, the RNAi target region refers to a continuous portion of the nucleotide sequence of the RNA molecule formed during gene transcription, including messenger RNA (mRNA), which is a processed product of the primary transcript RNA. The target portion of the sequence will be at least long enough to be used as a substrate for RNAi directed cutting at or near this portion. The target sequence can be 8-30 nucleotides long (including end values), 10-30 nucleotides long (including end values), 12-25 nucleotides long (including end values), 15-23 nucleotides long (including end values), 16-23 nucleotides long (including end values), or 18-23 nucleotides long (including end values), and includes all shorter lengths within each specified range. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. In certain embodiments, the target sequence is between 9 and 26 nucleotides in length (inclusive), including all subranges and integers therebetween. For example, although not intended to be limiting, in certain embodiments of the invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length that is completely or at least substantially complementary to at least a portion of the RNA transcript of the target gene.

[0506] As used herein, "dsRNA agent" refers to a composition comprising RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that are capable of degrading or inhibiting the translation of a target mRNA transcript. Although not wishing to be limited to a particular theory, the dsRNA agents of the present invention may act via an RNA interference mechanism (i.e., by inducing RNA interference by interacting with the RNA interference pathway machinery of mammalian cells (RNA-induced silencing complex or RISC)), or by any alternative mechanism or pathway. Methods for achieving gene silencing in plant, invertebrate, and vertebrate cells are well known in the art (see, e.g., Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188), the disclosures of each of which are incorporated herein by reference in their entirety.

[0507] As used herein, the dsRNA agents disclosed herein are composed of a sense strand and an antisense strand, including but not limited to short interfering RNA (siRNA), RNAi agents, microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the targeted mRNA, and it is understood in the art that dsRNA duplex structures of various lengths can be used to inhibit target gene expression. For example, dsRNAs with duplex structures of 19, 20, 21, 22, and 23 base pairs are known to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20: 6877-6888). It is also known in the art that shorter or longer RNA duplex structures can also effectively induce RNA interference.

[0508] As used herein, certain embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or administer single-stranded RNA to a subject. Single-stranded antisense molecules that may be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as "single-stranded antisense agents" or "antisense polynucleotide agents," and "antisense single-stranded nucleotide agents" are also referred to as "ASOs." Single-stranded sense molecules that may be included in certain compositions and / or administered in certain methods of the present invention are referred to herein as "single-stranded sense agents" or "sense polynucleotide agents."

[0509] As used herein, the term "base sequence" herein refers to a polynucleotide sequence without chemical modification or delivery compound.

[0510] As used herein, the term "matching position" refers in a sense to the position in each strand that "pairs" with each other when the two strands are in a duplex. For example, in a 21 nucleobase sense strand and a 21 nucleobase antisense strand, the 1st nucleobase of the sense strand is in a "matching position" with the 21st nucleobase of the antisense strand. In another non-limiting example, for a 23 nucleobase sense strand and a 23 nucleobase antisense strand, the 2nd nucleobase of the sense strand is in a matching position with the 22nd nucleobase of the antisense strand. In another non-limiting example, in an 18 nucleobase sense strand and an 18 nucleobase antisense strand, the 1st nucleobase of the sense strand is in a matching position with the 18th nucleobase of the antisense strand; and the 4th nucleobase in the sense strand is in a matching position with the 15th nucleobase in the antisense strand. Those of skill will understand how to identify matching positions between the sense and antisense strands of duplexes and paired strands.

[0511] mismatch

[0512] It is known to those skilled in the art that mismatches are tolerable for the efficacy of dsRNA, especially in the terminal regions of the dsRNA. Certain mismatches are better tolerated, for example, mismatches with wobble base pairs G:U and A:C are better tolerated (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33(5): 1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005; 33(11): 3698).

[0513] Complementarity

[0514] As used herein, unless otherwise indicated, the term "complementarity" when used to describe the relatedness of a first nucleotide sequence (e.g., a target gene dsRNA agent sense strand or a target gene mRNA) to a second nucleotide sequence (e.g., a target gene dsRNA agent antisense strand or a single-stranded antisense polynucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize [form inter-base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)] with an oligonucleotide or polynucleotide comprising the second nucleotide sequence and to form a duplex or duplex structure under certain conditions. Other conditions may also apply, such as physiologically relevant conditions that may be encountered in an organism. A skilled person will be able to determine the set of conditions that is most suitable for testing the complementarity of two sequences based on the ultimate application of the hybridizing nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics, as long as at least the above hybridization requirements are met. Sequence identity or complementarity is independent of modification.

[0515] For example, the complementary sequence in the target gene dsRNA as described herein comprises an oligonucleotide or polynucleotide containing a first nucleotide sequence and an oligonucleotide or polynucleotide containing a second nucleotide sequence that base-pairs over the full length of one or two nucleotide sequences. Such sequences may be referred to herein as "fully complementary" to each other. It should be understood that in embodiments in which two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs are not considered herein as mismatches determined based on complementarity. For example, a target gene dsRNA reagent comprises an oligonucleotide of 19 nucleotides in length and another oligonucleotide of 20 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 19 nucleotides that is fully complementary to the shorter oligonucleotide. For purposes described herein, this situation may be referred to as "fully complementary." Therefore, as used herein, "fully complementary" refers to that all (100%) bases in the continuous sequence of the first polynucleotide will hybridize with the same number of bases in the continuous sequence of the second polynucleotide. The continuous sequence may comprise all or part of the first or second nucleotide sequence.

[0516] As used herein, the term "substantially complementary" refers to a hybridization pair of nucleobase sequences in which at least about 85% (but not all) of the bases in the contiguous sequence of a first polynucleotide hybridize to the same number of bases in the contiguous sequence of a second polynucleotide. If the two sequences contain one or more mismatched base pairs, such as at least 1, 2, 3, 4, or 5 mismatched base pairs, when hybridized, the term "substantially complementary" can be used to refer to a first sequence that forms a duplex of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) relative to the second sequence while retaining the ability to hybridize under conditions most relevant to its ultimate application, for example, inhibition of target gene expression by the RISC pathway. The term "partially complementary" can be used herein to refer to a hybridization pair of nucleobase sequences in which at least 75% (but not all) of the bases in the contiguous sequence of a first polynucleotide hybridize to the same number of bases in the contiguous sequence of a second polynucleotide. In some embodiments, "partially complementary" means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the bases in the contiguous sequence of the first polynucleotide will hybridize to the same number of bases in the contiguous sequence of the second polynucleotide.

[0517] The terms "complementary," "fully complementary," "substantially complementary," and "partially complementary" as used herein may refer to base matching between the sense and antisense strands of a dsRNA agent, base matching between the antisense strand of a dsRNA agent and the sequence of a target mRNA, or base matching between a single-stranded antisense oligonucleotide and the target mRNA sequence. It should be understood that the term "antisense strand of a dsRNA agent" can refer to the same sequence as an "antisense polynucleotide agent."

[0518] As used herein, the terms "substantially identical" or "substantial identity" when used in reference to a nucleic acid sequence refer to a nucleic acid sequence comprising a sequence having at least about 85% or greater sequence identity, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing the optimal alignment of the two sequences over the comparison window. The percentage is calculated by determining the number of positions at which the same nucleic acid base appears in the two sequences to produce the number of matched positions; dividing the number of matched positions by the total number of positions in the comparison window and then multiplying the result by 100 to obtain the percentage of sequence identity.

[0519] As used herein, the term "chain comprising a sequence" refers to an oligonucleotide comprising a nucleotide chain described by a sequence referred to using standard nucleotide nomenclature. As used herein, the term "double-stranded RNA" or "dsRNA" refers to a sequence comprising an RNA molecule or RNAi molecule complex having a hybridized double-stranded region comprising two antiparallel and substantially or completely complementary nucleic acid chains, which are referred to as having "sense" and "antisense" directions relative to the target gene RNA, respectively. The double-stranded region can have any desired length that allows for specific degradation of the target gene RNA by the RISC pathway, but is typically 9 to 30 base pairs in length, for example 15-30 base pairs in length. Contemplating duplexes between 9 and 30 base pairs, the duplexes can be any length within this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs, and any subranges therein, including but not limited to 15-30 base pairs, 15-26 base pairs; 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-27 base pairs, 18-30 base pairs, 18-28 base pairs, 18-30 base pairs, 18-26 base pairs, 18-27 base pairs, 18-28 base pairs, 18-29 base pairs, 18-30 base pairs, 18-29 base pairs, 18-30 base pairs, 18-26 .... -23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs or 21-22 base pairs. The length of the dsRNA reagent produced in the cell by processing with Dicer and similar enzymes is generally within the range of 19-22 base pairs. A chain in the double-stranded region of the dsDNA agent comprises a sequence that is substantially complementary to the region of the gene RNA. The two chains forming the duplex structure can be from a single RNA molecule with at least one self-complementary region, or can be formed by two or more independent RNA molecules. In the case where the double-stranded region is formed by a single molecule, the molecule can have a duplex structure (herein referred to as "hairpin loop") formed by a single-stranded nucleotide chain at a chain at the 3'-end and another chain at the corresponding 5'-end. In some embodiments of the present invention, the hairpin configuration comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides.When the two substantially complementary strands of a dsRNA agent are composed of separate RNA molecules, these molecules need not be covalently linked, but can be covalently linked. When the two strands are covalently linked by means other than a hairpin loop, the connecting structure is referred to as a "linker."

[0520] base pairing

[0521] The term "base pairing" is used herein in a non-limiting sense to mean that, for example, a dsRNA agent can contain base pairs that are complementary or mismatched in the sense and antisense sequences.

[0522] Blunt end or protruding end

[0523] In some embodiments of the present invention, a dsRNA agent may comprise sense and antisense sequences having unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA agent, and these unpaired nucleotides or nucleotide analogs are referred to as "overhangs". An end without unpaired nucleotides is referred to as a "blunt end" and has no nucleotide overhangs. If both ends of a dsRNA agent are blunt-ended, the dsRNA is referred to as "blunt-ended". In some embodiments of the present invention, the first end of the dsRNA agent is blunt-ended, in some embodiments, the second end of the dsRNA agent is blunt-ended, and in certain embodiments of the present invention, both ends of the dsRNA agent are blunt-ended.

[0524] In some embodiments of the dsRNA reagent of the present invention, the dsRNA does not have one or two blunt ends. In this case, there is at least one unpaired nucleotide at the end of one chain of the dsRNA reagent. For example, when the 3'-end of one chain of the dsRNA extends beyond the 5'-end of the other chain, there is a nucleotide overhang, and vice versa. The dsRNA may comprise an overhang of at least 1, 2, 3, 4, 5, 6 or more nucleotides. The nucleotide overhang may comprise or be composed of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. It should be understood that in some embodiments, the nucleotide overhang is on the sense strand of the dsRNA reagent, on the antisense strand of the dsRNA reagent, or at both ends of the dsRNA reagent, and the nucleotides of the overhang may be present at the 5' end, 3' end, or both ends of the antisense strand or sense strand of the dsRNA.

[0525] As used herein, the term "antisense strand" or "guide strand" refers to the strand of a dsRNA agent that comprises a region that is substantially complementary to a target sequence. As used herein, the term "sense strand" or "passenger strand" refers to the strand of a dsRNA agent that comprises a region that is substantially complementary to a region of the antisense strand of a dsRNA agent.

[0526] About modification

[0527] In some embodiments of the present invention, the RNA of the gene RNAi agent is chemically modified to obtain enhanced stability and / or one or more other beneficial properties. The nucleic acids in certain embodiments of the present invention can be synthesized and / or modified by methods well known in the art, for example, see "Current protocols in Nucleic Acid Chemistry," Beaucage, SL et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may be present in certain embodiments of the dsRNA agents of the present invention include, for example: (a) terminal modifications, such as 5' end modifications (phosphorylation, conjugation, reverse connection, etc.), 3' end modifications (conjugation, DNA nucleotides, reverse connection, etc.); (b) base modifications, such as base substitution with stable bases, destabilizing bases, or base pairing with an expanded partner library, deletion of bases (abasic nucleotides), or conjugation of bases; (c) sugar modifications (e.g., at the 2' position or the 4' position) or replacement of sugars; and (d) backbone modifications, including modification or replacement of phosphodiester bonds. Specific examples of RNA compounds available in certain embodiments of the dsRNA reagents, antisense polynucleotides and sense polynucleotides of the present invention include, but are not limited to, RNAs comprising modified backbones or without natural internucleoside linkages. As non-limiting examples, RNAs with backbone modifications may not have phosphorus atoms in the backbone. RNAs without phosphorus atoms in their internucleoside backbones may be referred to as oligonucleosides. In certain embodiments of the present invention, modified RNAs have phosphorus atoms in their internucleoside backbones.

[0528] It should be understood that the term "RNA molecule" or "RNA" or "ribonucleic acid molecule" includes not only RNA molecules expressed or found in nature, but also analogs and derivatives of RNA, which include one or more ribonucleotides / ribonucleoside analogs or derivatives as described herein or known in the art. The terms "ribonucleoside" and "ribonucleotide" are used interchangeably herein. RNA molecules can be modified in the core base structure or the ribose-phosphate backbone structure (e.g., as described below), and molecules containing ribonucleoside analogs or derivatives must retain the ability to form duplexes.

[0529] As used herein, the term "fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2'-position of the ribose group of a nucleotide is replaced by fluorine, and "non-fluorinated modified nucleotide" refers to a nucleotide or nucleotide analog in which the hydroxyl group at the 2'-position of the ribose group of a nucleotide is replaced by a non-fluorinated group. "Nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides. The methoxy-modified nucleotide refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced by a methoxy group. Isonucleotides refer to compounds formed by changing the position of the base on the ribose ring in a nucleotide. In some embodiments, an isonucleotide can be a compound formed by moving the base from the 1'-position to the 2'-position or 3'-position of the ribose ring. BNAs refer to constrained or inaccessible nucleotides. BNAs can contain a five-, six-, or seven-membered ring with a "fixed" C3'-endo sugar condensed bridge structure. The bridge is typically incorporated at the 2' or 4' position of the ribose to provide a 2',4'-BNA nucleotide. In some embodiments, BNAs can be LNA, ENA, cET BNA, etc. Acyclic nucleotides are a type of nucleotide formed by opening the sugar ring of the nucleotide. In some embodiments, acyclic nucleotides can be unlocked nucleic acids (UNA) or glycerol nucleic acids (GNA).

[0530] As non-limiting examples, the RNA molecule can also include at least one modified ribonucleoside, including but not limited to 2'-O-methyl modified nucleosides, nucleosides comprising 5' thiophosphate groups, terminal nucleosides connected to cholesterol derivatives or dodecanoic acid bisdecylamide groups, locked nucleosides, abasic nucleosides, 2'-deoxy-2'-fluoro modified nucleosides, 2'-amino modified nucleosides, 2'-alkyl modified nucleosides, morpholino nucleosides, phosphoramidates or the non-natural bases comprising nucleosides, or any combination thereof. In some embodiments of the present invention, the RNA molecule includes the modified ribonucleosides of the following number: at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 total lengths of the ribonucleosides of the dsRNA agent molecule. For each of the multiple modified ribonucleosides in this RNA molecule, the modifications need not be identical.

[0531] In some embodiments, the dsRNA reagents, antisense polynucleotides and / or sense polynucleotides of the present invention can include one or more independently selected modified nucleotides and / or one or more independently selected non-phosphodiester bonds. The term "independent selection" as used herein refers to selected elements, such as modified nucleotides, non-phosphodiester bonds, etc., and refers to two or more selected elements that can be identical to each other but do not necessarily have to be identical to each other. As used herein, "nucleotide bases", "nucleotides" or "core bases" are heterocyclic pyrimidine or purine compounds, which are standard components of all nucleic acids and include bases forming nucleotides: adenine (a), guanine (g), cytosine (c), thymine (t) and uracil (u). Core bases can be further modified to include (but are not intended to limit): universal bases, hydrophobic bases, mixed bases, bases with expanded size and fluorinated bases. The terms "ribonucleotides" or "nucleotides" can be used herein to refer to unmodified nucleotides, modified nucleotides or alternative moieties. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil may be replaced by other moieties without significantly altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such a replacement moiety.

[0532] In one embodiment, the RNA of the modification contemplated for use in the methods and compositions described herein is a peptide nucleic acid (PNA), which has the ability to form a desired duplex structure and allow or mediate the specific degradation of the target RNA via the RISC pathway. In certain embodiments of the invention, the gene RNA interfering agent includes a single-stranded RNA that interacts with the target gene RNA sequence to guide the cutting of the target gene RNA.

[0533] The RNA backbone of modification can comprise for example phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkylphosphonates (comprising 3'-alkylene phosphonates and chiral phosphonates), phosphinate, phosphoramidate (comprising 3'-amino phosphoramidate and aminoalkylphosphoramidate), thiophosphoramidate, thioalkylphosphonates, thioalkylphosphotriester, and boric acid phosphate (it has normal 3'-5' connection, and these 2'-5' connection analogs, and those with inverted polarity, wherein adjacent nucleoside units are to with 3'-5' to 5'-3' or 2'-5' to 5'-2' form connection). Various salts, mixed salts and free acid forms are also comprised. The method for preparing phosphorus-containing bond is the conventional implementation means of this area, and this type of method can be used for preparing the dsRNA reagent of some modification of the present invention, the antisense polynucleotide of some modification and / or the justice polynucleotide of some modification.

[0534] The modified RNA backbone wherein the phosphorus atom is not included has a backbone formed by a short-chain alkyl or cycloalkyl nucleoside linkage, a mixed heteroatom and an alkyl or cycloalkyl nucleoside linkage, or one or more short-chain heteroatom or heterocyclic nucleoside linkages. It includes those with morpholine bonds (partially formed by the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; methylacetyl and thiomethylacetyl backbones; methylenemethylacetyl and thiomethylacetyl backbones; backbones containing olefins; sulfamate backbones; methyleneimino and methylenehydrazine backbones; sulfonates and sulfonamide backbones; amide backbones; and other parts mixed with N, O, S and CH2 components. The method for preparing a modified RNA backbone without a phosphorus atom is conventional practice in the art, and such methods can be used to prepare certain modified dsRNA agents of the present invention, certain modified antisense polynucleotides and / or certain modified sense polynucleotides.

[0535] In certain embodiments of the present invention, RNA mimics are included in dsRNA, antisense polynucleotides and / or sense polynucleotides, such as, but not limited to, sugar and internucleoside linkages (i.e., backbones) that replace nucleotide units with new groups. In such embodiments, base units are kept to hybridize with suitable nucleic acid target compounds. A kind of such oligomeric compound (RNA mimics that have been shown to have excellent hybridization properties) is referred to as peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced by backbones containing amides, particularly aminoethylglycine backbones. Core bases are retained and are directly or indirectly combined with the nitrogen atoms of the backbone amide moieties. The method for preparing RNA mimics is conventional practice in this area, and such methods can be used to prepare the dsRNA reagents of some modifications of the present invention.

[0536] Some embodiments of the invention include RNAs having phosphorothioate backbones and oligonucleosides having heteroatom backbones, particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as a methylene(methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- [where the natural phosphodiester backbone is represented as -OPO-CH2-]. Methods for preparing RNAs having phosphorothioate backbones and oligonucleosides having heteroatom backbones are routinely practiced in the art, and such methods can be used to prepare certain modified dsRNA agents, certain antisense polynucleotides, and / or certain sense polynucleotides of the invention.

[0537] The modified RNA may also comprise one or more substituted sugar moieties. The dsRNA, antisense polynucleotides and / or sense polynucleotides of the present invention may comprise one of the following at the 2' position: OH, F, O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein alkyl, alkenyl and alkynyl groups may be substituted or unsubstituted C1 to C 10 Alkyl or C2 to C 10 Exemplary suitable modifications include: O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) n CH3)]2, wherein n and m are 1 to about 10. In other embodiments, the dsRNA comprises one of the following at the 2' position: C1 to C 10 Lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino; substituted silyl, RNA cleavage group, reporter group, intercalator; group for improving the pharmacokinetic properties of dsRNA agent; or group for improving the pharmacodynamic properties of dsRNA agent, antisense polynucleotide and / or sense polynucleotide, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504). Another exemplary modification is 2'-dimethylaminoethoxyethoxy, i.e., O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in the Examples below; and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Methods for preparing modified RNAs such as those described are routinely practiced in the art, and such methods can be used to prepare certain modified dsRNA agents of the invention.

[0538] Similar modifications can also be carried out at other positions on the RNA of dsRNA reagents of the present invention, antisense polynucleotides, other positions of sense polynucleotides and / or sense polynucleotides, particularly at 3' terminal nucleotides or at 3' position of sugar in dsRNA, antisense polynucleotides or sense polynucleotides connected with 2'-5' and at 5' position of 5' terminal nucleotides. dsRNA reagents, antisense polynucleotides and / or sense polynucleotides can also have sugar mimics, for example, replacing the cyclobutyl moiety of pentofuranosyl. The method for preparing such as described modified RNA is conventional practice in this area, and such method can be used for preparing dsRNA reagents, antisense polynucleotides and / or sense polynucleotides of some modifications of the present invention.

[0539] In some embodiments, the dsRNA agent, antisense polynucleotide and / or sense polynucleotide may include modifications or substitutions of nucleobases (often referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymidine. Adenine, 5-uracil (pseudouracil), 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines; 5-halo, in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-azaguanine and 7-azaadenine and 3-azaguanine and 3-azaadenine. Additional nucleobases that can be included in certain embodiments of the dsRNA agents of the invention are known in the art, see, for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, JL, Ed. John Wiley & Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Methods of preparing dsRNA, antisense strand polynucleotides, and / or sense strand polynucleotides comprising nucleobase modifications and / or substitutions, such as those described herein, are routinely practiced in the art, and such methods can be used to prepare certain modified dsRNA agents, sense polynucleotides, and / or antisense polynucleotides of the invention.

[0540] Certain embodiments of the dsRNA agents, antisense polynucleotides and / or sense polynucleotides of the present invention include RNA modified to include one or more locked nucleic acids (LNAs). Locked nucleic acids are nucleotides with modified ribose moieties that contain an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-endo conformation. Adding locked nucleic acids to the dsRNA agents, antisense polynucleotides and / or sense polynucleotides of the present invention can increase stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). The method for preparing the dsRNA reagent, antisense polynucleotide and / or justice polynucleotide comprising locked nucleic acid is conventionally implemented in this area, and such method can be used for preparing the dsRNA reagent of some modification of the present invention.Some embodiment of the dsRNA compound of the present invention, justice polynucleotide and / or antisense polynucleotide includes the nucleotide of at least one modification, wherein the nucleotide of at least one modification includes: 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxynucleotide, 2', 3'-seco nucleotide mimetics, locked nucleotide, 2'-F-arabinose nucleotide, 2'-methoxyethyl nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide and 3'-Ome nucleotide, nucleotide comprising 5'-thiophosphate group, or the terminal nucleotide connected with cholesterol derivative or dodecanoic acid bisdecylamide group, 2'-amino modified nucleotide, phosphoramidate or the non-natural base comprising nucleotide.In some embodiments, dsRNA compound includes E-vinylphosphonate nucleotide at the 5' end of antisense strand (also referred to as guide strand in this article).

[0541] In certain embodiments of the present invention, at least one modified nucleotide is included at the 3' and 5' ends of the dsRNA compound, the sense polynucleotide, and / or the 3' end of the antisense polynucleotide, wherein the at least one modified nucleotide comprises: an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-OMe nucleotide, or an inverted 2'-deoxynucleotide. It is known to those skilled in the art that including an abasic or inverted abasic nucleotide at the end of an oligonucleotide can enhance stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003; 31(11): 2705-2716. doi: 10.1093 / nar / gkg393).

[0542] In certain embodiments of the present invention, the dsRNA compound or antisense polynucleotide comprises at least one modified nucleotide, wherein the at least one modified nucleotide comprises an open-ring nucleic acid nucleotide (UNA) or / and a glycol nucleic acid nucleotide (GNA). It is known to those skilled in the art that UNA and GNA are thermally unstable chemical modifications that can significantly improve the off-target spectrum of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018; 9(1): 723. doi: 10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010; 6: 862–70).

[0543] In certain embodiments, the present invention relates to open-ring nucleic acid (UNA) oligomers for therapeutic use. Open-ring nucleic acid (UNA) is an acyclic analog of RNA in which the bond between the C2' atom of the ribose ring and the 'atom of the target gene has been severed. It has been demonstrated that the incorporation of UNA is well tolerated for siRNA gene silencing activity and can even enhance its activity in some cases (Meghan A. et al. "Locked vs. unlocked nucleic acids (LNA vs. UNA): contrasting structures work towards common therapeutic goals". Chem. Soc. Rev., 2011, 40, 5680–5689).

[0544] UNA is a heat-labile modification, and replacing ribonucleotides with UNA reduces base pairing strength and duplex stability. Strategic placement of UNA in the seed region of the siRNA antisense strand can reduce off-target activity in gene silencing mechanisms mediated by microRNA (miRNA). miRNAs primarily recognize target genes for gene suppression through base pairing between the antisense seed region (positions 2-8 from the 5' end) and the target mRNA. Each miRNA has the potential to regulate a large number of genes. The siRNA antisense strand loaded by the RNA-induced silencing complex (RISC) can also potentially regulate a large number of unintended genes through miRNA-mediated mechanisms. Therefore, the addition of thermally unstable nucleotides, such as UNA, to the seed region of siRNA can reduce off-target activity (Lam JK, Chow MY, Zhang Y, Leung SW. siRNA Versus miRNA as Therapeutics for Gene Silencing. Mol Ther Nucleic Acids. 2015 Sep 15; 4(9): e252. doi: 10.1038 / mtna.2015.23. PMID: 26372022; PMCID: PMC4877448.). Specifically, such RNA oligonucleotides or RNA oligonucleotide complexes contain at least one UNA nucleobase monomer in the seed region (Narendra Vaish et al. "Improved specificity of gene silencing by siRNAs containing unlocked nucleobase analog". Nucleic Acids Research, 2011, Vol. 39, No. 51823–1832).

[0545] According to the present invention, potential advantages of incorporating UNA into RNA oligonucleotides or RNA oligonucleotide complexes include but are not limited to:

[0546] 1. Reduce off-target activity. Adding UNA to the siRNA seed region reduces the base pairing strength of the seed region, thereby reducing potential off-target activity caused by the micro-RNA mechanism.

[0547] 2. UNA is well tolerated in terms of siRNA activity. In some cases, UNA can lead to enhanced activity.

[0548] Exemplary UNA monomers that can be used in this technology include, but are not limited to:

[0549] Invab is an inverted abasic (deoxyribose) residue. For example, in some embodiments, Invab: In some embodiments, the sense strand or antisense strand may include a "terminal cap," which, as used herein, is a non-nucleotide compound or other moiety that can be incorporated at one or more ends of the strand of the RNAi agent disclosed herein, and in some cases can provide certain advantageous properties for the RNAi agent, such as, for example, protection against exonuclease degradation. In some embodiments, an inverted abasic residue (Invab) is added as an end cap (see, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31 (11), 2705-16). End caps are generally known in the art, and in some embodiments, the end cap is present at the 5' end, the 3' end, or both the 5' and 3' ends of the sense strand.

[0550] Another modification can be i...

Claims

1. An RNAi agent for inhibiting target gene expression, wherein the RNAi agent is a double-stranded ribonucleic acid (dsRNA) agent, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising the formula (X) listed in the 3′ to 5′ direction: 3′-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5′ formula (X) in, Each N F represents 2′-fluorine-modified nucleotides; Each N X Each independently represents a modified or unmodified nucleotide, N X There are no more than three 2′-fluoro-modified nucleotides or there is only one 2′-fluoro-modified nucleotide; n can be an integer from 0 to 7.

2. The dsRNA agent of claim 1, wherein the antisense strand comprises a compound represented by formula (I) listed in the 3′ to 5′ direction: 3′-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5′ Formula (I) in, Each N F represents 2′-fluorine-modified nucleotides; Each N X Each independently represents a modified or unmodified nucleotide, N X There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide; n can be an integer from 0 to 7.

3. The dsRNA agent according to claim 1 or 2, wherein the antisense strand comprises the formula (I-1) listed in the 3′ to 5′ direction: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (I-1) in, Each N F represents 2′-fluorine-modified nucleotides; N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 There are three or more 2′-fluorinated nucleotides or there is only one 2′-fluorinated nucleotide; Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide; n can be an integer from 0 to 7.

4. The dsRNA agent according to claim 3, wherein in the antisense strand represented by formula (I-1), N M1 、N M2 、N M3 、N M4 、N M6 、N M7 and N M8 There are only three 2′-fluorinated nucleotides in N M5 Not a 2′-F modified nucleotide.

5. The dsRNA agent according to claim 1, wherein the antisense strand of the dsRNA agent comprises a 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5′ Formula (II) in, Each N F represents 2′-fluorine-modified nucleotides; N M1 、N M2 、N M3 、N M4 、N M5 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 and N M4 There are only two 2′-fluoro modified nucleotides in N M5 、N M7 and N M8 Not a 2′-fluorine-modified nucleotide; Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide; n can be an integer from 0 to 7.

6. The dsRNA agent according to claim 1-3, wherein the antisense strand of the dsRNA agent comprises a 3′-(N L ) n N M1 N L N M2 N L N F N L N F N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (III) in, Each N F represents 2′-fluorine-modified nucleotides; N M1 、N M2 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M6 and N M7 There are only two 2′-fluoro modified nucleotides in N M4 、N M5 and N M8 Not a 2′-fluorine-modified nucleotide; Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide; n can be an integer from 0 to 7.

7. The dsRNA agent according to any one of claims 3 to 6, wherein the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

8. The dsRNA agent according to any one of claims 3 to 6, wherein the nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

9. The dsRNA agent according to any one of claims 3 to 6, wherein the nucleotides at positions 2, 5, 12, 14 and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

10. The dsRNA agent according to any one of claims 3 to 6, wherein the nucleotides at positions 2, 4, 10, 14 and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

11. The dsRNA agent according to any one of claims 3 to 6, wherein the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

12. The dsRNA agent according to any one of claims 3 to 6, wherein the nucleotides at positions 2, 5, 12, 14 and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

13. The dsRNA agent according to any one of claims 3 to 6, wherein the nucleotides at positions 2, 5, 10, 14 and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

14. The dsRNA agent according to claim 1 or 2, wherein the antisense strand of the dsRNA agent is represented by formula (I), N M1 、N M2 、N M3 、N M5 、N M6 and N M8 There is only one 2′-fluorinated nucleotide in N M4 、N M7 Not a 2'-fluoro modified nucleotide.

15. The dsRNA agent of claim 14, wherein the antisense strand of the dsRNA agent comprises a 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (IV) in, Each N F represents 2′-fluorine-modified nucleotides; N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M5 、N M6 and N M8 There is only one 2′-fluorinated nucleotide in N M4 、N M7 Not a 2′-fluorine-modified nucleotide; Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide; n can be an integer from 0 to 7.

16. The dsRNA agent according to claim 15, wherein the nucleotides at positions 2, 4 and 14 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides.

17. The dsRNA agent according to claim 15, wherein the nucleotides at positions 2, 8, and 14 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluorine-modified nucleotides.

18. The dsRNA agent according to claim 15, wherein the nucleotides at positions 2, 12, and 14 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluorine-modified nucleotides.

19. The dsRNA agent according to claim 15, wherein the nucleotides at positions 2, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluoro-modified nucleotides.

20. The dsRNA agent according to claim 15, wherein the nucleotides at positions 2, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluorine-modified nucleotides.

21. The dsRNA agent according to claim 15, wherein the nucleotides at positions 2, 6, and 14 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA agent are 2'-fluorine-modified nucleotides.

22. The dsRNA agent of claim 1 or 2, wherein the antisense strand comprises the formula (I-2) listed in the 3' to 5' direction: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N M10 N M5 N M6 N L N M7 N M8 N L N F N L -5′ Formula (I-2) in, Each N F represents 2′-fluorine-modified nucleotides; N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 Each independently represents a modified or unmodified nucleotide, N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 、N M8 、N M9 and N M10 There are only three 2′-fluoro modified nucleotides; Each N L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide; n can be an integer from 0 to 7.

23. The dsRNA agent according to claim 22, wherein the nucleotides at positions 2, 7, 11, 14 and 16 of the antisense strand represented by formula (I-2) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

24. The dsRNA agent according to claim 22, wherein the nucleotides at positions 2, 7, 11, 14 and 18 of the antisense strand represented by formula (I-2) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

25. The dsRNA agent according to claim 22, wherein the nucleotides at positions 2, 8, 12, 14 and 16 of the antisense strand represented by formula (I-2) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

26. The dsRNA agent according to claim 22, wherein the nucleotides at positions 2, 9, 12, 14 and 16 of the antisense strand represented by formula (I-2) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides.

27. The dsRNA agent according to any one of claims 3 to 26, wherein the N of the antisense strand of the dsRNA agent is represented by formula (I-1), formula (I-2), formula (II), formula (III) and / or formula (IV). L One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural bases containing nucleotides; preferably, N in the dsRNA agent L The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, or Invab.

28. The dsRNA agent according to claim 1 or 2, wherein the N of the antisense strand represented by formula (I) and / or formula (X) is X One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural bases containing nucleotides; preferably, N in the dsRNA agent L The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, or Invab.

29. The dsRNA agent of any one of claims 1-28, which comprises in the antisense strand an E-vinylphosphonate nucleotide at the 5' end of the antisense strand.

30. The dsRNA agent according to any one of claims 3 to 28, wherein N in the antisense strand of the dsRNA agent is represented by formula (I-1), formula (I-2), formula (II), formula (III) and / or formula (IV) M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 N M8 、N M9 and / or N M10 The modified nucleotides are independently selected from the following: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), open ring nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides.

31. The dsRNA agent according to claim 30, wherein N M1 、N M2 、N M3 、N M4 、N M5 、N M6 、N M7 and N M8 When the nucleotides are not 2'-fluoro modified, they are each independently selected from 2'-O-methyl modified nucleotides.

32. The dsRNA agent of any one of claims 1 to 31, wherein the dsRNA agent has an antisense strand that is complementary or substantially complementary to a sense strand, and the length of the complementary region is between 18 and 25 nucleotides; preferably, the length of the complementary region is 18-23 nucleotides; preferably, the length of the complementary region is 19-21 nucleotides; preferably, the length of the complementary region is 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.

33. The dsRNA agent of any one of claims 1 to 32, wherein the dsRNA agent has a sense strand that is completely complementary to the antisense strand.

34. The dsRNA agent of any one of claims 1 to 33, wherein n is 0, 1, 2, 3, 4, 5, 6 or 7.

35. The dsRNA agent of any one of claims 1 to 34, wherein the length of the sense strand of the dsRNA agent does not exceed 40 nucleotides; preferably, the length of each strand of the dsRNA agent does not exceed 30 nucleotides; preferably, the length of each strand of the dsRNA agent does not exceed 25 nucleotides; preferably, the length of each strand of the dsRNA agent does not exceed 23 nucleotides; preferably, the length of each strand of the dsRNA agent is 19, 20 or 21 nucleotides.

36. The dsRNA agent according to any one of claims 1 to 35, wherein the 3' end or the 5' end or both ends of any one strand of the dsRNA agent comprise one or more overhang regions of the dsRNA agent, and the overhang can be 1 to 5 nucleotides in length.

37. The dsRNA agent of any one of claims 1 to 36, wherein the 3'-end of the antisense strand of the dsRNA agent has a blunt end.

38. The dsRNA agent of any one of claims 1 to 37, wherein the antisense strand of the dsRNA agent has an overhang of 1, 2, 3, 4 or 5 unpaired nucleotides at the 3'-end and / or the sense strand at the 5'-end.

39. The dsRNA agent according to any one of claims 1 to 38, wherein the sense strand of the dsRNA agent has a blunt end at the 3'-end and / or the antisense strand has a blunt end at the 5'-end.

40. The dsRNA agent of any one of claims 1 to 39, comprising at least one phosphorothioate internucleoside linkage; preferably, the sense strand of the dsRNA agent comprises at least one phosphorothioate internucleoside linkage; preferably, the antisense strand of the dsRNA agent comprises at least one phosphorothioate internucleoside linkage; preferably, the sense strand and / or antisense strand of the dsRNA agent comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages; preferentially, the dsRNA agent contains 1 or 2 phosphorothioate internucleoside linkages at the 3'-terminal and / or 5'-terminal position of the sense strand and / or antisense strand.

41. The dsRNA agent of any one of claims 1-40, further comprising one or more targeting groups or linking groups.

42. The dsRNA agent of claim 41, wherein the one or more targeting groups or linking groups are conjugated to the sense strand.

43. The dsRNA agent according to claim 41, wherein the targeting group or linking group of the dsRNA agent is selected from the group consisting of: N-acetyl-galactosamine (GalNAc) and lipophilic molecules.

44. The dsRNA agent of claim 41, wherein the targeting group or linking group is conjugated to the 5'-end of the sense strand, and the targeting group has the following structure:

45. The dsRNA agent according to any one of claims 1 to 44, wherein the antisense strand of the dsRNA agent comprises an inverted abasic residue at the 3'-terminus; preferably, the sense strand of the dsRNA agent comprises one or two inverted abasic residues at the 3' or / and 5' termini.

46. ​​An RNAi agent for inhibiting target gene expression, wherein the RNAi agent is a double-stranded ribonucleic acid (dsRNA) agent, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, the sense strand comprising a compound represented by formula (V) listed in the 5′ to 3′ direction: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (V) in, Each N′ F represents 2′-fluorine-modified nucleotides; N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 at least two 2′-fluoro-modified nucleotides; In formula (V), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (V) does not contain more than six 2′-fluorine-modified nucleotides in total; Each N′ L independently represent modified or unmodified nucleotides; n' may be an integer from 0 to 7.

47. The dsRNA agent of claim 46, having a sense strand as represented by formula (V') listed in the 5' to 3' direction: 5'-(N' L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L N′ L N′ L N′ L N′ L -3′ formula (V′) in, Each N′ F represents 2′-fluorine-modified nucleotides; N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 and N′ N6 There are only two 2′-fluoro modified nucleotides; Each N′ L independently represents a modified or unmodified nucleotide, where the modification is not a 2′-fluoro-modified nucleotide; n' may be an integer from 0 to 7.

48. The dsRNA agent of claim 47, wherein the nucleotides at positions 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V') are 2'-fluoro-modified nucleotides.

49. The dsRNA agent of claim 47, wherein the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V') are 2'-fluoro-modified nucleotides.

50. The dsRNA agent of claim 47, wherein the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V') are 2'-fluoro-modified nucleotides. The dsRNA agent of claim 47 , wherein the nucleotides at positions 11, 12, and 14 of the sense strand (counting from the first paired nucleotide from the 3′ end of the sense strand) of the dsRNA agent represented by formula (V′) are 2′-fluoro-modified nucleotides.

52. The dsRNA agent of claim 47, wherein the nucleotides at positions 11, 12, and 15 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (V') are 2'-fluoro-modified nucleotides.

53. An RNAi agent for inhibiting target gene expression, wherein the RNAi agent is a double-stranded ribonucleic acid (dsRNA) agent, the dsRNA agent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, the sense strand comprising the formula (IX) listed in the 5′ to 3′ direction: 5′-(N′ L ) n′ N′ L N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ F N′ L N′ N5 N′ N6 N′ N7 N′ L N′ L N′ L N′ L N′ L N′ L -3′ Formula (IX) in, Each N′ F represents 2′-fluorine-modified nucleotides; N′ N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and N′ N7 Each independently represents a modified or unmodified nucleotide, N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and N′ N7 at least two 2′-fluoro-modified nucleotides; In formula (IX), there is no motif of three or more consecutive 2′-fluorine-modified nucleotides, and formula (IX) does not contain more than six 2′-fluorine-modified nucleotides in total; Each N′ L independently represent modified or unmodified nucleotides; n' may be an integer from 0 to 7.

54. The dsRNA agent of claim 53, wherein the nucleotides at positions 7, 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA agent represented by formula (IX) are 2'-fluoro-modified nucleotides.

55. The dsRNA agent according to any one of claims 46 to 54, wherein N′ in the sense strand of the dsRNA agent is represented by formula (V) or formula (IX). L One or more of the nucleotides are independently selected from the following modified nucleotides: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bisdecylamide group, 2'-amino modified nucleotides, phosphoramidates, or non-natural bases containing nucleotides; preferably, the dsRNA agent is N' shown in formula (V) L The nucleotides are selected from the following modified nucleotides: 2'-O-methyl modified nucleotides, UNA, or Invab.

56. The dsRNA agent of any one of claims 46-55, comprising an E-vinylphosphonate nucleotide at the 5' end of the antisense strand.

57. The dsRNA agent according to any one of claims 46 to 56, wherein N′ in the sense strand of the dsRNA agent is represented by formula (V) and / or formula (IX). N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and N′ N7 The modified nucleotides are independently selected from the following: 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimetics, locked nucleotides (LNA), open ring nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidates or non-natural bases containing nucleotides.

58. The dsRNA agent of claim 57, wherein N' N1 , N′ N2 , N′ N3 , N′ N4 , N′ N5 , N′ N6 and N′ N7 When they are non-2'-fluoro modified nucleotides, they are each independently selected from 2'-O-methyl modified nucleotides.

59. The dsRNA agent of any one of claims 46-58, wherein the dsRNA agent has an antisense strand that is complementary or substantially complementary to the sense strand, and the length of the complementary region is between 18 and 25 nucleotides; preferably, the length of the complementary region is 18-23 nucleotides; preferably, the length of the complementary region is 19-21 nucleotides; preferably, the length of the complementary region is 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.

60. The dsRNA agent of any one of claims 46-59, having an antisense strand that is completely complementary to the sense strand.

61. The dsRNA agent of any one of claims 46-60, wherein n' is 0, 1, 2, 3, 4, 5, 6 or 7.

62. The dsRNA agent of any one of claims 46 to 61, wherein each antisense strand of the dsRNA is no more than 30 nucleotides in length; preferably, each antisense strand of the dsRNA is no more than 30 nucleotides in length; preferably, each antisense strand of the dsRNA is no more than 25 nucleotides in length; preferably, each antisense strand of the dsRNA is no more than 23 nucleotides in length; preferably, each antisense strand of the dsRNA is 19, 20, or 21 nucleotides in length.

63. The dsRNA agent according to any one of claims 46 to 62, wherein the sense strand of the dsRNA agent represented by Formula (V) or Formula (IX) has an unpaired nucleotide overhang at one or both of the 5'-termini.

64. The dsRNA agent according to any one of claims 46 to 63, wherein the 5'-terminus of the sense strand of the dsRNA agent represented by formula (V) or formula (IX) has a blunt end.

65. The dsRNA agent of any one of claims 46-64, wherein the antisense strand of the dsRNA agent has an overhang of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 unpaired nucleotides at the 3'-terminus.

66. The dsRNA agent of any one of claims 46 to 65, which has a blunt end at the 5'-end of the antisense strand and / or the 3'-end of the sense strand.

67. The dsRNA agent of any one of claims 46-66, comprising at least one phosphorothioate internucleoside linkage; preferably, the sense strand of the dsRNA agent comprises at least one phosphorothioate internucleoside linkage; preferably, the antisense strand of the dsRNA agent comprises at least one phosphorothioate internucleoside linkage; preferably, the sense strand and / or antisense strand of the dsRNA agent comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages; preferentially, the dsRNA agent contains 1 or 2 phosphorothioate internucleoside linkages at the 3'-terminal and / or 5'-terminal position of the sense strand and / or antisense strand.

68. The dsRNA agent of any one of claims 46-67, further comprising one or more targeting groups or linking groups.

69. The dsRNA agent of claim 68, wherein the one or more targeting groups or linking groups are conjugated to the sense strand.

70. The dsRNA agent of claim 68, wherein the targeting group or linking group is selected from the group consisting of: N-acetyl-galactosamine (GalNAc), a lipophilic molecule, and the targeting group or linking group is conjugated to the 5'-end of the sense strand, and the targeting group preferably has the following structure:

71. The dsRNA agent of any one of claims 46-70, wherein the sense strand of the dsRNA agent comprises an inverted abasic residue at the 3'-terminus.

72. The dsRNA agent of any one of claims 46-70, wherein the sense strand of the dsRNA agent comprises one or two inverted abasic residues at the 3' or / and 5' end.

73. The dsRNA agent of any one of claims 1-72, wherein the dsRNA agent is siRNA.

74. An RNAi agent for inhibiting the expression of a target gene sequence, wherein the RNAi agent is a double-stranded ribonucleic acid (dsRNA) agent comprising any combination of an antisense strand having a nucleotide sequence as set forth in any one of claims 1 to 45 and a sense strand having a nucleotide sequence as set forth in any one of claims 46 to 72.

75. A composition comprising the dsRNA agent of any of claims 1-74.

76. The composition of claim 75, further comprising a pharmaceutically acceptable carrier.

77. The composition of claim 76, further comprising one or more additional therapeutic agents.

78. The composition of claim 76, packaged in a kit, container, wrapper, dispenser, prefilled syringe, or vial.

79. The composition of claim 76, formulated for ocular, vaginal, rectal, intranasal, transdermal, subcutaneous administration, intravenous infusion, intraarterial, lymphatic, intrabronchial, intrapleural, intraperitoneal, cerebrospinal or intramuscular injection, pulmonary, intrathecal or intraventricular administration.

80. A cell comprising the dsRNA agent of any of claims 1-74.

81. A method for inhibiting target gene expression in a cell, the method comprising: The dsRNA agent of any of claims 1-74 is delivered into the subject or object such that the dsRNA agent is delivered to a specific target in the subject.

82. The method of claim 81, wherein the dsRNA agent is administered ocularly, vaginally, rectally, intranasally, transdermally, subcutaneously, intravenously, intraarterially, intralymphatically, intrabronchially, intrapleurally, intraperitoneally, by cerebrospinal or intramuscular injection, pulmonaryly, intrathecally, or intraventricularly to a subject.

83. The method of claim 81, wherein the target gene is selected from the group consisting of: LPA, PNPLA3, ASGR1, F7, F12, FXI, APOCIII, APOB, APOL1, TTR, PCSK9, SCAP, KRAS, CD274, PDCD1, C5, ALAS1, HAO1, LDHA, ANGPTL3, SERPINA1, AGT, HAMP, LECT2, EGFR, VEGF, KIF11, AT3, CTNNB1, HMGB1, HIF1A, APP, ATXN2, C9orf72, TARDBP, MAPT (Tau), HTT, SNCA, FUS, ATXN3, SCN9A, SCN10A, CACNA1B, ATXN1, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, and STAT3.

84. Use of the dsRNA agent of any one of claims 1 to 73 in the preparation of medicaments for viral diseases, neuromuscular diseases, bacterial infections, inflammatory and immune diseases, metabolic diseases, liver diseases, kidney diseases, cardiovascular diseases, ophthalmic diseases, lung diseases and rare diseases.

Images