New application of circACACA

Abstract

The invention relates to the technical field of poultry breeding, and particularly provides a novel application of circACACA. According to the invention, eight differentially expressed circRNAs are obtained, and all the circRNAs are expected to be used as markers for FLS diagnosis. According to the application disclosed by the invention, by constructing a molecular regulation and control network of the circACACA, the circACACA is found to be remarkably and highly expressed in the liver of the chicken and is mainly positioned in cytoplasm, and the circACACA plays a biological function as a molecular sponge of the miR-132b-5p and the miR-101-2-5p. The circACACA mediates a CBFB / PIM1 complex through a ceRNA mechanism, so that AKT / mTOR and PPAR-gamma signal channels are regulated and controlled, and the circACACA participates in fat metabolism regulation and health maintenance in poultry livers.

Description

Technical Field

[0001] The present invention relates to the technical field of poultry breeding, and in particular to a new application of circACACA. Background Art

[0002] Fatty Liver Syndrome (FLS) is the most common lipid metabolic disease in poultry, and generally occurs in laying hens in good physical condition during the peak egg-laying period. The peak egg-laying period of diseased chickens is significantly shortened, the egg production rate is significantly reduced, and it is often accompanied by weight gain. In severe cases, the mortality rate is as high as 5%-20%, which can cause huge economic losses to the poultry industry. The disease is a complex pathological syndrome caused by multiple factors such as genetics, environment, and metabolic stress. At present, scholars at home and abroad have mostly alleviated the incidence of FLS by controlling energy levels and protein intake and regulating the external environment. However, there is still a lack of effective preventive measures to completely prevent the occurrence of the disease. Studies have shown that circRNA plays a key role in the regulation of fat metabolism. However, there is no report on whether and how circACACA regulates the pathological mechanism of FLS through biological processes. In addition, there are still many functional circRNAs and their specific mechanisms of action that have not been fully explored, and in-depth research and verification are needed. Summary of the invention

[0003] The present invention aims to further explore the potential role of circACACA in chicken liver fatty lesions and its molecular regulatory mechanism, so as to provide new ideas and methods for solving chicken FLS, and thus propose a new application of circACACA.

[0004] In order to achieve the above object, the technical solution of the present invention is: In a first aspect, the present invention provides an application of a circRNA marker in the preparation of an FLS diagnostic product, characterized in that the circRNA marker is selected from at least one of circACACA, circKMT2E, circAHCTF1, circMAP4K5, circUSP45, circRHEB, circPLXNC1, and circQPRT.

[0005] FLS diagnostic products include but are not limited to reagents, kits, chips, etc.

[0006] Preferably, the circRNA marker is circACACA, or the circRNA marker is a combination of circACACA and at least one of circKMT2E, circAHCTF1, circMAP4K5, circUSP45, circRHEB, circPLXNC1, and circQPRT.

[0007] In a second aspect, the present invention provides the use of an agent for reducing or inhibiting the expression of the circACACA gene in the preparation of a product for promoting lipid metabolism balance in the liver of a chicken and / or enhancing the antioxidant stress capacity of liver cells and / or weakening liver cell autophagy, wherein the agent has a sequence as shown in SEQ ID NO. 1 to SEQ ID NO.2 or a sequence as shown in SEQ ID NO. 3 to SEQ ID NO.4.

[0008] Preferably, the target miRNA of the circACACA gene includes miR-132b-5p and miR-101-2-5p, and the common target gene of the miR-132b-5p and the miR-101-2-5p is CBFB.

[0009] In a third aspect, the present invention provides the use of miR-132b-5p and / or miR-101-2-5p in the preparation of products that promote lipid metabolism balance in chicken liver and / or enhance the ability of liver cells to resist oxidative stress and / or weaken liver cell autophagy.

[0010] In a fourth aspect, the present invention provides an agent for enhancing or promoting the expression of miR-132b-5p or an agent for reducing the adsorption of miR-132b-5p for use in the preparation of a product that promotes the balance of lipid metabolism in the liver of a chicken and / or enhances the ability of liver cells to resist oxidative stress and / or weakens the autophagy of liver cells, wherein the agent has a sequence as shown in SEQ ID NO. 76.

[0011] In a fifth aspect, the present invention provides an agent for enhancing or promoting the expression of miR-101-2-5p or an agent for reducing the adsorption of miR-101-2-5p for use in the preparation of a product that promotes the balance of lipid metabolism in the liver of a chicken and / or enhances the ability of liver cells to resist oxidative stress and / or weakens the autophagy of liver cells, wherein the agent has a sequence as shown in SEQ ID NO. 78.

[0012] In a sixth aspect, the present invention provides an application of an agent for reducing or inhibiting CBFB gene expression in the preparation of a product for promoting lipid metabolism balance in chicken liver and / or enhancing the ability of liver cells to resist oxidative stress and / or weakening liver cell autophagy, wherein the agent has a sequence as shown in SEQ ID NO. 84 to SEQ ID NO.85.

[0013] In the seventh aspect, the present invention provides a product for promoting lipid metabolism balance in chicken liver and / or enhancing the ability of liver cells to resist oxidative stress and / or weakening liver cell autophagy, characterized in that it includes the reagent described in the second aspect, the fourth aspect, the fifth aspect, and the sixth aspect or the miR-132b-5p and / or miR-101-2-5p described in the third aspect.

[0014] In the eighth aspect, the present invention provides a method for promoting lipid metabolic balance in the liver of a chicken and / or enhancing the ability of liver cells to resist oxidative stress and / or weakening liver cell autophagy for non-therapeutic and non-diagnostic purposes, characterized in that it comprises: transfecting a sequence as shown in SEQ ID NO. 1 to SEQ ID NO. 2, or transfecting a sequence as shown in SEQ ID NO. 3 to SEQ ID NO. 4, or transfecting a sequence as shown in SEQ ID NO. 76, or transfecting a sequence as shown in SEQ ID NO. 78, or transfecting a sequence as shown in SEQ ID NO. 84 to SEQ ID NO. 85, or transfecting miR-132b-5p and / or miR-101-2-5p in primary liver cells of chickens.

[0015] Compared with the prior art, the present invention has the following beneficial effects: 1) The present invention obtained eight differentially expressed circRNAs: circACACA, circKMT2E, circAHCTF1, circMAP4K5, circUSP45, circRHEB, circPLXNC1, and circQPRT, all of which are expected to be used as markers for the diagnosis of FLS.

[0016] 2) The present invention constructs a molecular regulatory network of circACACA and finds that circACACA is significantly highly expressed in chicken liver and is mainly located in the cytoplasm. CircACACA plays a biological function as a molecular sponge of miR-132b-5p and miR-101-2-5p. MiR-132b-5p and miR-101-2-5p can promote the balance of lipid metabolism in the liver, enhance the antioxidant stress ability of liver cells, and weaken the activity of cell autophagy. CBFB is a common target downstream gene of miR-132b-5p and miR-101-2-5p. CBFB is similar to circACACA, which can promote the accumulation of lipid droplets in liver cells, weaken the cell's antioxidant stress ability, and induce the occurrence of cell autophagy. CircACACA mediates the CBFB / PIM1 complex through the ceRNA mechanism, thereby regulating the AKT / mTOR and PPAR-γ signaling pathways, and participates in the regulation of fat metabolism in poultry liver and the maintenance of health.

[0017] In summary, the present invention provides new research ideas and directions for further exploring the potential functions of circRNA in diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings: Figure 1 The circRNA sequencing data quality assessment results of the six samples in Example 1 of the present invention are shown in Figure 1, wherein A is the error rate distribution diagram of the six samples; and B is the GC content distribution diagram of the six samples.

[0019] Figure 2 The analysis and identification results of circRNA in Example 1 of the present invention, wherein A is the identification of circRNA in FL and CL; B is a statistical diagram of circRNA sequence length; C is the statistics of circRNA sources for each sample; and D is a circos diagram of the density distribution of circRNA on the chromosome of each sample.

[0020] Figure 3 1 is the differential expression analysis result of circRNA in chicken FL and CL in Example 1 of the present invention, wherein A is a volcano map of differentially expressed circRNA; B is an analysis statistical map of differentially expressed circRNA; and C is a cluster map of differentially expressed circRNA.

[0021] Figure 4 The enrichment analysis results of the differentially expressed circRNA source genes in Example 1 of the present invention, wherein A is the KEGG enrichment analysis of the differentially expressed circRNA source genes; B is the GO enrichment map of the differentially expressed circRNA source genes.

[0022] Figure 5 This is the verification of the circRNA ring structure and stability in Example 2 of the present invention, wherein A is the circRNA source information and Sanger sequencing; B is the amplification result of circRNA and β-actin by N9 and Oligo d (T) primers; C is the expression level of circRNA and β-actin after RNase R treatment. **P < 0.01 indicates extremely significant difference.

[0023] Figure 6 This is the verification result of the expression of 8 circRNAs in Example 2 of the present invention. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0024] Figure 7 This is the tissue expression pattern of circACACA in Example 2 of the present invention. abP<0.05 indicates a significant difference.

[0025] Figure 8 This is the subcellular localization of circACACA in Example 2 of the present invention.

[0026] Fig. 9 The interference and overexpression efficiencies of circACACA in Example 2 of the present invention, wherein A is the interference efficiency of circACACA; B is the overexpression efficiency of circACACA. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0027] Fig.10 The effect of circACACA on fat metabolism in chicken liver cells detected by qPCR in Example 2 of the present invention, wherein (AC) is the expression of fat synthesis-related genes, fat transport-related genes and fatty acid β-oxidation-related genes after qPCR analysis of circACACA interference; (DF) is the expression of fat synthesis-related genes, fat transport-related genes and β-oxidation-related genes after qPCR analysis of circACACA overexpression. *P<0.05 indicates significant difference, **P<0.01 indicates extremely significant difference.

[0028] Fig.11 The Western blot and TC, TG kits in Example 2 of the present invention detect the effect of circACACA on fat metabolism in chicken liver cells, wherein A is Western blot detection of FASN and ACOX1 protein levels after circACACA interference; B is Western blot detection of FASN and ACOX1 protein levels after overexpression of circACACA; C is the detection of TG content in liver cells after interference and overexpression of circACACA; D is the detection of TC content in liver cells after interference and overexpression of circACACA. *P<0.05 indicates significant difference, **P<0.01 indicates extremely significant difference.

[0029] Fig.12 The effect of circACACA on the accumulation of lipid droplets in liver cells detected by BODIPY 493 / 503 staining in Example 2 of the present invention, wherein A is the BODIPY 493 / 503 fluorescence staining image of lipid droplets in liver cells after interference and overexpression of circACACA; B is the statistics of lipid droplet staining area after interference with circACACA; C is the statistics of lipid droplet staining area after overexpression of circACACA. **P<0.01 indicates extremely significant difference.

[0030] Fig.13The qPCR and Western blot analysis of the effect of circACACA on cell anti-oxidative stress in Example 2 of the present invention, wherein A is qPCR analysis of the expression of anti-oxidative stress-related genes after interfering with circACACA; B is qPCR analysis of the expression of anti-oxidative stress-related genes after overexpressing circACACA; C is Western blot detection of the protein expression of SOD and GPX7 after interfering with circACACA; D is Western blot detection of the protein expression of SOD and GPX7 after overexpressing circACACA. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0031] Fig.14 The effect of circACACA on ROS and antioxidant kinase activity in Example 2 of the present invention, wherein A is the effect of circACACA on ROS generation detected by flow cytometry; B is the effect of circACACA on intracellular MAD accumulation; (CE) is the effect of circACACA on intracellular antioxidant kinase activity. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0032] Fig.15 The effects of circACACA on cell autophagy were analyzed by qPCR and Western blot in Example 2 of the present invention, wherein A is qPCR detection of mRNA expression of autophagy-related genes after interference with circACACA; B is qPCR detection of mRNA expression of autophagy-related genes after overexpression of circACACA; C is Western blot analysis of protein levels of autophagy-related genes after interference with circACACA; D is Western blot analysis of protein levels of autophagy-related genes after overexpression of circACACA. *P<0.05 indicates significant difference, **P<0.01 indicates extremely significant difference.

[0033] Fig.16 The effects of circACACA on cell autophagy detected by Mcherry-EGFP-LC3 adenovirus and transmission electron microscopy in Example 2 of the present invention, wherein A is the change in intracellular autophagic flux after Mcherry-EGFP-LC3 adenovirus detection interferes with circACACA; B is the change in intracellular autophagic bodies after overexpression of circACACA observed by transmission electron microscopy.

[0034] Fig.17 This is a distribution diagram of the error rates of miRNA sequencing of 6 samples in Example 3 of the present invention.

[0035] Fig.18 This is a chromosome density distribution diagram of 6 sample reads in Example 3 of the present invention.

[0036] Fig.19 This is the miRNA sequencing data analysis of 6 samples in Example 3 of the present invention, wherein A is the sequence length distribution diagram of the 6 samples; B is the TPM density distribution diagram of the 6 samples; C is the TPM box plot of the 6 samples; and D is the TPM interval distribution of miRNA.

[0037] Fig. 20 3 is the differential expression analysis of miRNA in chicken FL and CL in Example 3 of the present invention, wherein A is the verification of miRNAs in chicken FL and CL; B is the volcano map of differentially expressed miRNA; and C is the cluster map of differentially expressed circRNA.

[0038] Fig.21 The prediction and identification of circACACA target miRNAs in Example 3 of the present invention, wherein A is a Venn diagram of RNAhybrid and circRNA-seq predicting circRNA target miRNAs; B is the expression of potential target miRNAs detected by qPCR after interference with overexpression of circACACA; (C, D) are the expression of miR-132b-5p and miR-101-2-5p detected by qPCR after interference with overexpression of circACACA; E is the expression pattern of miR-132b-5p and miR-101-2-5p in CL and FL in miRNA sequencing; (F, G) are the target relationships of circACACA with miR-132b-5p and miR-101-2-5p detected by FISH. *P<0.05 indicates significant difference, **P<0.01 indicates extremely significant difference.

[0039] Fig. 22 This is the verification of the relationship between circACACA and miRNAs targets in Example 3 of the present invention, where (A, B) are the prediction maps of circACACA binding sites with miR-132b-5p and miR-101-2-5p; (C, D) are the construction of circACACA dual-luciferase reporter vectors; (E, F) are the detection of dual-luciferase activity. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0040] Fig.23The effect of miR-132b-5p on fat metabolism in chicken liver cells detected by qPCR in Example 3 of the present invention, wherein (A, B) are the detection of miR-132b-5p interference overexpression efficiency; (CE) is qPCR analysis of the expression of fat synthesis, transport and decomposition related genes after interfering with miR-132b-5p; (FH) is qPCR analysis of the expression of fat synthesis, transport and decomposition related genes after overexpressing miR-132b-5p. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0041] Fig.24 The Western blot and TC, TG kits in Example 3 of the present invention detect the effect of miR-132b-5p on fat metabolism in chicken liver cells, wherein (A, B) are Western blot detection of FASN and ACOX1 protein levels after interference with miR-132b-5p; (C, D) are Western blot detection of FASN and ACOX1 protein levels after overexpression of miR-132b-5p; E is the detection of TG content in liver cells after interference and overexpression of miR-132b-5p; F is the detection of TC content in liver cells after interference and overexpression of miR-132b-5p. **P<0.01 indicates extremely significant difference.

[0042] Fig.25 The effect of BODIPY 493 / 503 staining on the accumulation of lipid droplets in liver cells detected by miR-132b-5p in Example 3 of the present invention, wherein A is the BODIPY 493 / 503 fluorescence staining image of lipid droplets in liver cells after interference and overexpression of miR-132b-5p; B is the statistics of lipid droplet staining area after interference with miR-132b-5p; C is the statistics of lipid droplet staining area after overexpression of miR-132b-5p. **P<0.01 indicates extremely significant difference.

[0043] Fig.26 The qPCR and Western blot analysis of the effect of miR-132b-5p on cell anti-oxidative stress in Example 3 of the present invention, wherein A is qPCR analysis of the mRNA expression of anti-oxidative stress related genes after interfering with miR-132b-5p; B is Western blot detection of the protein expression of SOD and GPX7 after interfering with miR-132b-5p; C is qPCR analysis of the mRNA expression of anti-oxidative stress related genes after overexpressing miR-132b-5p; D is Western blot detection of the protein expression of SOD and GPX7 after overexpressing miR-132b-5p. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0044] Fig. 27 The effects of miR-132b-5p on ROS and antioxidant kinase activity in Example 3 of the present invention, wherein (A, B) are the effects of miR-132b-5p on ROS generation detected by flow cytometry; C is the effect of miR-132b-5p on intracellular MAD accumulation; (DF) are the effects of miR-132b-5p on intracellular antioxidant kinase activity. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0045] Fig.28 The qPCR and Western blot analysis of the effect of miR-132b-5p on cell autophagy in Example 3 of the present invention, wherein A is qPCR detection of mRNA expression of autophagy-related genes after interfering with miR-132b-5p; B is Western blot analysis of protein levels of autophagy-related genes after interfering with miR-132b-5p; C is qPCR detection of mRNA expression of autophagy-related genes after overexpression of miR-132b-5p; D is Western blot analysis of protein levels of autophagy-related genes after overexpression of miR-132b-5p. *P<0.05 indicates significant difference, **P<0.01 indicates extremely significant difference.

[0046] Fig.29 The effects of miR-132b-5p on cellular autophagy were detected by Mcherry-EGFP-LC3 adenovirus and transmission electron microscopy in Example 3 of the present invention, wherein A is the change in intracellular autophagic flux after Mcherry-EGFP-LC3 adenovirus detection interfered with miR-132b-5p; B is the change in intracellular autophagic bodies after overexpression of miR-132b-5p observed by transmission electron microscopy.

[0047] Fig.30 The effect of miR-101-2-5p on fat metabolism in chicken liver cells detected by qPCR in Example 3 of the present invention, wherein (A, B) are the detection of the efficiency of miR-101-2-5p interference overexpression; (CE) is the qPCR analysis of the expression of genes related to fat synthesis, transport and decomposition after interfering with miR-101-2-5p; (FH) is the qPCR analysis of the expression of genes related to fat synthesis, transport and decomposition after overexpressing miR-101-2-5p. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0048] Fig.31The Western blot and TC, TG kits in Example 3 of the present invention detect the effect of miR-101-2-5p on fat metabolism in chicken liver cells, wherein (A, B) are Western blot detection of FASN and ACOX1 protein levels after interference with miR-101-2-5p; (C, D) are Western blot detection of FASN and ACOX1 protein levels after overexpression of miR-101-2-5p; E is the detection of TG content in liver cells after interference and overexpression of miR-101-2-5p; F is the detection of TC content in liver cells after interference and overexpression of miR-101-2-5p. **P<0.01 indicates extremely significant difference.

[0049] Fig.32 The effect of BODIPY 493 / 503 staining on the accumulation of lipid droplets in liver cells by detecting miR-101-2-5p in Example 3 of the present invention, wherein A is the BODIPY 493 / 503 fluorescence staining image of lipid droplets in liver cells after interference and overexpression of miR-101-2-5p; B is the statistics of lipid droplet staining area after interference with miR-101-2-5p; C is the statistics of lipid droplet staining area after overexpression of miR-101-2-5p. **P<0.01 indicates extremely significant difference.

[0050] Fig.33 The qPCR and Western blot analysis of the effect of miR-101-2-5p on cell anti-oxidative stress in Example 3 of the present invention, wherein A is qPCR analysis of the mRNA expression of anti-oxidative stress related genes after interfering with miR-101-2-5p; B is Western blot detection of the protein expression of SOD and GPX7 after interfering with miR-101-2-5p; C is qPCR analysis of the mRNA expression of anti-oxidative stress related genes after overexpressing miR-101-2-5p; D is Western blot detection of the protein expression of SOD and GPX7 after overexpressing miR-101-2-5p. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0051] Fig.34 The effects of miR-101-2-5p on ROS and antioxidant kinase activity in Example 3 of the present invention, wherein (A, B) are the effects of miR-101-2-5p on ROS generation detected by flow cytometry; C is the effect of miR-101-2-5p on intracellular MAD accumulation; (DF) are the effects of miR-101-2-5p on intracellular antioxidant kinase activity. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0052] Fig.35 The qPCR and Western blot analysis of the effect of miR-101-2-5p on cell autophagy in Example 3 of the present invention, wherein A is qPCR detection of mRNA expression of autophagy-related genes after interfering with miR-101-2-5p; B is Western blot analysis of protein levels of autophagy-related genes after interfering with miR-101-2-5p; C is qPCR detection of mRNA expression of autophagy-related genes after overexpression of miR-101-2-5p; D is Western blot analysis of protein levels of autophagy-related genes after overexpression of miR-101-2-5p. *P<0.05 indicates significant difference, **P<0.01 indicates extremely significant difference.

[0053] Fig.36 The effects of miR-101-2-5p on cellular autophagy were detected by Mcherry-EGFP-LC3 adenovirus and transmission electron microscopy in Example 3 of the present invention, wherein A is the change in intracellular autophagic flux after Mcherry-EGFP-LC3 adenovirus detection interfered with miR-101-2-5p; B is the change in intracellular autophagic bodies after overexpression of miR-101-2-5p observed by transmission electron microscopy.

[0054] Fig.37 The prediction and identification of the target genes of miR-132b-5p and miR-101-2-5p in Example 3 of the present invention, wherein A is a Venn diagram of the target genes of miR-132b-5p and miR-101-2-5p predicted by different software; B is the binding site of miR-132b-5p and miR-101-2-5p and CBFB predicted by RNAhybrid; (C, D) are qPCR detections of the effects of miR-132b-5p and miR-101-2-5p on CBFB mRNA; (E, F) are the constructions of CBFB-WT and CBFB-MT dual fluorescence reporter vectors; (G, H) are the detections of dual luciferase activity. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0055] Fig.38 The effect of CBFB on fat metabolism in chicken liver cells detected by qPCR in Example 3 of the present invention, wherein (A, B) is the detection of CBFB interference overexpression efficiency; (CE) is qPCR analysis of the expression of genes related to fat synthesis, transport and decomposition after interference with CBFB; (FH) is qPCR analysis of the expression of genes related to fat synthesis, transport and decomposition after overexpression of CBFB. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0056] Fig.39The Western blot and TC, TG kits in Example 3 of the present invention detect the effect of CBFB on fat metabolism in chicken liver cells, wherein A is Western blot detection of FASN and ACOX1 protein levels after interference with CBFB; B is Western blot detection of FASN and ACOX1 protein levels after overexpression of CBFB; C is detection of intracellular TG content after interference and overexpression of CBFB; D is detection of intracellular TC content after interference and overexpression of CBFB. **P<0.01 indicates extremely significant difference.

[0057] Fig.40 The effect of CBFB on the accumulation of lipid droplets in liver cells detected by BODIPY 493 / 503 staining in Example 3 of the present invention, wherein A is the BODIPY 493 / 503 fluorescence staining image of lipid droplets in liver cells after interference and overexpression of CBFB; B is the statistics of lipid droplet staining area after interference with CBFB; C is the statistics of lipid droplet staining area after overexpression of CBFB. **P<0.01 indicates extremely significant difference.

[0058] Fig.41 The effect of CBFB on the anti-oxidative stress of liver cells in Example 3 of the present invention, wherein A is qPCR analysis of the mRNA expression of anti-oxidative stress related genes after interfering with CBFB; B is qPCR analysis of the mRNA expression of anti-oxidative stress related genes after overexpressing CBFB; C is Western blot detection of the protein expression of SOD and GPX7 after interfering with CBFB; D is Western blot detection of the protein expression of SOD and GPX7 after overexpressing CBFB. (E, F) are flow cytometry detection of the effect of CBFB on the production of intracellular ROS; *P < 0.05 indicates a significant difference, **P < 0.01 indicates an extremely significant difference.

[0059] Fig.42 The qPCR and Western blot analysis of the effect of CBFB on cell autophagy in Example 3 of the present invention, wherein A is qPCR detection of mRNA expression of autophagy-related genes after interference with CBFB; B is qPCR detection of mRNA expression of autophagy-related genes after overexpression of CBFB; C is Western blot analysis of protein levels of autophagy-related genes after interference with CBFB; D is Western blot analysis of protein levels of autophagy-related genes after overexpression of CBFB. *P<0.05 indicates significant difference, **P<0.01 indicates extremely significant difference.

[0060] Fig.43The effects of Mcherry-EGFP-LC3 adenovirus and transmission electron microscopy on cellular autophagy in Example 3 of the present invention are detected, wherein A is the change in intracellular autophagic flux after Mcherry-EGFP-LC3 adenovirus detection interferes with CBFB; B is the change in intracellular autophagic bodies after overexpression of CBFB observed by transmission electron microscopy.

[0061] Fig.44 The CBFB in Example 3 of the present invention regulates the AKT / mTOR and PPAR-γ signaling pathways, wherein (A, B) are Western blots to detect the expression of key proteins in the AKT / mTOR signaling pathway and the PPAR-γ signaling pathway after interfering with CBFB; (C, D) are Western blots to detect the expression of key proteins in the AKT / mTOR signaling pathway and the PPAR-γ signaling pathway after overexpressing CBFB. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0062] Fig.45 The verification of the interaction between CBFB and PIM1 in Example 3 of the present invention, wherein A is qPCR detection of PIM1 mRNA expression after interference with overexpression of CBFB; (B, C) are Western blot detection of PIM1 protein expression after interference with overexpression of CBFB; D is immunoprecipitation test to verify the binding relationship between CBFB and PIM1. *P<0.05 indicates significant difference, **P<0.01 indicates extremely significant difference.

[0063] Fig.46 The PIM1 in Example 3 of the present invention regulates the AKT / mTOR and PPAR-γ signaling pathways, wherein A is the Western blot detection of the expression of key proteins in the AKT / mTOR signaling pathway and the PPAR-γ signaling pathway after interfering with PIM1; B is the statistics of the grayscale values ​​of key protein bands in the AKT / mTOR signaling pathway and the PPAR-γ signaling pathway after interfering with PIM1. *P<0.05 indicates a significant difference, and **P<0.01 indicates an extremely significant difference.

[0064] Fig.47 This is a co-transfection experiment in Example 3 of the present invention to verify that the CBFB and PIM1 complex participates in the AKT / mTOR and PPAR-γ signaling pathways, wherein A is a Western blot test of the expression of fat metabolism, anti-oxidative stress and cell autophagy related proteins and key proteins of the AKT / mTOR and PPAR-γ signaling pathways after co-transfection of si-CBFB and si-PIM1; (B, C) are statistics of the grayscale values ​​of each protein band after co-transfection. *P < 0.05 indicates a significant difference, and **P < 0.01 indicates an extremely significant difference.

[0065] Fig.48 CircACACA in Example 3 of the present invention regulates the AKT / mTOR and PPAR-γ signaling pathways by targeting miR-132b-5p, wherein A is Western blot detection of the expression of fat metabolism, anti-oxidative stress and cell autophagy related proteins and key proteins of the AKT / mTOR and PPAR-γ signaling pathways after co-transfection of ov-circACACA and miR-132b-5p mimics; (B, C) are statistics of the grayscale values ​​of each protein band after co-transfection. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0066] Fig.49 CircACACA in Example 3 of the present invention regulates the AKT / mTOR and PPAR-γ signaling pathways by targeting miR-101-2-5p, wherein A is Western blot detection of the expression of fat metabolism, anti-oxidative stress and cell autophagy related proteins and key proteins of the AKT / mTOR and PPAR-γ signaling pathways after co-transfection of ov-circACACA and miR-101-2-5p mimics; (B, C) are statistics of the grayscale values ​​of each protein band after co-transfection. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference.

[0067] Fig.50 The circACACA in Example 3 of the present invention regulates the AKT / mTOR and PPAR-γ signaling pathways by mediating CBFB, wherein A is Western blot detection of the expression of fat metabolism, anti-oxidative stress and cell autophagy related proteins and key proteins of the AKT / mTOR and PPAR-γ signaling pathways after co-transfection of ov-circACACA and si-CBFB; (B, C) are statistics of the grayscale values ​​of each protein band after co-transfection. *P<0.05 indicates a significant difference, **P<0.01 indicates an extremely significant difference. DETAILED DESCRIPTION

[0068] In the description of the present invention, it should be noted that, if the specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.

[0069] This study used the nationally approved Tianfu broiler chicken as a research model, and screened out a significantly differentially expressed circRNA, circACACA, by sequencing and analyzing the livers of FLS-affected chickens and normal chickens. Subsequently, using primary chicken liver cells cultured in vitro, the specific functions and molecular regulatory mechanisms of circACACA in chicken liver fat metabolism and pathological processes were systematically explored.

[0070] In addition, it should be noted that "U" or "u" in all RNA sequences in the embodiments of the present invention is represented by "w" in the sequence listing.

[0071] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0072] Embodiment 1:

[0073] This example verifies FLS and sequences circRNA in fatty liver and normal liver, as follows: (1) Experimental animals The "Tianfu Broiler" supporting system was approved by the National Animal Genetic Resources Committee in September 2018. It utilizes the genetic resources of local chicken breeds in my country. The present invention selects Tianfu broiler parent-generation breeder chickens as research objects to explore the pathogenesis of chicken FLS.

[0074] In this study, 300 200-day-old Tianfu broiler parent-generation breeder chickens with consistent egg-laying conditions and similar basic body weight were selected for the experiment. All the experimental chickens came from and were raised at the Poultry Breeding Experimental Farm of Sichuan Agricultural University in Ya'an City, Sichuan Province. The feeding management and immunization and health care procedures were implemented in accordance with the "Tianfu Broiler" Supporting Parent-Generation Breeder Feeding and Management Manual, with 15 hours of light per day, automatic drinking water, and automatic feces cleaning.

[0075] In this experiment, 300 experimental chickens were randomly divided into two groups, namely the fatty liver group (experimental group) and the normal liver group (control group). The control group was given a basic diet of 125 g / chicken at the time of light on (5 o'clock) every day to meet the energy requirements of body growth and reproductive capacity, while the experimental group chickens were allowed to eat freely. After 300 days of age, some experimental chickens were selected and anesthetized by intravenous injection of water and chloral (50 mg / kg), and then other samples such as tissues and serum were collected. All animal experiments in this study were approved by the Experimental Animal Ethics Committee of Sichuan Agricultural University and strictly followed the relevant provisions of the national animal welfare ethics and animal protection principles.

[0076] (2) Test methods (2-1) Sample collection After reaching 300 days of age, 10 chickens were selected from each test group, and 15 mL of blood was collected using a blood collection tube without anticoagulant. After standing for 15 minutes, the blood was centrifuged at 3500 r / min for 10 minutes to separate the serum. The serum samples were frozen and stored at -20°C for testing.

[0077] Subsequently, the chickens were anesthetized with water and chloral and then killed. The abdominal cavity was opened aseptically, and part of the liver tissue was quickly collected, immediately frozen with liquid nitrogen and stored in a -80°C ultra-low temperature refrigerator to extract total RNA for circRNA sequencing. Part of the liver tissue was collected and fixed in 4% paraformaldehyde for Oil Red O staining of tissue sections, hematoxylin and eosin (HE) staining, and immunohistochemistry of LC3.

[0078] (2-2) Serum index determination The TG and TC levels in serum were determined using the kit from Nanjing Jiancheng Bioengineering Institute. The antioxidant kit from Nanjing Jiancheng Bioengineering Institute was also used to detect the content or activity of GSH, GSH-Px and T-AOC. The reagent preparation and operation steps were carried out according to the instructions.

[0079] (2-3) HE staining, Oil Red O staining and LC3 immunofluorescence Three normal liver and three fatty liver chickens were selected, and part of the liver tissue was removed. The surrounding blood was removed with phosphate buffered saline (PBS). Subsequently, the tissue was immersed in 4% paraformaldehyde for fixation. Next, the fixed liver tissue was embedded in paraffin and cut into thin slices. The slices were dewaxed in xylene and then dehydrated in 100%, 95%, 80% and 70% ethanol in sequence. Then, the slices were washed in distilled water for 5 minutes and immersed in hematoxylin staining solution, eosin staining solution and oil red O staining solution for staining. After staining, they were dehydrated again in 70%, 80%, 95% and 100% ethanol. Finally, the slices were placed in xylene for transparency. After the slices were taken out, neutral gum mounting medium was added and covered with a coverslip. After the mounting medium was dried, the tissue slices were observed under a microscope.

[0080] For immunofluorescence staining of LC3, the processing steps are similar to HE staining and Oil Red O staining. First, the tissue samples are fixed, sliced, dewaxed, dehydrated, and washed. Next, the sections are placed in EDTA antigen retrieval buffer and heated to 90-95°C in a microwave oven for 15 minutes to expose the antigen sites. Then, the sections are blocked with 5% bovine serum albumin (BSA) at room temperature for 30 minutes to reduce nonspecific binding. Next, the sections are immersed in a dilution containing a specific LC3 antibody and incubated overnight at 4°C. The dilution of the fluorescently labeled secondary antibody is incubated in the sections for 1 hour at room temperature. Finally, the sections are sealed and observed under a microscope.

[0081] (2-4) Construction, sequencing and analysis of circRNA transcriptome RNA extraction from chicken fatty liver and normal liver tissues was completed using commercially available kits, and circRNA-seq of chicken fatty liver and normal liver was completed by Beijing Novotech Co., Ltd. This process is a conventional method in the field and will not be analyzed in detail here.

[0082] (2-4-1) RNA extraction from tissue samples First, chicken fatty liver and normal liver tissue samples were ground into powder using liquid nitrogen, and a small amount of powder was taken for RNA extraction. Each sample was lysed by adding 1ml RNAiso Plus, followed by adding 200µl chloroform, mixing and standing at 4°C for 10 minutes. Next, centrifuge at 12000rpm for 15 minutes and collect the supernatant. Then, add 700µl pre-cooled isopropanol, mix and stand for 10 minutes, centrifuge at 12000rpm for 10 minutes, and discard the supernatant. Then add 75% ethanol, vortex until a large amount of precipitate is seen suspended, centrifuge at 12000rpm for 5 minutes, and discard the supernatant. Finally, the EP tube was inverted on the filter paper for 3-5 minutes, and the precipitate was diluted with DEPC water after drying. After that, the sample RNA integrity and the presence of DNA contamination were analyzed by agarose gel electrophoresis; the RNA purity, concentration and integrity were further evaluated by Nanodrop and Agilent 2100 bioanalyzer. The qualified RNA samples were stored in a -80℃ ultra-low temperature freezer for future use.

[0083] (2-4-2) Library construction and sequencing CircRNA-seq of chicken fatty liver and normal liver was completed by Beijing Novotech Co., Ltd. The strand-specific circRNA library was constructed by removing ribosomal RNA. First, ribosomal RNA was removed from total RNA using the Epicentre Ribo-ZeroTM kit, and RNA was then fragmented into short fragments of 250-300 bp by RNase R. The fragmented RNA was used as a template and random oligonucleotides were used as primers to synthesize the first strand of cDNA. The RNA strands were then depolymerized by RNase H, and the second strand of cDNA was synthesized using dNTPs (dUTP, dATP, dGTP, and dCTP) as raw materials. AMPure XP beads were used to purify cDNA. The purified double-stranded cDNA was end-repaired, A-tailed, and connected to sequencing adapters. AMPure XP beads were used to screen cDNA of about 350-400 bp. The second strand of cDNA containing U was degraded using USER enzyme, and finally PCR amplification was performed to obtain the library. The library was checked using Qubit and Agilent 2100 bioanalyzer. After the library inspection is qualified, Illumina PE150 sequencing is performed to obtain the raw sequencing sequence (Raw data) information of the fragment to be sequenced.

[0084] (2-4-3) Analysis The quality of the raw data was evaluated by statistically analyzing the sequencing error rate, data volume, alignment rate and other data. If the standard was met, the information of circRNA was analyzed. The specific analysis process is as follows: First, the raw data was filtered to remove reads with sequencing adapters or low sequencing quality. The sequencing error rate and GC content distribution were checked to obtain clean reads. The clean reads obtained by sequencing were aligned to the reference genome (gallus_gallus_Ensembl_97 reference genome (ftp: / / ftp.ensembl.org / pub / release97 / fasta / gallus_gallus / dna / ) using Hisat2 (http: / / ccb.jhu.edu / software / hisat2) software. CircRNA was identified by joint analysis using find_circ and CIRI software. The length distribution of circRNA was statistically analyzed, its source and chromosome distribution were analyzed, and the expression of known and new circRNA in each sample was normalized using TPM. The formula is as follows, where libsize represents the sum of sample circRNA readcounts.

[0085] TPM=(read count*1,000,000) / libsize The differential expression analysis of the two groups of samples was performed using DESeq based on negative binomial distribution. The overall distribution of differential circRNAs was evaluated by volcano plots, and differential circRNAs were screened out based on the corrected significance level (padj < 0.05) and the difference multiple. After obtaining the differentially expressed circRNAs between the two groups, the source gene set of each group of differentially expressed circRNAs was enriched in Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) according to the correspondence between circRNAs and their source genes. Finally, the binding sites of sheared circRNAs and miRNAs were analyzed and predicted using miRanda software.

[0086] (2-5) Data analysis SPSS 19.0 software was used for significant difference test. The differences between the two groups were compared by Student's t test, and the differences between multiple groups were analyzed by one-way ANOVA. The significance level was set at P < 0.05, indicating a significant difference, represented by *; P < 0.01 was an extremely significant difference, represented by **; different letters (a, b, c) P < 0.05 indicated significant differences between different treatment groups. All data are expressed as mean ± standard error of the mean (SEM).

[0087] (3) Results and analysis (3-1) Validation of the chicken fatty liver model (3-1-1) Comparison of histomorphology between chicken fatty liver (FL) and normal liver (CL) The comparison of liver tissue morphology showed that the liver of the experimental group was significantly larger in size, lighter in color, yellower, greasy to the touch, soft and fragile, with bleeding spots on the surface and blunt edges ( Figure 1 Oil Red O staining can dye lipid droplets in tissue red and is often used to evaluate the accumulation of fat in liver tissue samples. The results of this experiment showed that a large number of red-stained areas appeared in the livers of the experimental group of chickens, indicating that lipid droplets accumulated in large numbers in the liver cells of the chickens ( Figure 1 In this study, HE staining was used to observe the basic structure and pathological characteristics of the liver tissues of the two groups of chickens. The results showed that the liver cells of the chickens in the treatment group were filled with white fat, their volume increased significantly, the cell nuclei were squeezed to one side by the fat, and a large number of inflammatory cells infiltrated ( Figure 1 Middle C).

[0088] (3-1-2) Comparison of serum parameters between chicken FL and CL The TG and TC levels in the serum of the two groups of chickens were detected by biochemical kits. The results showed that the TG level in the serum of the experimental group was significantly higher than that in the control group (P<0.05), and the TC content was extremely significantly higher than that in the control group ( Figure 2 The activities of serum enzymes related to anti-oxidative stress were further evaluated. The results showed that the activities of GSH (P<0.01), GSH-Px (P<0.05) and T-AOC (P<0.01) in the serum of chickens in the treatment group were significantly lower than those in the control group ( Figure 2 The above results are consistent with the pathological characteristics of chicken FLS, so we preliminarily determined that the chicken FLS model was successfully established.

[0089] (3-1-3) Comparison of LC3 immunofluorescence in chicken FL and CL To further confirm the successful construction of the chicken FLS model, we collected liver tissues from two groups of chickens and fixed, embedded and sliced ​​them. Subsequently, fluorescent staining was performed using an antibody against the autophagy marker protein LC3. The results showed that the LC3 fluorescent staining area in CL was low, while in the liver of the treated group, the fluorescent staining intensity was significantly higher than that of the normal group ( Figure 3 ; P<0.01). These results further indicate that chickens with FLS disease were successfully obtained in this experiment, providing a solid foundation for subsequent sequencing verification.

[0090] (3-21) CircRNA sequencing of chicken FL and CL (3-21-1) Data quality assessment of circRNA sequencing Based on the above experimental results, we selected 3 FL samples and 3 CL tissue samples for circRNA transcriptome sequencing. The original sequencing data of the 6 samples have been deposited in the SRA database with the accession number PRJNA960781. The data quality summary of each sample is shown in Table 1. A total of 349,335,704 original reads were obtained for all samples. After filtering and removing reads with adapters and reads with N ratios greater than 0.002, 344,469,760 clean reads were obtained, and a total of 51.67G cleanbases were used for subsequent data analysis. In addition, the error rate of the 6 samples was 0.03%, and its distribution is as follows Fig.41 A. The Q20 of the samples was higher than 97.23%, and the Q30 was greater than 92.55%. The GC content of each sample was between 64.54% and 65.82%. The content distribution is as follows Fig.41 As shown in B. The above results indicate that the sequencing data is of good quality and can be used for subsequent analysis.

[0091] Table 1 Data quality assessment of circRNA sequencing in chicken FL and CL

[0092] (3-1-2) circRNA analysis and identification by circRNA sequencing Furthermore, clean reads were aligned to the genome using Hisat2, and circRNAs were identified using find_circ and CIRI software. A total of 3979 circRNAs were identified in the six samples, of which 3187 were found in FL samples, 2924 in CL samples, and 2132 were expressed in both FL and CL samples ( Figure 2 The length of these circRNAs is generally less than 1000 bp, mainly concentrated in 300~400 bp ( Figure 2 In B), most circRNAs are derived from exon splicing, and only a few circRNAs are composed of introns and intergenic regions ( Figure 2 The circos graph was used to count the distribution density of circRNA on each chromosome in each sample. The results showed that circRNA was randomly distributed on each chromosome ( Figure 2 Middle D).

[0093] (3-2) Analysis of circRNA sequencing data of chicken FL and CL (3-2-1) Differential expression analysis of circRNAs in chicken FL and CL The differential expression of circRNAs in the two groups of samples was analyzed using DESeq2 based on negative binomial distribution. The results showed that among the 2132 co-expressed circRNAs, 77 were differentially expressed in FL and CL samples. Compared with the control group, 46 circRNAs were upregulated and 31 circRNAs were downregulated ( Figure 3 A, B), detailed information of differentially expressed circRNAs is listed in the appendix. The hierarchical clustering diagram of 77 differentially expressed circRNAs intuitively shows the significant differences between the two groups of samples ( Figure 3 (C) further verified the reliability and usability of the samples and sequencing data.

[0094] (3-2-2) Enrichment analysis of differentially expressed circRNA source genes After obtaining the differentially expressed circRNAs between the two groups, KEGG and GO enrichment analysis was performed on the source genes of these differentially expressed circRNAs according to the corresponding relationship between circRNAs and their source genes. The results of KEGG enrichment analysis showed that the source genes of differentially expressed circRNAs were enriched in 50 signal transduction pathways, and the 20 most significantly enriched pathways were selected to draw scatter plots for analysis, such as Figure 4 As shown in A, the parent genes of differentially expressed circRNAs are significantly enriched in insulin signaling pathway, mTOR signaling pathway, fatty acid biosynthesis and TGF-beta signaling pathways.

[0095] GO enrichment analysis results showed that the parent genes of differentially expressed circRNAs were significantly enriched in three main categories: biological process (BP), cellular component (CC) and molecular function (MF). In the BP category, they were mainly enriched in metabolic process; in the CC category, they were mainly enriched in cell part and intracellular; in the MF category, they were mainly enriched in catalytic activity, enzyme binding and transferase activity ( Figure 4 B). GO enrichment results showed that the parent genes of these differentially expressed circRNAs were mainly involved in biological functions such as metabolic processes, cellular components and catalytic activity. These results provide valuable clues for further exploring the role of circRNAs in poultry liver metabolic diseases, indicating that circRNAs may participate in chicken liver fat metabolism and its growth and development through these key biological processes and signaling pathways.

[0096] Through the above analysis, this example believes that the first eight differentially expressed circRNAs: circACACA, circKMT2E, circAHCTF1, circMAP4K5, circUSP45, circRHEB, circPLXNC1, and circQPRT are all expected to be used as markers for FLS diagnosis, among which circACACA has been reported to be closely related to the occurrence and development of various malignant tumors and energy metabolism. Therefore, the present invention further focuses on whether there is a correlation between circACACA and FLS, aiming to discover its new application direction.

[0097] Embodiment 2: This example conducts the identification and functional verification of circACACA, as follows: (1) Experimental animals and experimental reagents In this experiment, 30 200-day-old Tianfu broilers with normal egg-laying were selected from the poultry breeding farm of Sichuan Agricultural University to collect primary liver cells. The animal experiment was approved by the Animal Ethics Committee of Sichuan Agricultural University with approval number: 2021102006.

[0098] The main test kits include: PrimeScriptTM RT reagent Kit With gDNA Eraser reverse transcription kit (Dalian TaKaRa, catalog number RR047A), One Step TB Green® PrimeScript™ RT-PCR Kit II (Dalian TaKaRa, RR086A), Western and IP cell lysis buffer kits (Beijing Solebao, catalog number R0100), BCA protein quantification kit (China Beibo Biotechnology, catalog number BB-3401), ultra-sensitive ECL chemiluminescence kit (Shanghai Biyuntian, catalog number P0018AS), ELISA kit (Shanghai Newgeorge, catalog number NG-EH671, NG-EH250, NG-EH481 and NG-EH368), Omni-Easy™ one-step PAGE gel rapid preparation kit (China Yazyme Biotechnology, catalog number PG212), and endotoxin-free plasmid extraction kit (USA Omega, catalog number D6948-01).

[0099] The main antibodies include: anti-β-Tubulin (Chengdu Positive Energy, Catalog No. 200608), anti-GAPDH (Chengdu Positive Energy, Catalog No. 390035), anti-ACOX1 (Wuhan Abotek, Catalog No. A8091), anti-FASN (Wuhan Sanying Biotechnology, Catalog No. 10624-2-AP), anti-SOD (Wuhan Sanying Biotechnology, Catalog No. 10269-1-AP), anti-GPX7 (Wuhan Abotek, Catalog No. A3902), anti-LC3 Ⅰ / Ⅱ (Cell Signaling Technology, USA, Catalog No. 12741), anti-P62 (Cell Signaling Technology, USA, Catalog No. 39749), anti-Beclin1 (Wuhan Abotek, Catalog No. A11761), anti-Mouse IgG H&L (HRP (Chengdu Positive Energy, Catalog No. 511103), anti-Rabbit IgG H&L (HRP (Chengdu Zhengneng, item number 511203).

[0100] (2) Test methods (2-1) siRNA design and vector construction According to the full-length sequence of circACACA, two specific siRNAs spanning the splicing site were designed and synthesized. The detailed sequence information is shown in Table 2. The design and synthesis of the siRNA were completed by Shanghai Jima Biotechnology Co., Ltd. At the same time, the complete linear sequence of circACACA was inserted into the pCD25-ciR vector to construct a stable overexpression plasmid of circACACA. The pcD25-ciR vector was purchased from Guangzhou Jisai Biotechnology Co., Ltd., and the synthesis of the overexpression vector was completed by Beijing Qingke Biotechnology Co., Ltd.

[0101] Table 2 siRNA sequences of circACACA

[0102] (2-2) Isolation, culture and transfection of primary chicken liver cells Tianfu broilers with light weight and continuous egg laying were selected for the isolation of primary liver cells. The specific steps are as follows: 1) The chickens were fasted for 12 hours before sampling. When sampling, the chickens were fixed on the operating table and chloral hydrate (50 mg / kg) was slowly injected through the wing vein according to the weight of the chickens to anesthetize them. After anesthesia, heparin sodium (175 U / kg) was immediately injected through the wing vein to prevent blood coagulation and ensure the smooth progress of the subsequent flushing steps.

[0103] 2) After the chicken's limbs become limp and its eyes are closed, disinfect the chicken with alcohol. Then, open the chicken's abdominal cavity under sterile conditions and remove the entire liver. Wash the blood and other impurities on the surface of the liver with room temperature PBS buffer, soak the entire liver in PBS, and then transfer it to a sterile cell culture room for subsequent operations.

[0104] 3) Use a 50 mL sterile syringe to draw calcium-free HEPES perfusion solution (pH 7.5) and slowly and continuously flush the liver. Then, continue to flush the liver with calcium-containing HEPES wash solution (pH 7.5) until its color changes from dark red to yellow-brown.

[0105] 4) Transfer the rinsed liver to the clean bench, cut off some liver tissue that is more fully perfused, and remove the surface capsule, internal blood vessels and other connective tissues. Then, use ophthalmic scissors to cut the liver tissue into particles of about 1mm³, centrifuge at 2000 rpm for 5 minutes, and remove excess liquid and yellow fat.

[0106] 5) Add three times the volume of type II collagenase and pancreatin mixture (ratio 2:1) and digest for 15 to 20 minutes. Then, add an equal amount of culture medium to terminate the digestion. After blowing evenly, let it stand for 3 minutes, take the supernatant and filter it through 40um and 70um filter sieves respectively, collect the filtered liquid, centrifuge at 2000 rpm for 5 minutes, and collect the cell pellet.

[0107] 6) Add three times the volume of red blood cell lysis buffer, blow evenly and let stand for 10 minutes to completely lyse the red blood cells. Then, wash with PBS and repeat several times until the supernatant becomes clear and transparent.

[0108] 7) Resuspend the cells in M199 medium containing 1% penicillin-streptomycin and 10% fetal bovine serum, plate them according to the experimental requirements, and culture them in an incubator with 5% CO2 and a humidified environment at 37°C. After 24 hours of culture, replace with fresh medium.

[0109] 8) When the cell confluence reaches 80%, perform cell transfection. 1-3h before transfection, replace with M199 medium without penicillin-streptomycin. First, incubate the corresponding siRNA and overexpression vector with Opti-MEM® medium to form liquid A; then, mix Opti-MEM® medium and Lipofectamine® 3000 reagent to make liquid B. Mix liquid A and liquid B, incubate at room temperature for 15 minutes, and then transfer to the cells. According to the experimental requirements, collect cell samples at different time points after transfection for corresponding experiments.

[0110] (2-3) RNA extraction and cRNA synthesis Place tissue or cell samples into a centrifuge tube containing RNAiso plus reagent. For tissue samples, use liquid nitrogen to quickly freeze and grind into powder; for cell samples, add the cell suspension directly to RNAiso plus for lysis. The specific steps are as follows: 1) Add 200ul chloroform to 1ml lysate, shake vigorously for 30s, let stand at 4℃ for 10min, wait for stratification and clarification, and centrifuge at 12000rpm for 15min.

[0111] 2) Carefully aspirate the upper layer of liquid, add 200ul of chloroform again, and repeat step (1).

[0112] 3) Pipette 400-500ul of the upper layer liquid, add 600ul of pre-cooled isopropanol, shake for 30s, let stand at 4℃ for 10min, and centrifuge at 12000rpm for 10min.

[0113] 4) Pour off the supernatant, add 1 ml of 75% ethanol (diluted with RNase-free water), vortex and centrifuge at 12,000 rpm for 5 minutes.

[0114] 5) Discard the supernatant and repeat step (4).

[0115] 6) Pour off the supernatant and air dry the pellet for 5-10 minutes to avoid over-drying. Dissolve the dried RNA pellet in an appropriate amount of RNase-free water (usually 20-50 µL).

[0116] 7) Use Nanodrop 2000 spectrophotometer to detect the absorbance of RNA at different wavelengths to evaluate the purity and concentration of the extracted RNA.

[0117] Use PrimeScriptTM RT reagent Kit With gDNA Eraser to reverse transcribe qualified RNA into cDNA. The detailed steps are as follows: 1) Prepare the genomic DNA removal reaction mixture (Table 3) according to the kit instructions, and perform the reaction on a PCR instrument according to the program of 42℃ for 2 minutes and 12℃ storage.

[0118] Table 3 Reverse transcription reaction system 1

[0119] 2) After the first step of the reaction is completed, refer to the instructions and prepare the reaction mixture according to the corresponding proportions and order (Table 4). Add this mixture to the product after the first step of the reaction and perform the following reaction on the PCR instrument: 37℃ for 15min, 85℃ for 5s, and then store at 12℃.

[0120] Table 4 Reverse transcription reaction system 2

[0121] (2-4) Fluorescence quantitative PCR (qPCR) All primers in this chapter were designed by Premier 5 software and synthesized by Beijing Qingke Biotechnology Co., Ltd. The detailed sequence information of the primers is shown in Table 5. The reaction system of qPCR is: 1ul template cDNA, 0.5ul forward primer, 0.5ul reverse primer, 5ul TB Green Premix Ex Taq II, and then diluted to a total of 10ul with RNase-free water. The qPCR reaction conditions are as follows: 95℃ for 5min, 95℃ for 10s, select the appropriate annealing temperature according to the primer for 20s, 72℃ for 20s, and perform 40 cycles. β-actin is used as the internal reference gene.

[0122] Table 5 qPCR primer sequences

[0123]

[0124] (2-5) Identification of circRNA The cDNA mixed sample of chicken liver cells was used as a template and PCR amplification was performed using the circRNA primers in Section (2-4). The amplification procedure was as follows: first react at 95°C for 10 minutes, then react at 95°C for 30 seconds, react according to the annealing temperature of the primers for 30 seconds, then react at 72°C for 30 seconds, and cycle 36 times. Finally, react at 72°C for 10 minutes and store at 4°C. The amplified product was then sequenced by Sanger sequencing, and the sequencing results were aligned using BioEdit Sequence Alignment Editor. The RNA of chicken liver cells was also used for RNase R digestion experiments. 1 μg of RNA was taken for RNase R digestion treatment, and 1 μg of RNA was taken for control treatment using RNase-free water. The treated RNA was reverse transcribed into cDNA and used as a template for qPCR fluorescence quantitative analysis using the circRNA primers in Section (2-4). In addition, 1 μg of RNA mixed sample of liver cells was reverse transcribed using random primer N9, and another 1 μg of RNA was reverse transcribed using Oligo d(T) primer, and the expression levels of circRNA and β-actin were quantitatively analyzed by qPCR fluorescence.

[0125] (2-6) Fluorescence in situ hybridization (FISH) First, based on the full-length sequence of circACACA, a FISH probe spanning the splicing site was designed and synthesized by Beijing Qingke Biotechnology Co., Ltd. The detailed sequence information is shown in Table 6. Subsequently, the FISH experiment was performed, and the operation steps were as follows: 1) Cell collection and fixation: Collect adherent liver cells, discard the culture medium, wash the cells with PBS, and then fix them with 4% paraformaldehyde for 15 minutes.

[0126] 2) Permeabilization: Treat the fixed cell samples with RNase A and proteinase K to permeabilize the cell membrane and ensure that the probe can enter the cell smoothly.

[0127] 3) Probe preparation: Use sterilized DEPC water to dilute the probe and prepare the probe mixture.

[0128] 4) Hybridization incubation: Add the probe mixture to the cell sample, making sure the probe evenly covers the sample area. Then incubate at 37°C overnight.

[0129] 5) Nuclear staining: Discard the probe mixture, wash the sample, and add DAPI working solution for staining for 10 minutes.

[0130] 6) Fluorescence microscopy: Observe the fluorescence signal in the sample using a fluorescence microscope, capture images, and use image analysis software to record the location and intensity of the probe signal.

[0131] Table 6 FISH probe sequences of circACACA

[0132] (2-7) Western blot First, primary chicken liver cells were inoculated into 6-well plates for cell transfection, and proteins were collected 48 hours later for Western blot experiments. This process is a routine operation in the art and will not be described in detail here.

[0133] (2-8) BODIPY 493 / 503 staining BODIPY 493 / 503 staining: The cells were seeded in a 96-well plate. After 48 hours of transfection, the culture medium was discarded and the cells were washed three times with PBS. Then, 4% paraformaldehyde was added for 30 minutes of fixation. Subsequently, the diluted BODIPY 493 / 503 staining solution was added to each well, stained for 15 minutes in the dark, and then washed with PBS. Then, Hoechst staining solution was added to stain the cell nucleus for 15 minutes and washed again with PBS. Finally, the staining of the cells was observed using a fluorescent inverted microscope and the staining photos were taken.

[0134] (2-9) Flow cytometry ROS assay The cells were seeded in a 6-well plate. After 48 hours of transfection, the cells were digested with trypsin. The cells were then collected by centrifugation at 2000 rpm for 5 minutes, and the cells were washed twice with PBS. The cell pellet was centrifuged into an EP tube. DCFH-DA was diluted with serum-free culture medium at a ratio of 1:1000, and 1 mL of the diluted solution was added to each sample. Incubate in a 37°C incubator for 20 minutes, and invert the tube every 3-5 minutes to ensure that the probe is in full contact with the cells. After the incubation, centrifuge at 2000 rpm for 5 minutes and discard the supernatant. The cells were then washed 3 times with serum-free culture medium to remove DCFH-DA that did not enter the cells. Finally, the flow cytometer was used for on-machine detection, and the flow data were analyzed using CytExpert software.

[0135] (2-10) Elisa test Elisa enzyme-linked immunosorbent assay kit was used to detect the activities of intracellular MDA and anti-oxidative stress-related enzymes (SOD, GSH and T-AOC) according to the instructions of the kit. This process is a routine experimental operation in this field and is not described in detail here.

[0136] (2-11) LC3 adenovirus transfection Primary chicken liver cells were inoculated in 6-well plates and cultured until the cell density reached 70-80% confluence for cell transfection. After 24 hours of transfection, fresh medium without antibiotics was used and cultured for 1 hour to stabilize the cell state. Subsequently, an appropriate amount of virus solution was added to each well, and the culture plate was gently shaken to ensure that the virus was in full contact with the cells. After incubation for 8 hours, fresh medium was replaced, and after continuing to culture for 48 hours, the cells were collected and fixed with 4% paraformaldehyde. Finally, the fluorescence signal of LC3 was observed by fluorescence microscopy, and fluorescence images were randomly taken.

[0137] (2-12) Transmission electron microscopy The cells were seeded in a 6-well plate. After 48 hours of transfection, the cells were gently scraped off with a cell scraper and centrifuged at 2000 rpm for 5 minutes to collect the cells. Subsequently, 1 ml of electron microscopy fixative was added to fix the cells. After fixation, the cells were placed in 30%, 50%, 70%, 90%, 95% and 100% ethanol solutions for dehydration, each treatment for 15 hours, and finally dehydrated twice in pure acetone for 10 hours each. Next, the cells were embedded and polymerized, and the embedded samples were cut into ultrathin sections of 60-90 nm thickness using an ultrathin slicer. The sections were then placed in a 2% uranyl acetate solution for light staining for 15-30 minutes, and then stained with lead citrate for 5 minutes. After that, the sections were gently rinsed with distilled water to remove excess stain, and the sections were dried naturally. Finally, the samples were observed by transmission electron microscopy, ultrastructural images were captured, and the collected images were processed and analyzed using image analysis software.

[0138] (2-13) TG and TC content determination The Nanjing Jiancheng Biochemical Kit was used to detect the TG and TC content in the cells. This is a routine operation and will not be described in detail here.

[0139] (2-14) Data Analysis The 2-△△t method was used to calculate the relative expression of the target gene in the qPCR experiment. Graphs were drawn using GraphPad Prism 8.0 software, and significant difference tests were performed using SPSS 19.0 software.

[0140] (3) Results and analysis (3-1) Verification of circRNA (3-1-1) Verification of circRNA ring structure and stability Based on the sequencing and annotation results, the sequence characteristics and source information of differentially expressed circRNAs were analyzed in detail. Figure 5 Figure A shows the exon circularization structure of the first eight differentially expressed circRNAs. Next, the present invention designed open amplification primers for the circular splicing site of circRNA, and used the cDNA mixed sample of chicken liver cells as a template for PCR amplification. The amplified product was Sanger sequenced, and the result was compared with the sequence in the circRNA sequencing data, as shown in Figure 2. Figure 5As shown by the red arrow in A, this experiment successfully amplified the splicing site of circRNA. Random primer (N9) can effectively reverse transcribe all RNAs, while Oligo d(T) primer specifically targets linear RNA with a Poly A tail. To further confirm the circular structure of circRNA, this experiment used these two primers to amplify and qPCR analyze the RNA of chicken liver cells. The results showed that the amplification efficiency of Oligo d(T) primer for circRNA was extremely low (P<0.01), which indicates that the circRNA selected in this experiment does not contain a Poly A tail, but exists in chicken liver cells as a circular structure connected head to tail ( Figure 5 B). Figure 5 As shown in C, after RNase R treatment, the expression of circRNA remained basically unchanged, while the linear RNA β-actin was significantly degraded (P<0.01). In summary, the first eight differentially expressed circRNAs are stably present in chicken livers in a head-to-tail circular structure, which further verifies the accuracy and reliability of the sequencing data.

[0141] (3-1-2) Verification of circRNA expression Furthermore, qPCR experiments were performed using liver tissue samples to verify the expression trends of differentially expressed circRNAs in the sequencing data. The results showed that circACACA, circKMT2E, circAHCTF1, circMAP4K5, circUSP45, and circRHEB were significantly highly expressed in fatty liver tissue (P<0.05), while circPLXNC1 and circQPRT were expressed at higher levels in normal liver tissue ( Figure 6 ; P<0.05). This result is consistent with the circRNA sequencing data, providing a reliable basis for subsequent trials of these circRNAs as diagnostic markers for FLS.

[0142] (3-2) Expression pattern and subcellular localization of circACACA (3-2-1) Tissue expression pattern of circACACA In view of the previous research progress on circACACA and its high and significantly different expression levels, this experiment selected it as the main research object. The expression of circRNA is highly tissue-specific, and exploring the expression pattern of circRNA in different tissues is important for the study of its potential biological functions and molecular mechanisms. In this study, 10 tissues including liver, heart, spleen, lung, kidney, breast muscle, leg muscle, fat, brain and intestine of normal chickens were collected, and the expression level of circACACA in different tissues was detected by qPCR. The results showed that circACACA was expressed in liver, fat, breast muscle and heart tissues, among which the expression level in liver was significantly higher ( Figure 7 ; P<0.05). This result suggests that circACACA may play an important role in lipid metabolism and health of chicken liver.

[0143] (3-2-2) Subcellular localization of circACACA Based on the sequence of circACACA, this study designed specific in situ hybridization fluorescent probes at its head and tail binding sites, and performed FISH verification in chicken liver cells, FL tissues, and CL tissues. The results showed that circACACA was expressed in both the nucleus and cytoplasm, but was mainly concentrated in the cytoplasm ( Figure 8 This result suggests that circACACA may be post-transcriptionally regulated in the cytoplasm and function as a molecular sponge.

[0144] (3-2-3) Effects of circACACA on fat metabolism, anti-oxidative stress and autophagy in chicken liver (3-2-3-1) Effects of circACACA on liver fat metabolism To explore the potential role of circACACA in chicken liver metabolism and development, two siRNAs spanning the splicing sites were designed and synthesized based on the full-length sequence of circACACA, named s1-circACACA and s2-circACACA (the sequences are shown in Table 2). At the same time, the full-length sequence was cloned into the pcD25-ciR vector to construct a stable overexpression plasmid of circACACA, which was named ov-circACACA. Subsequently, the two siRNAs and the overexpression vector were transfected into chicken primary liver cells, respectively, and the expression level of circACACA under different treatment conditions was detected. The results showed that both s1-circACACA and s2-circACACA could significantly reduce the expression level of circACACA (P<0.05), among which the inhibitory effect of s2-circACACA was more significant (P<0.01), so s2-circACACA was selected for subsequent experiments and named si-circACACA ( Fig. 9 In addition, transfection with ov-circACACA vector also significantly increased the expression of circACACA ( Fig. 9 (B; P < 0.01). The above results indicate that siRNA and overexpression plasmid of circACACA can significantly regulate the expression of circACACA in chicken liver cells in vitro and can be applied to subsequent functional verification experiments.

[0145] After transfection of si-circACACA into primary chicken liver cells cultured in vitro, qPCR assay revealed that the mRNA expression levels of genes related to fat synthesis (ACACA, SCD1, FASN, and SREBP) were significantly decreased ( Fig.10 A; P<0.01), but the mRNA expression levels of fat transport-related genes (ApoVLDL-Ⅱ, CPT1 and APOA1) (P<0.05) and fatty acid β-oxidation-related genes (ACADS, ACSL1 and ACOX1) (P<0.01) were significantly upregulated ( Fig.10 In contrast, after overexpression of circACACA in chicken liver cells, the expression levels of genes related to fat synthesis were significantly increased ( Fig.13 D; P < 0.01), while the expression of fat transport-related genes and fat decomposition-related genes was inhibited ( Fig.10 Middle E, F; P<0.01). Western blot experiments further verified the changes in the expression level of related gene proteins. The results showed that interference with circACACA significantly inhibited the expression of FASN and promoted the expression of ACOX1 ( Fig.11 In contrast, as circACACA expression increased, FASN protein expression also increased, while ACOX1 expression showed an opposite trend ( Fig.11 (B; P < 0.05). Detection of intracellular TG and TC content is also one of the important indicators for evaluating liver fat metabolism, such as Fig.11 As shown in C and D, with the increase of circACACA expression, the accumulation of TG (P<0.01) and TC (P<0.05) in chicken liver cells increased significantly. BODIPY staining results showed that compared with the si-NC transfection group, the green fluorescence staining area in the cells of the si-circACACA transfection group was significantly reduced ( Fig.12 A, B; P<0.01); compared with the control group, a large number of positively stained cells were observed in the ov-circACACA treatment group ( Fig.12 In conclusion, circACACA can promote the accumulation of fat in liver cells and disrupt the metabolic balance of intracellular fat.

[0146] (3-2-3-2) Effects of circACACA on liver resistance to oxidative stress In addition, this study explored the potential role of circACACA in the anti-oxidative stress of liver cells. First, qPCR results showed that inhibiting the expression of circACACA significantly increased the mRNA expression levels of anti-oxidative stress-related genes SOD, GPX7, TRX, and GST ( Fig.13 A; P<0.05), while overexpression of circACACA significantly downregulated the mRNA expression of SOD and TRX ( Fig.13 Middle B; P<0.01). The Western blot results were consistent with the qPCR results. Interference with circACACA significantly upregulated the protein expressions of SOD and GPX7 ( Fig.13 C; P < 0.05), while transfection with ov-circACACA produced the opposite effect, significantly downregulating their protein expression ( Fig.13 D; P<0.05). In this experiment, flow cytometry was used to analyze the content of intracellular ROS in different treatment groups. The results showed that with the increase of circACACA expression, the accumulation of intracellular ROS increased significantly ( Fig.14 (A; P<0.01). Overexpression of CircACACA significantly increased the production of intracellular MDA ( Fig.14 In addition, interference with circACACA significantly enhanced the activities of anti-oxidative stress-related enzymes SOD, GSH, and T-AOC ( Fig.14 CE; P<0.05), while overexpression of circACACA led to a decrease in the activities of SOD and T-AOC ( Fig.14 CE; P<0.05). In summary, circACACA can induce the increase of intracellular antioxidant stress level.

[0147] (3-2-3-3) Effects of circACACA on autophagy in liver cells To further explore the effect of circACACA on autophagy in liver cells, qPCR and Western blot were used to detect the expression of autophagy marker genes at the mRNA and protein levels, respectively. qPCR results showed that interference with circACACA significantly reduced the mRNA expression levels of Beclin1, ATG5, ATG7, and ATG9, and increased the expression of P62 ( Fig.15 In contrast, overexpression of circACACA significantly promoted the expression of Beclin1 and ATG9, and reduced the expression of P62 ( Fig.15Middle B; P<0.05). The Western blot results were consistent with the qPCR results. Reducing the expression of circACACA could alleviate the protein levels of autophagy-related genes ( Fig.15 C; P < 0.05), overexpression of circACACA significantly increased the levels of autophagy-related proteins, but not P62 ( Fig.15 In addition, Mcherry-EGFP-LC3 adenovirus was used to track autophagosomes, and the fluorescent protein labeling results showed that the positive fluorescent staining area in cells transfected with si-circACACA was significantly lower than that in the control group ( Fig.16 Further observation under transmission electron microscopy revealed that overexpression of circACACA could increase the number of autophagosomes in cells ( Fig.16 In conclusion, circACACA can promote autophagy in chicken liver cells.

[0148] Embodiment 3:

[0149] This example studies the molecular mechanism of circACACA regulating chicken liver fat metabolism, anti-oxidative stress and cell autophagy, as follows: (1) Experimental animals and experimental reagents The sources of experimental animals are the same as those in Examples 1 and 2.

[0150] Kit: Dual luciferase reporter gene detection kit (Shanghai Bio-Tech, catalog number RG027), other kits are the same as in Example 2.

[0151] Antibodies include: anti-AKT (Wuhan Aibotec, catalog number A8P0140), anti-P-AKT (Wuhan Aibotec, catalog number A14687), anti-mTOR (Chengdu Positive Energy, catalog number 380411), anti-p-mTOR (Chengdu Positive Energy, catalog number 381557), anti-PPAR-γ (Chengdu Positive Energy, catalog number 340844), anti-RXRA (Chengdu Positive Energy, catalog number R383177), anti-PIM1 (Chengdu Positive Energy, catalog number R381112), anti-Flag (Wuhan Aibotec, catalog number AE005), and other antibodies are the same as in Example 2.

[0152] (2) Test methods (2-1) Construction, sequencing and analysis of miRNA transcriptome, specifically the following steps: 1) Database construction The qualified RNA samples were used to construct the library using the Small RNA Sample Pre Kit. First, using the unique 3' and 5' end structural characteristics of Small RNA, total RNA was used as the starting sample, and adapters were added to both ends of the Small RNA for reverse transcription to generate cDNA. Subsequently, PCR amplification was performed, and the target DNA fragments were separated by PAGE gel electrophoresis. After gel cutting and recovery, the cDNA library was obtained.

[0153] 2) Sequencing After the library is constructed, Qubit 2.0 is first used for preliminary quantification, and then the insert size of the library is detected by the highly sensitive Agilent2100. When the fragment size meets expectations, qPCR is used to accurately measure the effective concentration of the library to ensure that the quality of the library meets the needs of subsequent experiments. After the library is qualified, the adapter primer, DNA polymerase, and four dNTPs with base-specific fluorescent labels are added to the reaction system. When dNTP is added to the newly synthesized DNA chain, the buffer required to excite fluorescence is added, and the fluorescence signal is excited by laser. Subsequently, the fluorescence signal is recorded and analyzed by computer, and the collected optical signal is converted into sequencing bases, thereby completing the Illumina SE50 sequencing process.

[0154] 3) Analysis The raw data (Raw Data or Raw Reads) obtained by Illumina Novoseq sequencing are first quality controlled to remove reads with adapters and low-quality reads to obtain high-quality clean reads. Subsequently, the clean reads of each sample are length-screened, and sRNAs within a certain length range are selected for subsequent analysis. Bowtie is used to map the length-screened sRNA sequences to the reference genome to analyze the distribution characteristics of sRNAs on the reference sequence. Subsequently, the successfully located reads are compared with the sequences in the specified range in the miRBase database to obtain detailed information on the matching sRNAs in each sample, including the secondary structure of the matched known miRNAs, the sequence, length, and frequency of occurrence of miRNAs in each sample.

[0155] Next, the expression of known and newly discovered miRNAs in each sample was statistically analyzed and normalized by TPM. Differential expression analysis was performed using DESeq2 based on negative binomial distribution to determine the differentially expressed miRNAs between the two groups. On this basis, according to the correspondence between miRNAs and their target genes, the target gene sets of each group of differentially expressed miRNAs were enriched by GO and KEGG pathways to explore their potential biological functions and involved signaling pathways.

[0156] (2-2) Prediction of miRNA-target relationships RNAhybrid online prediction software (https: / / bibiserv.cebitec.uni-bielefeld.de / rnahybrid / ) was used to analyze the target relationship and binding sites between circRNA and miRNAs. TargetScan (http: / / www.targetscan.org / vert_71 / ) and miRDB (http: / / mirdb.org / ) were used to predict the interaction relationship between miRNAs and mRNAs.

[0157] (2-3) Construction of dual luciferase reporter plasmid According to the miRNA binding sites predicted by RNAhybrid, site-directed mutagenesis was performed on them. The mutation site and the 150 bp sequence before and after were selected, and the mutant fragment was cloned into the multiple cloning site of the pmirGLO vector using T4 DNA ligase to construct a circACACA vector containing the mutant sequence, namely circACACA-MT. In addition, a sequence fragment containing the binding site and the 150 bp sequence before and after it was selected and inserted into the pmirGLO vector to construct the wild-type dual-luciferase reporter vector of circACACA, namely circACACA-WT. Similarly, according to the binding sites of miRNAs and target mRNAs, the pmirGLO vector was used to construct its wild-type (CBFB-WT) and mutant (CBFB-MT) dual-luciferase reporter vectors.

[0158] (2-4) Cultivation, passaging and transfection of DF-1 cells The DF-1 cell line was cultured in F12 medium containing 10% FBS and 1% penicillin-streptomycin and continuously cultured in a humidified incubator at 37°C, with fresh medium replaced every 24 hours. Cell passaging began when the cell confluence reached about 90%. First, 0.25% trypsin was added to digest the adherent cells. After the cells were completely detached, an equal volume of F12 medium was added to terminate the trypsin digestion. Then, the cells were collected by centrifugation at 2000 rpm for 5 minutes, and the cells were resuspended and inoculated into a 48-well plate. When the cells grew to a confluence of 70% to 80%, circACACA-WT+miRNA mimics, circACACA-WT+mimics NC, circACACA-MT+miRNA mimics and circACACA-MT+mimics NC were transfected into DF- cells respectively. The transfection procedure was similar to that of primary chicken liver cells. For detailed operations, please refer to Example 2 “(2-2) Isolation, culture and transfection of primary chicken liver cells”.

[0159] (2-5) Dual luciferase reporter assay 72h after transfection, cells were collected and 100ul of reporter cell lysis buffer was added to fully lyse the cells. Subsequently, the supernatant was transferred to a 96-well ELISA plate. According to the instructions of the dual-luciferase reporter gene assay kit, 100ul of firefly luciferase assay reagent was added, and the detection interval was set to 2 seconds and the measurement time was set to 10 seconds to determine the relative light unit (RLU) of luciferase. Next, according to the required amount of each sample, Renilla luciferase assay buffer and Renilla luciferase assay substrate (100X) were diluted at a ratio of 1:100 to prepare the assay working solution. 100ul of Renilla luciferase assay working solution was added to each sample, mixed and then its RLU value was determined. The ratio was calculated by dividing the RLU value of firefly luciferase by the RLU value of Renilla luciferase, with Renilla luciferase as the internal reference. Finally, the relative activity level of the target reporter gene in each sample was evaluated by comparing the ratios of different samples.

[0160] (2-6) qPCR For detailed qPCR operation steps and partial primer sequence information, please refer to "(2-4) Fluorescence quantitative PCR (qPCR)" in Example 2. The new primer information required in this section is as follows: Table 7 qPCR primer sequences

[0161] (2-7) FISH For detailed operation steps of FISH assay and the fluorescent probe sequence of circACACA, please refer to “(2-6) Fluorescence in situ hybridization (FISH)” in Example 2. The fluorescent probe sequence information of miR-132b-5p and miR-101-2-5p required in this section is shown in Table 8 below: Table 8 FISH probe sequences of miRNAs

[0162] (2-8) For other experimental methods involved in this example, such as isolation, culture and transfection of primary chicken liver cells, extraction and synthesis of RNA, Western blot, BODIPY 495 / 503 staining, flow cytometry, Elisa assay, LC3 adenovirus transfection, transmission electron microscopy, TG and TC kit detection and data analysis, etc., please refer to the section “(2) Experimental methods” in Example 2.

[0163] (3) Results and analysis (3-1) miRNA sequencing and analysis of chicken FL and CL (3-1-1) Quality assessment of miRNA sequencing data Based on the experimental results of Example 1, we selected 3 FL samples and 3 CL tissue samples for miRNA transcriptome sequencing experiments. The original data of miRNA sequencing of the 6 samples have been deposited in the SRA database with the accession number PRJNA957563. Subsequently, we performed a quality assessment on the original data of sequencing output of the 6 samples. As shown in Table 9, a total of 9,974,115 to 14,853,155 original reads were obtained for the 6 samples. After removing the low-quality reads with adapters, 9824635 to 14606056 clean reads were obtained for subsequent data analysis. The error rates of the 6 samples were all 0.01%, and their distribution is as follows Fig.17 The Q20 of all samples was higher than 98.82%, and the Q30 was higher than 96.40%. The GC content of each sample ranged from 48.93% to 49.79%. The above results showed that the miRNA sequencing data of chicken FL and CL were of good quality and could be used for subsequent analysis and experiments.

[0164] Table 9 Quality assessment of miRNA sequencing data in chicken FL and CL

[0165] (3-1-2) Data analysis of miRNA sequencing Furthermore, this experiment used circos graphs to perform density statistics on the reads mapped to each chromosome of the genome in the six samples. The results showed that miRNAs were randomly distributed on each chromosome of the chicken ( Fig.18 Subsequently, this experiment conducted a statistical analysis of the sequence length of miRNA and found that the length of most miRNAs was concentrated between 21 and 23 nucleotides ( Fig.19 The expression patterns and expression level distribution of miRNAs in the six samples are shown in Figure 2. Fig.19 As shown in B and C. The number of miRNAs distributed in different TPM intervals was counted and it was found that the most miRNAs were in the range of 0 to 0.1 TPM, followed by miRNAs in the range of 0.3 to 3.75 TPM ( Fig.19 Middle D).

[0166] (3-1-3) Differential expression analysis of miRNAs in chicken FL and CL A total of 644 miRNAs were detected in the two groups of liver samples, of which 479 miRNAs were co-expressed in the two groups of samples ( Fig. 20 In order to study the differential expression of miRNA, this experiment used the DESeq2 method based on negative binomial distribution to perform differential expression analysis of miRNA in the two groups of samples. The analysis results showed that among the 479 co-expressed miRNAs, 19 miRNAs showed significant differential expression between FL and CL samples, of which 13 miRNAs were upregulated and 6 miRNAs were downregulated ( Fig. 20 The detailed information of differentially expressed miRNAs is listed in the Appendix. In addition, we performed a hierarchical clustering visualization analysis on the 19 differentially expressed miRNAs ( Fig. 20 The clustering results intuitively demonstrated the significant differences between the two groups of samples, which not only verified the accuracy of sample classification, but also further supported the reliability of sequencing data and the usability of analysis results, laying a solid foundation for subsequent research.

[0167] (3-2) Prediction and identification of circACACA target miRNAs Furthermore, we explored the potential target miRNAs of circACACA. First, we used RNAhybrid online prediction software to predict the target miRNAs of circACACA, and combined with the circRNA sequencing results for Venn analysis, and finally screened out 9 miRNAs, namely miR-132b-5p, miR-1653, miR-301b-5p, miR-6596-3p, miR-130b-5p, miR-3531-3p, miR-1771, miR-1626-5p and miR-101-2-5p ( Fig.21 Subsequently, we used qPCR to preliminarily verify the expression relationship between the 9 screened miRNAs and circACACA. The results showed that among these miRNAs, only miR-132b-5p and miR-101-2-5p showed significantly opposite expression levels to circACACA ( Fig.21 Then, we combined the miRNA sequencing data for joint analysis, and found that miR-132b-5p and miR-101-2-5p were significantly overexpressed in CL, further confirming the opposite expression pattern of these two miRNAs and circACACA ( Fig.21 Middle E; P<0.05). FISH assay also detected the co-localization of circACACA and these two miRNAs in cells ( Fig.21 F, G in the middle), these results provide a basis for the interaction between them. Furthermore, based on the binding sites of circACACA with miR-132b-5p and miR-101-2-5p predicted by RNAhybrid software ( Fig. 22 We constructed wild-type (circACACA-WT) and mutant (circACACA-MT) dual-luciferase reporter vectors containing miR-132b-5p and miR-101-2-5p binding sites, respectively. Fig. 22 C, D). Subsequently, these reporter vectors were co-transfected with miR-132b-5p mimic and miR-101-2-5p mimic to perform dual luciferase reporter assay. The results showed that both miR-132b-5p and miR-101-2-5p could significantly reduce the fluorescence activity of circACACA-WT, but had no significant effect on the fluorescence activity of circACACA-MT ( Fig. 22 (E, F; P<0.05). The above results suggest that circACACA can act as a molecular sponge for miR-132b-5p and miR-101-2-5p.

[0168] (3-3) Effects of miR-132b-5p on fat metabolism, anti-oxidative stress and autophagy in chicken liver (3-3-1) Effects of miR-132b-5p on liver fat metabolism In order to study the effect of miR-132b-5p on chicken liver health, this experiment synthesized its inhibitor (inhibitor) and agonist (mimic) according to the sequence of miR-132b-5p. The sequence is shown in Table 10, and these reagents were transfected into primary chicken liver cells cultured in vitro. Through qPCR detection, we found that miR-132b-5p inhibitor can significantly reduce its expression level ( Fig.23 A; P<0.01), while miR-132b-5p mimic significantly increased its expression level ( Fig.23 (centerB; P < 0.01).

[0169] Table 10 Inhibitor and agonist sequences of miR-132b-5p and miR-101-2-5p

[0170] Furthermore, qPCR results showed that interference with miR-132b-5p significantly increased the gene expressions of ACACA, SCD1, FASN, and SREBP ( Fig.26 C; P<0.01), but inhibited the mRNA levels of genes related to fat transport and fatty acid β-oxidation ( Fig.23 In contrast, overexpression of miR-132b-5p significantly reduced the mRNA levels of genes related to fat synthesis ( Fig.23 F; P<0.01), and promoted the expression of genes related to fat transport and fat decomposition ( Fig.23 Middle G, H; P<0.01). Western blot results showed that after transfection with miR-132b-5p inhibitor, the protein level of ACOX1 was significantly downregulated, but the protein expression of FASN showed an upward trend ( Fig.24 A, B; P<0.05). After overexpression of miR-132b-5p, the protein expressions of ACOX1 and FASN showed an opposite trend ( Fig.24 In addition, we found that the levels of intracellular TG and TC were negatively correlated with the expression of miR-132b-5p ( Fig.24 E, F; P<0.01). BODIPY staining results further revealed that after reducing the expression of miR-132b-5p, the green fluorescence staining area in liver cells increased significantly ( Fig.25However, as the expression of miR-132b-5p increased, the accumulation of intracellular lipid droplets also decreased significantly ( Fig.25 In conclusion, miR-132b-5p can alleviate the accumulation of fat in liver cells and is beneficial to the maintenance of fat metabolism.

[0171] (3-3-2) Effect of miR-132b-5p on liver resistance to oxidative stress Subsequently, we explored the effect of miR-132b-5p on the anti-oxidative stress of liver cells. Interference with miR-132b-5p significantly inhibited the mRNA levels of SOD, GST and TRX ( Fig.26 Middle A; P<0.05). After inhibiting miR-132b-5p, the changes in the protein expression levels of GPX7 and SOD were consistent with their mRNA expressions ( Fig.26 In contrast, overexpression of miR-132b-5p significantly promoted the mRNA and protein expressions of genes related to anti-oxidative stress ( Fig.26 C, D; P<0.05). Flow cytometry analysis showed that transfection of miR-132b-5p inhibitor significantly increased the accumulation of intracellular ROS, while overexpression of miR-132b-5p inhibited the production of ROS ( Fig. 27 In addition, the production of MAD in cells was negatively correlated with miR-132b-5p ( Fig. 27 C; P<0.01), but the activities of antioxidant stress-related enzymes such as SOD, GSH and T-AOC were significantly increased with the increase of miR-132b-5p ( Fig. 27 DF; P<0.05). In summary, miR-132b-5p can enhance the anti-oxidative stress ability of chicken liver cells.

[0172] (3-3-3) Effect of miR-132b-5p on autophagy in liver cells Next, we investigated the effect of miR-132b-5p on autophagy in chicken liver cells. Inhibition of miR-132b-5p significantly upregulated the mRNA levels of autophagy-related genes (Beclin1, ATG5, ATG7, and ATG9) ( Fig.28 A; P<0.01). Meanwhile, the protein expressions of LC3 and Beclin1 also increased significantly, while the expression of P62 showed an opposite trend ( Fig.28 In contrast, overexpression of miR-132b-5p significantly inhibited the mRNA levels of autophagy-related genes ( Fig.28C; P<0.05), and the levels of LC3 and Beclin1 proteins also decreased significantly, while the expression of P62 increased ( Fig.28 In addition, the Mcherry-EGFP-LC3 adenovirus transfection assay showed that the fluorescent staining area in cells transfected with miR-132b-5p mimic was significantly lower than that in the control group ( Fig.29 Middle A). Transmission electron microscopy further confirmed that inhibition of miR-132b-5p could significantly increase the number of autophagosomes in cells. Fig.29 In summary, miR-132b-5p can attenuate the level of autophagy in cells.

[0173] (3-4) Effects of miR-101-2-5p on fat metabolism, anti-oxidative stress and autophagy in chicken liver (3-4-1) Effect of miR-101-2-5p on liver fat metabolism To explore the potential effect of miR-101-2-5p on the health of primary chicken hepatocytes, we constructed its inhibitor and mimic, as shown in Table 10, and performed in vitro transfection experiments. The qPCR results showed that the expression level of miR-101-2-5p was successfully changed ( Fig.30 Next, we found that downregulation of miR-101-2-5p significantly promoted the mRNA levels of genes related to fat synthesis ( Fig.30 C; P<0.05), while the expression of genes related to fat transport and fatty acid β-decomposition was significantly inhibited ( Fig.30 In contrast, overexpression of miR-101-2-5p attenuated the expression of fat synthesis genes ( Fig.30 Middle F; P < 0.01), up-regulated the mRNA levels of genes related to fat transport and fatty acid β-decomposition ( Fig.30 Middle G, H; P<0.05). Western blot analysis further verified the results at the protein level, that is, interference with miR-101-2-5p reduced the expression of ACOX1 and increased the expression of FASN ( Fig.31 A, B; P<0.01); while overexpression of miR-101-2-5p promoted the expression of ACOX1 and inhibited the protein level of FASN ( Fig.31 In C, D; P<0.01). In addition, we also detected the accumulation levels of TG and TC in cells using a kit. The results showed that downregulation of miR-101-2-5p significantly increased the intracellular content of TG and TC, while overexpression produced the opposite effect ( Fig.31E, F; P<0.01). BODIPY 493 / 503 staining also revealed a large amount of fluorescent staining area in the miR-101-2-5p inhibitor transfection group ( Fig.32 A, B; P < 0.01), but the fluorescence staining was relatively less in the miR-101-2-5pmimic transfection group ( Fig.32 In conclusion, miR-101-2-5p is beneficial to the maintenance of lipid metabolism balance in liver cells.

[0174] (3-4-2) Effect of miR-101-2-5p on liver resistance to oxidative stress Subsequently, this study evaluated the effect of miR-101-2-5p on the anti-oxidative stress of liver cells. qPCR results showed that interference with miR-101-2-5p significantly inhibited the mRNA expression of genes related to anti-oxidative stress ( Fig.33 Middle A; P<0.01). Western blot results further confirmed the inhibitory effect of down-regulating miR-101-2-5p on the expression of GPX7 and SOD proteins ( Fig.33 Middle B; P<0.05). Overexpression of miR-101-2-5p had an opposite effect on both the mRNA and protein levels of genes related to anti-oxidative stress ( Fig.33 C, D; P<0.05). Flow cytometry results showed that miR-101-2-5p inhibited the generation of ROS in liver cells ( Fig.34 (A, B; P<0.05). As the expression level of miR-101-2-5p increased, the intracellular MAD content gradually decreased ( Fig.34 C; P<0.05), while the accumulation of SOD, GSH and T-AOC was positively correlated with the expression of miR-101-2-5p ( Fig.34 DF; P<0.05). In summary, miR-101-2-5p can effectively alleviate the antioxidant stress response in liver cells.

[0175] (3-4-3) Effect of miR-101-2-5p on autophagy in liver cells Finally, we also explored the effect of miR-101-2-5p on autophagy in liver cells. The results showed that interference with miR-101-2-5p significantly increased the mRNA expression levels of autophagy-related genes Beclin1, ATG5, ATG7, and ATG9, and significantly inhibited the expression of P62 ( Fig.35 In addition, the Western blot results of autophagy-related proteins after interference with miR-101-2-5p were similar to those of qPCR ( Fig.35In contrast, overexpression of miR-101-2-5p decreased the mRNA levels of Beclin1, ATG5, ATG7, and ATG9, and increased the expression of P62 ( Fig.35 Middle C; P<0.05). Western blot results also showed that upregulating the expression of miR-101-2-5p could increase the protein content of P62, but downregulate the protein expression of LC3 and Beclin1 ( Fig.35 Middle D; P<0.05). The results of the Mcherry-EGFP-LC3 adenovirus infection experiment showed that the staining area of ​​autophagosomes in liver cells after upregulation of miR-101-2-5p was significantly lower than that in the control group ( Fig.36 Electron microscopy results also revealed that cells transfected with miR-101-2-5p inhibitor contained more autophagosomes and autolysosomes ( Fig.36 In summary, miR-101-2-5p can inhibit the occurrence of cellular autophagy.

[0176] (3-5) Prediction and identification of target genes of miR-132b-5p and miR-101-2-5p To further explore the molecular mechanism of action of miR-132b-5p and miR-101-2-5p, we used miRDB and Targetscan online prediction software and combined miRNA sequencing data to predict the downstream target genes of these two miRNAs. Venn analysis results showed that CBFB was the only common target gene of miR-132b-5p and miR-101-2-5p ( Fig.37 Figure 2 (A). The target binding sites of miR-132b-5p and miR-101-2-5p and CBFB predicted by RNAhybrid are shown in Figure 2. Fig.37 As shown in B. Their expression levels were further verified by qPCR, and the results showed that downregulation of miR-132b-5p and miR-101-2-5p could promote the mRNA expression of CBFB, while upregulation of miR-132b-5p and miR-101-2-5p inhibited the mRNA expression of CBFB ( Fig.37 C, D; P < 0.05). Subsequently, we constructed wild-type and mutant dual-fluorescence reporter vectors of CBFB to conduct dual-fluorescence reporter enzyme assays ( Fig.37 The results showed that the addition of miR-132b-5p and miR-101-2-5p mimics significantly reduced the fluorescence activity of the CBFB wild-type vector ( Fig.37(G, H; P<0.01). In summary, CBFB is a common downstream target gene of miR-132b-5p and miR-101-2-5p.

[0177] (3-6) Effects of CBFB on fat metabolism, anti-oxidative stress and cell autophagy in chicken liver (3-6-1) Effects of CBFB on liver fat metabolism To explore the potential role of CBFB in liver health and development, we designed and synthesized three siRNAs targeting CBFB and their overexpression vectors. The results showed that s3-CBFB (named si-CBFB) significantly inhibited the expression of CBFB in liver cells in vitro ( Fig.38 A; P<0.01), while the overexpression vector (named ov-CBFB) significantly increased the expression level of CBFB ( Fig.38 Middle B; P<0.01). Further qPCR results showed that interference with CBFB reduced the mRNA levels of genes related to fat synthesis ( Fig.38 C; P<0.01), but the expression of genes related to fat transport and fatty acid β-oxidation was increased ( Fig.38 In contrast, overexpression of CBFB promoted the expression of genes related to fat synthesis ( Fig.38 F; P<0.05), and inhibited the mRNA levels of genes related to fat transport and degradation ( Fig.38 Middle G, H; P<0.05). Western blot further confirmed that downregulation of CBFB was beneficial to the expression of ACOX1 protein, but could inhibit the protein level of FASN ( Fig.39 Middle A; P<0.05). However, overexpression of CBFB promoted the expression of FASN but was not conducive to the expression of ACOX1 ( Fig.39 In addition, the accumulation levels of TG and TC in cells also changed accordingly with the changes in CBFB ( Fig.39 C, D; P<0.05). Finally, BODIPY 493 / 503 staining assay revealed that the accumulation of intracellular lipid droplets in the si-CBFB transfection group was significantly less than that in the control group ( Fig.40 A, B; P < 0.05), while a large amount of fluorescent staining area was observed in the ov-CBFB transfection group ( Fig.40 (A, C; P < 0.05). In summary, CBFB is similar to circACACA and can disrupt the balance of fat metabolism in the liver.

[0178] Table 11 siRNA sequences and overexpression vector sequences of CBFB

[0179] ov-CBFB is a sequence of CBFB cloned into PCDNA3.1 vector, the sequence is (SEQ ID NO.86): ATGCCGCGGGTCGTCCCCGACCAGCGCAGCAAGTTCGAGAACGAGGAGTTCTTCAGGAAGCTGAGCCGCGAGTGCGAGATCAAGTACACCGGCTTCAGGGACCGGCCCCACGAGGAGAGGCAGGCCCGCTTCCAG AACGCCTGCCGCGACGGCCGCTCCGAGATCGCTTTTGTGGCCACGGGAACCAATCTGTCTCTCCAGTTTTTCCGGCCAGCTGGCAGGGGGAGCAGCGGCAGACACCAACCCGGGAGTATGTCGACTTTGAGAGAGAAGGAGG CAAGGTGTACTTGAAGGCACCTATGATTCTTAATGGTGTCTGTGTAATCTGGAAAGGCTGGATAGATCTACAGAGACTGGATGGTATGGGCTGCCTGGAATTTGATGAAGAGAGAGCACAGCAGGAGGATGCATTGGCACAAC AAGCCTTTGAAGAAGCTCGAAGAAGAACCCGTGAATTCGAAGACAGAGACAGGTCTCATCGGGAGGAAATGGAGGCAAGAAGACAACAAGACCCTAGTCCTGGATCCAACCTAGGAAGTGGTGATGATCTCAAACTACGTTAA (3-6-2) Effects of CBFB on liver's anti-oxidative stress In addition, this study also explored the effect of CBFB on the anti-oxidative stress of liver cells. qPCR results showed that interference with CBFB significantly increased the mRNA expression levels of anti-oxidative stress-related genes SOD, GPX7 and GST ( Fig.41 A; P < 0.01), while up-regulation of CBFB inhibited the expression of these genes ( Fig.41 Middle B; P<0.05). Western blot results also revealed that the protein expression levels of anti-oxidative stress-related genes increased significantly with the downregulation of CBFB, while decreased significantly with the upregulation of CBFB ( Fig.41 C, D; P<0.05). The results of ROS flow cytometry showed that after interfering with CBFB, the ROS content in liver cells was significantly lower than that in the control group, while overexpression of CBFB significantly promoted the production of ROS in cells ( Fig.41In conclusion, CBFB can weaken the anti-oxidative stress ability of cells and cause cellular oxidative damage.

[0180] (3-6-3) Effects of CBFB on autophagy in liver cells In order to explore the effect of CBFB on autophagy in liver cells, we analyzed the expression of autophagy-related genes at both the mRNA and protein levels. qPCR data revealed that interfering with CBFB significantly promoted the mRNA level of P62, but downregulated the expression of Beclin1, AUG5, and AUG7 ( Fig.42 In contrast, overexpression of CBFB promoted the expression of Beclin1, ATG7, and ATG9, but reduced the mRNA level of P62 ( Fig.42 Middle B; P<0.05). Western blot results showed that downregulation of CBFB inhibited the protein expression of LC3 and Beclin1, while promoting the expression of P62 protein ( Fig.42 In contrast, upregulation of CBFB enhanced the accumulation of autophagy-related proteins LC3 and Beclin1, but decreased the expression of P62 ( Fig.42 Middle D; P<0.05). The results of the mcherry-EGFP-LC3 adenovirus labeling experiment further suggested that reducing the expression of CBFB significantly reduced the number of autophagosomes in cells ( Fig.43 Middle A). Transmission electron microscopy results once again confirmed the role of CBFB in promoting autophagy in liver cells ( Fig.43 The above results suggest that CBFB can induce autophagy in liver cells.

[0181] (3-7) circACACA affects liver health by regulating AKT / mTOR and PPAR-γ signaling pathways through ceRNA mechanism (3-7-1) CBFB regulates AKT / mTOR and PPAR-γ signaling pathways by binding to PIM1 Furthermore, we conducted an in-depth study on the mechanism of action of CBFB in liver cells. Western blot results showed that interference with CBFB did not significantly affect the protein expression of AKT and mTOR, but significantly increased the protein levels of p-AKT and p-mTOR. In addition, downregulation of CBFB significantly promoted the expression of PPAR-γ and RXRA, key proteins in the PPAR-γ signaling pathway ( Fig.44 Similarly, overexpression of CBFB had no significant effect on the protein expression of AKT and mTOR, but significantly inhibited the phosphorylation levels of AKT and mTOR, and attenuated the expression of PPAR-γ and RXRA ( Fig.44 C, D; P<0.05). The above results suggest that CBFB can inhibit the activity of AKT / mTOR signaling pathway and PPAR-γ signaling pathway.

[0182] Previous studies have shown that CBFB can participate in and regulate multiple signaling pathways by binding to PIM1, thereby exerting biological functions. However, the specific mechanism of action of the binding relationship between CBFB and PIM1 in chicken liver has not yet been verified. Therefore, this experiment carried out relevant experiments to verify the interaction between CBFB and PIM1 in chicken liver, so as to further understand its potential regulatory role in poultry fat metabolism and related signaling pathways. qPCR results showed that interference with CBFB significantly upregulated the mRNA expression of PIM1, while overexpression of CBFB produced the opposite effect and inhibited the gene expression level of PIM1 ( Fig.45 Middle A; P<0.05). The Western blot results were consistent with the qPCR results. When CBFB was downregulated, the PIM1 protein level increased significantly, while when CBFB was overexpressed, the PIM1 protein level decreased ( Fig.45 B, C; P<0.05). Finally, the results of the immunoprecipitation assay showed that the expression of Flag and PIM1 proteins was detected in both the IP-Flag group and the Input group, suggesting that there is an interaction between CBFB and PIM1 ( Fig.45 The above results indicate that there is an interaction between CBFB and PIM1, and CBFB has a negative regulatory effect on PIM1.

[0183] Next, this experiment explored the potential role of PIM1 in the AKT / mTOR signaling pathway and the PPAR-γ signaling pathway. The results showed that the effects of PIM1 on the two signaling pathways were opposite to those of CBFB, and downregulating the expression of PIM1 significantly inhibited the phosphorylation levels of AKT and mTOR. In addition, interfering with the expression of PIM1 also led to a decrease in the levels of PPAR-γ and RXRA proteins ( Fig.46 A, B; P<0.05). Further, we performed co-transfection experiments with si-CBFB+si-NC, si-CBFB+si-PIM1, and si-NC+si-NC. The results showed that downregulation of PIM1 could reverse the inhibitory effects of si-CBFB on fat accumulation, anti-oxidative stress, and cell autophagy ( Fig.47 In addition, inhibition of PIM1 also weakened the promoting effect of si-CBFB on the AKT / mTOR signaling pathway and PPAR-γ signaling pathway ( Fig.47In summary, we concluded that CBFB participates in hepatic lipid metabolism and development by interacting with PIM1 and regulating the AKT / mTOR and PPAR-γ signaling pathways.

[0184] (3-7-2) circACACA regulates the CBFB / PIM1 complex to inactivate AKT / mTOR and PPAR-γ signaling pathways by acting as a molecular sponge for miR-132b-5p and miR-101-2-5p To further prove that circACACA participates in the AKT / mTOR and PPAR-γ signaling pathways through the ceRNA mechanism and exerts regulatory functions, we conducted co-transfection experiments with circACACA, miR-132b-5p and miR-101-2-5p. Western blot results showed that the addition of circACACA to liver cells could alleviate the inhibition of miR-132b-5p on the fat synthesis protein FASN, and at the same time reduce the promotion of miR-132b-5p on the fat decomposition protein ACOX1. In addition, the addition of circACACA can also reverse the inhibitory effect of miR-132b-5p mimics on anti-oxidative stress and cellular autophagy ( Fig.48 (A, B; P<0.05). At the same time, overexpression of circACACA in cells significantly weakened the promoting effect of miR-132b-5p mimics on PIM1, and the expression of key proteins in the AKT / mTOR and PPAR-γ signaling pathways also decreased ( Fig.48 A, C; P<0.05). Co-transfection of ov-circACACA and miR-101-2-5p in cells produced similar effects on proteins related to fat metabolism, anti-oxidative stress and cell autophagy, as well as key proteins in the AKT / mTOR and PPAR-γ signaling pathways ( Fig.49 AC; P<0.05). Finally, we explored the effects of co-transfection of circACACA and CBFB on chicken liver health and related signaling pathways. Western blot results revealed that interference with CBFB alleviated the promoting effects of circACACA on fat accumulation, oxidative stress and cell autophagy in the liver ( Fig.50 (A, B; P<0.05). At the same time, inhibiting the expression of CBFB can also activate the activity of AKT / mTOR and PPAR-γ signaling pathways ( Fig.50In conclusion, circACACA regulates the inactivation of AKT / mTOR and PPAR-γ signaling pathways by the CBFB / PIM1 complex as a molecular sponge for miR-132b-5p and miR-101-2-5p, thereby participating in fat metabolism, anti-oxidative stress and cell autophagy in the liver.

[0185] Therefore, circACACA plays a biological role as a molecular sponge for miR-132b-5p and miR-101-2-5p. miR-132b-5p and miR-101-2-5p can promote the balance of lipid metabolism in the liver, enhance the antioxidant stress capacity of liver cells, and weaken the activity of cell autophagy. CBFB is a common target downstream gene of miR-132b-5p and miR-101-2-5p. Similar to circACACA, CBFB can promote the accumulation of lipid droplets in liver cells, weaken the antioxidant stress capacity of cells, and induce the occurrence of cell autophagy. circACACA mediates the CBFB / PIM1 complex through the ceRNA mechanism, thereby regulating the AKT / mTOR and PPAR-γ signaling pathways, and participates in the regulation of fat metabolism in poultry liver and the maintenance of health.

[0186] In summary, this paper deeply explored the potential role of circACACA in liver fat metabolic diseases and comprehensively constructed the molecular regulatory network of circACACA. This study not only provides a new theoretical basis for poultry health management and molecular breeding, but also provides a new strategy for the prevention and treatment of human non-alcoholic fatty liver disease (NAFLD).

[0187] Although the embodiments of the present invention have been shown and described, it is understood that a person of ordinary skill in the art may make various changes, modifications, substitutions and variations to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the attached claims and their equivalents. The above-described embodiments only express several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that a person of ordinary skill in the art may make several variations and improvements without departing from the concept of the present invention, and these all belong to the scope of protection of the present invention. Therefore, the scope of protection of the patent of the present invention shall be based on the attached claims.

Claims

1. Use of an agent for reducing or inhibiting the expression of the circACACA gene in the preparation of a product for promoting lipid metabolism balance in chicken liver and / or enhancing the antioxidant stress capacity of liver cells and / or weakening liver cell autophagy, wherein the agent has a sequence as shown in SEQ ID NO. 1 to SEQ ID NO. 2 or a sequence as shown in SEQ ID NO. 3 to SEQ ID NO.

4.

2. The use according to claim 1, characterized in that: The target miRNAs of the circACACA gene include miR-132b-5p and miR-101-2-5p, and the common target gene of the miR-132b-5p and the miR-101-2-5p is CBFB.

3. Use of miR-132b-5p and / or miR-101-2-5p in the preparation of products that promote lipid metabolism balance in chicken liver and / or enhance the ability of liver cells to resist oxidative stress and / or weaken liver cell autophagy.

4. Use of an agent for enhancing or promoting the expression of miR-132b-5p or an agent for reducing the adsorption of miR-132b-5p in the preparation of a product for promoting the balance of lipid metabolism in the liver of a chicken and / or enhancing the ability of liver cells to resist oxidative stress and / or reducing autophagy of liver cells, wherein the agent has a sequence as shown in SEQ ID NO.

76.

5. Use of an agent that enhances or promotes miR-101-2-5p expression or an agent that reduces miR-101-2-5p adsorption in the preparation of a product that promotes lipid metabolism balance in chicken liver and / or enhances the ability of liver cells to resist oxidative stress and / or weakens liver cell autophagy, wherein the agent has a sequence as shown in SEQ ID NO.

78.

6. Use of an agent for reducing or inhibiting CBFB gene expression in the preparation of a product for promoting lipid metabolism balance in chicken liver and / or enhancing liver cell antioxidant stress capacity and / or weakening liver cell autophagy, wherein the agent has a sequence as shown in SEQ ID NO. 84 to SEQ ID NO.

85.

7. A product for promoting lipid metabolism balance in chicken liver and / or enhancing liver cell anti-oxidative stress ability and / or reducing liver cell autophagy, characterized in that: It includes the reagent according to any one of claims 1, 2, 4 to 6 or the miR-132b-5p and / or miR-101-2-5p according to claim 3.

8. A method for promoting lipid metabolism balance in chicken liver and / or enhancing the ability of liver cells to resist oxidative stress and / or reducing liver cell autophagy for non-therapeutic and non-diagnostic purposes, characterized in that: include: The sequence shown in SEQ ID NO. 1 to SEQ ID NO. 2, or the sequence shown in SEQ ID NO. 3 to SEQ ID NO. 4, or the sequence shown in SEQ ID NO. 76, or the sequence shown in SEQ ID NO. 78, or the sequence shown in SEQ ID NO. 84 to SEQ ID NO. 85, or miR-132b-5p and / or miR-101-2-5p are transfected into primary chicken liver cells.

Images