Recombinant angiotensin converting enzyme inhibitory peptide, recombinant strain, preparation method and application of recombinant angiotensin converting enzyme inhibitory peptide

Abstract

The invention discloses a recombinant angiotensin converting enzyme inhibitory peptide, a recombinant strain, a preparation method and application of the recombinant angiotensin converting enzyme inhibitory peptide, and belongs to the technical field of genetic engineering and active peptides. The invention discloses a recombinant angiotensin converting enzyme inhibitory peptide. The amino acid sequence of the recombinant angiotensin converting enzyme inhibitory peptide is YWLKP. The ACE inhibitory activity of the recombinant angiotensin converting enzyme inhibitory peptide YWLKP disclosed by the invention is obviously improved compared with that of an original inhibitory peptide LYPVK, and the IC50 value is reduced from 10.6 + / -0.86 mu g / mL to 5.0 + / -0.62 mu g / mL. The recombinant angiotensin converting enzyme inhibitory peptide YWLKP disclosed by the invention has relatively strong intracellular antihypertensive activity, and is beneficial to the application of the recombinant angiotensin converting enzyme inhibitory peptide YWLKP in developing products with antihypertensive efficacy.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering and active peptide technology, and more specifically to a recombinant angiotensin converting enzyme inhibitory peptide, a recombinant strain, a preparation method and an application thereof. Background Art

[0002] Hypertension is the most common chronic disease, and its prevention, treatment and improvement are important tasks related to human life and health. Angiotensin converting enzyme (ACE) is a key enzyme involved in the blood pressure regulation system in the body, which can promote the production of angiotensin II and the degradation of bradykinin, thereby increasing blood pressure. ACE inhibitors such as captopril and enalapril can significantly lower blood pressure and are currently the main treatment method, but long-term medication will have certain side effects on the human body. Exploring safe and green ACE targeted inhibitors is a current research hotspot. ACE inhibitory peptides are bioactive peptides that are widely derived from food, act on ACE, and have the effect of lowering blood pressure. In recent years, research on their preparation, structural characterization, activity evaluation and mechanism of action has attracted much attention.

[0003] At present, ACE inhibitory peptides are mainly prepared by enzymatic hydrolysis of protein raw materials such as soybeans, oysters, and milk, followed by separation, purification, and characterization. Although the production cost is low, the target product has a low yield, low activity, and difficult and time-consuming separation and purification operations. In addition, the enzymatic hydrolysis product is a mixture with complex active components, making it difficult to accurately elucidate the antihypertensive mechanism of ACE inhibitory peptides. For example, the ACE inhibitory peptide VGLFPSRSF was prepared from tilapia skin using alkaline protease enzymatic hydrolysis. Its IC50 value for ACE inhibition was 61.43 μM, and the prepared product had a low content concentration, making it difficult to prepare high-purity inhibitory peptide products on a large scale from protein raw materials by enzymatic hydrolysis. The use of microorganisms for heterologous expression of recombinant proteins is a gradually emerging preparation technology that can generate target products, is simple to operate, easy to regulate, and easy to achieve large-scale production, and has broad application prospects.

[0004] Therefore, providing a recombinant angiotensin converting enzyme inhibitory peptide, a recombinant strain, a preparation method and application thereof is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a recombinant angiotensin converting enzyme inhibitory peptide, a recombinant strain, a preparation method and applications thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: A recombinant angiotensin converting enzyme inhibitory peptide, wherein the amino acid sequence of the recombinant angiotensin converting enzyme inhibitory peptide is YWLKP.

[0007] The present invention is based on the original ACE inhibitory peptide LYPVK amino acid sequence, adopts the idea that the molecular weight, hydrophobic residues, amino acid sequence distribution, arrangement and the type of amino acid residues at the end of the sequence will affect the inhibitory activity of the ACE peptide, and rationally designs its original amino acid sequence to obtain the amino acid sequence of the ACE inhibitory peptide with improved ACE inhibitory activity, and prepares the ACE inhibitory peptide by genetic engineering method to further verify its ACE inhibitory activity. And verify and compare the intracellular hypotensive effects of the two ACE inhibitory peptides, analyze the changes in the intracellular blood pressure-related product levels after the two ACE inhibitory peptides act, so as to explore the intracellular hypotensive effect.

[0008] The larger the molecular weight of the ACE inhibitory peptide, the more difficult it is to enter the active center of ACE, and the lower the ACE inhibitory activity; and according to the amino acid composition of the ACE active center, the hydrophobic amino acids, lysine and proline at the end of the ACE inhibitory peptide are easy to interact with ACE, which is more conducive to inhibiting the activity of ACE. Therefore, the above ideas are used to rationally design ACE inhibitory peptides and develop new ACE inhibitory peptides, which is conducive to improving their ACE inhibitory activity.

[0009] Furthermore, a recombinant expression vector contains multiple copies of the recombinant angiotensin converting enzyme inhibitory peptide YWLKP gene SEQ ID NO.1.

[0010] CATCATCATCATCATCATGATGATGACGATAAGTACTGGTTGAAACCCTATTGGTTAAAGCCTTACTGGCTTAAGCCATACTGGTTGAAACCCTATTGGTTAAAGCCTTACTGGCTTAAGCCATACTGGTTGAAACCCTATTGGTTAAAGCCTTACTGGCTTAAGCCA SEQ ID NO.1.

[0011] In SEQ ID NO.1, 1-18 bp are His-tag, 19-33 bp are enterokinase tag, and 34-333 bp are YWLKP tandem coding gene.

[0012] Furthermore, a recombinant strain of Escherichia coli is capable of expressing the recombinant angiotensin converting enzyme inhibitory peptide YWLKP.

[0013] Furthermore, in the method for preparing a recombinant angiotensin converting enzyme inhibitory peptide, the inhibitory peptide encoding gene is concatenated in multiple copies using codon degeneracy, the concatenated peptide is heterologously expressed in Escherichia coli, and after purification and proline endonuclease-specific enzymatic cleavage, the recombinant angiotensin converting enzyme inhibitory peptide YWLKP is obtained.

[0014] Furthermore, the recombinant angiotensin converting enzyme inhibitory peptide is used in the preparation of angiotensin converting enzyme inhibitors.

[0015] Furthermore, the recombinant angiotensin converting enzyme inhibitory peptide is used in the preparation of blood pressure lowering drugs.

[0016] Furthermore, an angiotensin converting enzyme inhibitor comprises the recombinant angiotensin converting enzyme inhibitory peptide as an active ingredient.

[0017] Furthermore, a blood pressure lowering pharmaceutical composition comprises the recombinant angiotensin converting enzyme inhibitory peptide.

[0018] Furthermore, a blood pressure lowering pharmaceutical preparation comprises the recombinant angiotensin converting enzyme inhibitory peptide or the blood pressure lowering pharmaceutical composition, and also comprises a pharmaceutically acceptable carrier.

[0019] Furthermore, the pharmaceutically acceptable carrier is suitable for tablets, capsules, powders, pills, granules, oral liquids, injections or emulsions.

[0020] It can be seen from the above technical scheme that, compared with the prior art, the present invention discloses a recombinant angiotensin converting enzyme inhibitory peptide, a recombinant strain, a preparation method and an application thereof. The inhibitory activity of the recombinant ACE inhibitory peptide YWLKP on ACE is improved compared with the original inhibitory peptide LYPVK, and IC 50 The value decreased from 10.6 ± 0.86 μg / mL to 5.0 ± 0.62 μg / mL. Cell experiments further verified that the intracellular hypotensive effect of the recombinant ACE inhibitory peptide YWLKP was improved compared with the original inhibitory peptide LYPVK, with an increase in NO content and a decrease in ET-1 content. The recombinant ACE inhibitory peptide YWLKP of the present invention is conducive to its application in the development of products with hypotensive effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0022] Figure 1 This is an amino acid comparison chart of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK.

[0023] Figure 2 This is the map of the recombinant expression vector of the recombinant ACE inhibitory peptide YWLKP.

[0024] Figure 3 The protein electrophoresis diagram and purified protein electrophoresis diagram of the tandem copy recombinant ACE inhibitory peptide YWLKP; wherein, A: protein electrophoresis diagram; M: protein marker; 1-4: cell fragmentation supernatant after single colony fermentation of different transformants; 5-6: cell fragmentation supernatant after single colony fermentation of different transformants without load; B: purified protein electrophoresis diagram; M: protein marker; 1: purified protein.

[0025] Figure 4 This is the HPLC molecular weight determination diagram of the tandem copy recombinant ACE inhibitory peptide YWLKP.

[0026] Figure 5 This is the HPLC molecular weight determination chart of the recombinant ACE inhibitory peptide YWLKP.

[0027] Figure 6 This is the mass spectrum of the recombinant ACE inhibitory peptide YWLKP.

[0028] Figure 7 IC of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK on ACE inhibition 50 value.

[0029] Figure 8 It is the cytotoxicity of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK.

[0030] Fig. 9 It is the intracellular NO content of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK.

[0031] Fig.10 It is the intracellular ET-1 content of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK. DETAILED DESCRIPTION

[0032] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] Example 1 Rational design of ACE inhibitory peptides The original ACE inhibitory peptide LYPVK (SEQ ID NO.3) was rationally designed to obtain the amino acid sequences of two inhibitory peptides as follows Figure 1 As shown, the sequence of the recombinant ACE inhibitory peptide of the present invention is YWLKP (SEQ ID NO.4).

[0034] Example 2 Construction of recombinant expression vector of recombinant ACE inhibitory peptide YWLKP The recombinant ACE inhibitory peptide YWLKP encoding gene (as shown in 34-333bp in SEQ ID NO.1) was obtained by using codon degeneracy, and a gene sequence containing a His-tag, an enterokinase tag and multiple copies of the YWLKP tandem encoding gene was artificially synthesized (as shown in SEQ ID NO.1). The artificially synthesized gene sequence was connected to the Escherichia coli expression vector pET28a(+) through NotⅠ (GCGGCCGC, C-terminus) and EcoRⅠ (GAATTC, N-terminus) to construct the recombinant expression vector YWLKP20-pET28a(+). The map of the recombinant expression vector is shown in Figure 2 , including a vector backbone, a His-tag, an enterokinase tag, and multiple copies of tandem peptide genes.

[0035] Example 3 Heterologous expression and purification of tandem recombinant ACE inhibitory peptide YWLKP The recombinant expression vector containing multiple copies of the tandem recombinant ACE inhibitory peptide YWLKP encoding gene was transformed into Escherichia coli BL21, positive transformants were screened, and further fermentation expression was performed. The fermentation expression conditions were 37°C, 180 rpm for 24 h, then adjusted to 20°C, and IPTG with a final concentration of 1 mM was added for induction, and fermentation was continued for 24 h. The fermentation product was the expressed tandem recombinant ACE inhibitory peptide YWLKP.

[0036] The fermentation product was centrifuged, the supernatant was removed, and the cells were collected. The collected cells were broken, and the supernatant of the broken cells was collected. The collected samples were tested by protein electrophoresis, and the results were as follows: Figure 3As shown in Figure A, compared with the empty fermentation sample (transformed with pET28a(+)), the transformant sample of the multi-copy tandem recombinant ACE inhibitory peptide YWLKP contained an additional single band between 11-17 kDa, which is almost consistent with the theoretical molecular weight of the multi-copy tandem recombinant ACE inhibitory peptide YWLKP (15.1 kDa).

[0037] The His-tag in the expression product was further purified by nickel magnetic beads, and the samples collected after purification were detected by protein electrophoresis. Figure 3 As shown in B, the purified sample contained a single band between 11-17 kDa (molecular weight of 15.1 kDa), indicating that the multi-copy tandem recombinant ACE inhibitory peptide YWLKP was successfully expressed and purified.

[0038] The molecular weight of the purified multi-copy tandem recombinant ACE inhibitory peptide YWLKP was further verified by HPLC. Figure 4 As shown, the sample has a single peak, and the peak time corresponds to the molecular weight (15.1 kDa), further indicating that the multi-copy tandem recombinant ACE inhibitory peptide YWLKP was successfully expressed and purified.

[0039] Example 4 Preparation of recombinant ACE inhibitory peptide YWLKP by specific enzymatic cleavage The purified multi-copy tandem recombinant ACE inhibitory peptide YWLKP was digested with enterokinase (sigma) at 37°C for 3 h to remove the histidine tag contained in the expression product; after enterokinase digestion, the molecular weight of the product was 13.7 kDa. The digestion product after enterokinase digestion was further specifically digested with proline endonuclease (sigma) at 37°C for 12 h. The digestion product was the prepared recombinant ACE inhibitory peptide YWLKP.

[0040] The prepared recombinant ACE inhibitory peptide YWLKP was subjected to HPLC molecular weight determination to confirm the accuracy of the prepared product. The results are as follows Figure 5 As shown, the sample has a single peak, and the peak time corresponds to the molecular weight (705.4 Da), indicating that the recombinant ACE inhibitory peptide YWLKP was successfully prepared.

[0041] Mass spectrometry analysis was performed on the prepared recombinant ACE inhibitory peptide YWLKP to further confirm the accuracy of the molecular weight of the prepared target product. Figure 6 As shown, the molecular weight of the sample is 705.4 Da, and the detected molecular weight is consistent with the theoretical molecular weight, indicating that the enzymatic cleavage product after specific enzymatic cleavage is the recombinant ACE inhibitory peptide YWLKP.

[0042] Example 5 Determination of ACE inhibitory activity of recombinant ACE inhibitory peptide YWLKP The ACE inhibitory activity of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK was determined using a visible spectrophotometer in a 96-well plate.

[0043] 1 mM N-[3-(2-furyl)acryloyl]-L-phenylalanylglycylglycine (FAPGG), 100 mL HEPES buffer (1.901 g HEPES reagent, 1.755 g NaCl reagent, pH 8.3), and 0.1 U / mL angiotensin converting enzyme (ACE) were prepared respectively.

[0044] 40 μL of different concentrations of recombinant ACE inhibitory peptide YWLKP or original ACE inhibitory peptide LYPVK samples, 40 μL of 1 mM FAPGG substrate, and 10 μL of 0.1 U / mL ACE were added to a 96-well plate in sequence. The final concentrations of recombinant ACE inhibitory peptide YWLKP or original ACE inhibitory peptide LYPVK samples were 2.5, 5, 10, and 20 μg / mL. The absorbance of the mixed system at 340 nm was measured using an ELISA reader. The system was placed in a 37°C shaker for 30 min. After the reaction, the absorbance at 340 nm was measured again using an ELISA reader. The ACE inhibition rate of the sample was determined by calculating the change in absorbance before and after the reaction. HEPES buffer (40 μL) was used as a blank control.

[0045] The calculation formula is: ACE inhibition rate % = 1-change in sample absorbance value / change in blank absorbance value. IC of ACE inhibitory peptide 50 The value is the ACE inhibitory peptide concentration when the inhibition rate of ACE is 50%.

[0046] The preparation method of the original ACE inhibitory peptide LYPVK is the same as that of the recombinant ACE inhibitory peptide YWLKP, wherein the multi-copy gene of the original ACE inhibitory peptide LYPVK is shown in SEQ ID NO.2.

[0047] CATCATCATCATCATCATGATGATGACGATAAGCTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAA CTGTATTCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAG; SEQ ID NO.2.

[0048] In SEQ ID NO.2, 1-18 bp are His-tag, 19-33 bp are enterokinase tag, and 34-333 bp are LYPVK tandem coding gene.

[0049] The results are as follows Figure 7 As shown, the IC of recombinant ACE inhibitory peptide YWLKP on ACE inhibition 50 The value was 5.0 ± 0.62 μg / mL, while the IC of the original ACE inhibitory peptide LYPVK on ACE inhibition was 50 The value was 10.6 ± 0.86 μg / mL, and the ACE inhibitory activity of the recombinant ACE inhibitory peptide YWLKP was improved.

[0050] Example 6 Study on the intracellular hypotensive effect of the recombinant ACE inhibitory peptide YWLKP Human umbilical vein endothelial cells EA.hy926 were used as the research object to explore the intracellular hypotensive effects of the recombinant ACE inhibitory peptide YWLKP of the present invention and the original ACE inhibitory peptide LYPVK. First, the toxicity of the two inhibitory peptide samples to cells was determined. Specifically: dilute the cells to make a cell suspension. The cells to be used were washed with PBS and digested with trypsin from the culture bottle, and then re-dissolved with complete culture medium to make a cell suspension, and counted with a hemocytometer. The cells were diluted to 2000 cells / well with complete culture medium, covered with 96-well plates, and placed in an incubator for about 24 hours to adhere to the wall. The supernatant culture fluid of each well of the cell was aspirated with a gun, and 100 μL of PBS solution was added to each well for washing, and then aspirated with a gun. The sample was diluted with a culture medium without FBS (i.e., DMEM-H+1% P / S, purchased from Gibco). The sample was weighed in advance, diluted to different concentrations in the clean bench, and sterilized by membrane. 100 μL of diluted sample was added to each well and placed in an incubator for about 24 hours. Use a gun to remove the supernatant culture medium from each well of the cells, add 100 μL PBS solution to each well for washing, and then remove it with a gun. Use a culture medium without FBS (i.e. DMEM-H + 1% P / S) to prepare CCK (the ratio is: 90 μL culture medium + 10 μL CCK). Add 100 μL of culture medium containing CCK to each well, place in an incubator for incubation, and measure the absorbance at 450 nm with an enzyme marker. Calculate the cell survival rate after treatment with the inhibitory peptide sample according to the cell viability formula.

[0051] The results are as follows Figure 8 As shown, the recombinant ACE inhibitory peptide YWLKP of the present invention and the original inhibitory peptide LYPVK are both non-cytotoxic. At a concentration of 2.5-40 μg / mL, the cell survival rate is greater than 90%, indicating that at the concentrations where the two inhibitory peptides effectively exert ACE inhibitory effects, they are non-toxic to endothelial cells. The antihypertensive drug Captopril (10 μg / mL Captopli) is a positive control. Control is a negative control.

[0052] The content of NO and ET-1 in cells is an important marker substance related to blood pressure. Whether the content of NO and ET-1 can be changed under the action of ACE inhibitory peptide is an important indicator for evaluating the antihypertensive effect of cells. The antihypertensive effect of the two inhibitory peptides was explored by measuring the NO content and ET-1 (endothelin 1) released by human umbilical vein endothelial cells EA.hy926 after treatment with the recombinant ACE inhibitory peptide YWLKP of the present invention and the original inhibitory peptide LYPVK. Captopril (10 µg / mL Captopli), a blood pressure-lowering drug, was used as a positive control. NO detection kit and ET-1 detection kit were used for detection.

[0053] The results of intracellular NO content are as follows Fig. 9As shown, after the action of the two inhibitory peptides, both peptides can increase the NO content released in cells compared with the negative control (Control). Under the same concentration treatment of the two inhibitory peptides, the NO content released by cells after treatment with the recombinant ACE inhibitory peptide YWLKP of the present invention is higher than that of the original inhibitory peptide LYPVK, indicating that the recombinant ACE inhibitory peptide YWLKP of the present invention has a stronger cell blood pressure lowering effect.

[0054] The results of intracellular ET-1 content are as follows Fig.10 As shown, compared with the negative control, both peptides can reduce the amount of ET-1 released into cells. Under the same concentration treatment of the two inhibitory peptides, the ET-1 content of cells after treatment with the recombinant ACE inhibitory peptide YWLKP of the present invention is lower than that of the original inhibitory peptide LYPVK, indicating that the recombinant ACE inhibitory peptide YWLKP of the present invention has a stronger effect of lowering blood pressure in cells.

[0055] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A recombinant angiotensin converting enzyme inhibitory peptide, characterized in that: The amino acid sequence of the recombinant angiotensin converting enzyme inhibitory peptide is YWLKP.

2. A recombinant expression vector, characterized in that: A multi-copy gene SEQ ID NO. 1 containing the recombinant angiotensin converting enzyme inhibitory peptide YWLKP according to claim 1.

3. A recombinant Escherichia coli strain, characterized in that: Capable of expressing the recombinant angiotensin converting enzyme inhibitory peptide YWLKP described in claim 1.

4. The method for preparing a recombinant angiotensin converting enzyme inhibitory peptide according to claim 1, characterized in that: The inhibitory peptide encoding gene was concatenated in multiple copies using codon degeneracy, and the concatenated peptide was heterologously expressed in Escherichia coli. After purification and proline endonuclease-specific enzymatic digestion, the recombinant angiotensin converting enzyme inhibitory peptide YWLKP was obtained.

5. Use of the recombinant angiotensin converting enzyme inhibitor peptide according to claim 1 in the preparation of angiotensin converting enzyme inhibitors.

6. Use of the recombinant angiotensin converting enzyme inhibitory peptide according to claim 1 in the preparation of antihypertensive drugs.

7. An angiotensin converting enzyme inhibitor, characterized in that The invention comprises the recombinant angiotensin converting enzyme inhibitory peptide according to claim 1 as an active ingredient.

8. A pharmaceutical composition for lowering blood pressure, characterized in that: The invention comprises the recombinant angiotensin converting enzyme inhibitory peptide as claimed in claim 1.

9. A drug preparation for lowering blood pressure, characterized in that: A pharmaceutical composition comprising the recombinant angiotensin converting enzyme inhibitory peptide according to claim 1 or the blood pressure lowering pharmaceutical composition according to claim 8, and also comprising a pharmaceutically acceptable carrier.

10. The blood pressure lowering pharmaceutical preparation according to claim 9, characterized in that: The pharmaceutically acceptable carrier is suitable for tablets, capsules, powders, pills, granules, oral liquids, injections or emulsions.

Images