Application of Zika virus virulence sites and / or testicular adaptive mutation sites

Abstract

This invention relates to the field of biotechnology and discloses the application of mutated gene sites in altering the virulence and / or testicular adaptation of Zika virus. This invention innovatively discovers testicular adaptation sites and novel virulence sites in Zika virus. Mutating these functional sites can yield Zika virus mutant strains with altered virulence and / or testicular adaptation, which is of great significance for Zika virus research, the construction of related animal models, and drug development.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of mutated gene sites in altering Zika virus virulence and / or testicular adaptability. Background Technology

[0002] Zika virus is a type of positive-sense RNA virus transmitted by insect vectors. Its genome has only one open reading frame, encoding a polyprotein consisting of three structural proteins and seven non-structural proteins. From N-terminus to C-terminus, this polyprotein consists of: capsid protein (C), pre-membrane protein (prM), and envelope protein (E); and the non-structural proteins are NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5.

[0003] Zika virus was the first flavivirus proven to be sexually transmitted, and it can also be transmitted vertically from mother to child. Besides causing serious illnesses such as viral encephalitis, microcephaly, and fetal death, Zika virus exhibits multi-tissue tropism; high viral loads have been detected in tissues and organs such as the placenta, uterus, and testes, indicating its potential to cause related diseases in the reproductive system. However, the infection and pathogenic mechanisms of Zika virus in reproductive system tissues and organs are currently unclear, which significantly hinders the development of related drugs and vaccines. Summary of the Invention

[0004] The purpose of this invention is to provide the application of mutated gene sites in altering Zika virus virulence and / or testicular adaptation. This invention innovatively discovers a testicular adaptation site of Zika virus, which is also a novel Zika virus virulence site. By performing (site-directed) mutations on this site, it is possible to achieve alterations in Zika virus virulence and / or testicular adaptation. This is of great significance for scientific and medical work such as developing new Zika virus vaccines and antibodies, and constructing new animal infection models of Zika virus.

[0005] To achieve the above objectives, the present invention provides, in one aspect, the application of a mutated gene site in altering the virulence of Zika virus, wherein the gene site is selected from at least one of the following in the Zika virus genome: a nucleotide encoding amino acid 401 of the E protein, a nucleotide encoding amino acid 444 of the E protein, a nucleotide encoding amino acid 117 of the NS2A protein, and a nucleotide encoding amino acid 146 of the NS1 protein.

[0006] The alteration of Zika virus virulence includes either increasing or decreasing virulence.

[0007] A second aspect of the present invention provides the application of a mutated gene site in altering the testicular adaptability of Zika virus, wherein the gene site is selected from at least one of the following in the Zika virus genome: a nucleotide encoding amino acid 401 of the E protein, a nucleotide encoding amino acid 444 of the E protein, a nucleotide encoding amino acid 117 of the NS2A protein, and a nucleotide encoding amino acid 146 of the NS1 protein.

[0008] The alteration of Zika virus virulence includes increasing or decreasing testicular adaptability.

[0009] A third aspect of the present invention provides a Zika virus mutant strain, wherein, compared with the wild-type virus strain, at least one of the following amino acids is mutated: amino acid 401 of the E protein, amino acid 444 of the E protein, amino acid 117 of the NS2A protein, and amino acid 146 of the NS1 protein.

[0010] The fourth aspect of the present invention provides a Zika virus attenuated mutant strain, wherein, compared with the wild-type virus strain, at least one of the following amino acids is mutated: amino acid 401 of the E protein, amino acid 444 of the E protein, amino acid 117 of the NS2A protein, and amino acid 146 of the NS1 protein.

[0011] A fifth aspect of the present invention provides a DNA molecule comprising an open reading frame in the Zika virus genome, wherein at least one of the nucleotides encoding amino acid 401 of the E protein, amino acid 444 of the E protein, amino acid 117 of the NS2A protein, and amino acid 146 of the NS1 protein is mutated.

[0012] The sixth aspect of this invention provides the use of the mutant strains described in the third aspect, and / or the attenuated mutant strains described in the fourth aspect, and / or the DNA molecules described in the fifth aspect in constructing animal models of Zika virus infection, particularly in constructing animal models of male reproductive system-related diseases caused by Zika virus infection.

[0013] The seventh aspect of the present invention provides the use of the mutant strain or a portion thereof described in the third aspect, and / or the attenuated mutant strain described in the fourth aspect, and / or the DNA molecule or a fragment thereof described in the fifth aspect in Zika virus research, and / or in the preparation of medicaments for the prevention and / or treatment of diseases caused by Zika virus infection.

[0014] Through the above technical solution, the present invention can achieve at least the following beneficial effects:

[0015] (1) This invention has discovered new Zika virus virulence and testicular adaptation sites. By performing site-directed mutations on these sites, the virulence and / or testicular adaptation of Zika virus can be effectively altered. This provides a basis for constructing new Zika virus infection models and is of great significance for the development of new drugs to prevent and treat diseases caused by Zika virus infection.

[0016] (2) This invention is the first to discover gene loci in Zika virus that are related to testicular adaptation. By mutating the above-mentioned loci discovered in this invention, Zika virus mutant strains with altered testicular adaptation can be obtained, which is of great significance for the study of reproductive organ diseases such as testes caused by Zika virus infection and the development of related drugs.

[0017] (3) By using the new Zika virus virulence and testicular adaptation sites provided by this invention to mutate wild-type Zika virus strains, mutant strains with altered virulence and / or testicular adaptation can be obtained, which helps to obtain new Zika virus attenuated live vaccine candidates, thereby enabling the development of new Zika virus vaccines and other drugs.

[0018] (4) Compared with the parent strain, the Zika virus mutant strains provided by this invention exhibit alterations in testicular tropism, testicular tissue damage ability, and neurotoxicity. Some mutant strains show increased testicular tropism and damage ability, as well as increased neurotoxicity, while others show decreased testicular tropism, testicular tissue damage ability, and neurotoxicity. The mutant strains provided by this invention can be used to construct animal models of male reproductive system diseases caused by Zika virus infection or as candidate strains for Zika virus attenuated live vaccines, laying the foundation for the development of new Zika vaccines, research on the infection and pathogenic mechanisms of Zika virus in reproductive system tissues and organs, and the development of related drugs. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the process of continuous passage of FSS13025 in the testes of A129 mice in Example 1.

[0020] Figure 2A-2B This is a graph showing the plaque assay results of the recombinant mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E, as well as the parent strain FSS13025, in Test Example 1. Figure 2A This is a diagram of the morphology of the empty spot. Figure 2B This is a statistical chart of the diameter of the empty spots.

[0021] Figure 3This is a comparison of the proliferation of the recombinant double-point mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E, as well as the parental strain FSS13025, in primary Sertoli cells of human testis in Test Example 2.

[0022] Figures 4A-4B The test example 3 involved recombinant double-point mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E, which, along with the parental strain FSS13025, were used in mouse testicular cell line 15P-1. Figure 4A ) and TM3 ( Figure 4B A comparison chart of replication capabilities in ( ).

[0023] Figures 5A-5B This is a comparison of viral load in the testicular tissue of C57BL / 6J male mice using the recombinant double-point mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E, as well as the parental strain FSS13025, in Test Example 4. Figure 5A ) and pathological damage detection images of testicular tissue ( Figure 5B ).

[0024] Figure 6 This is a comparison of viral load in the brain tissue of A129 mice of the recombinant double-point mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E, as well as the parental strain FSS13025, in Test Example 5.

[0025] Figures 7A-7B The test results were obtained from the recombinant single-point mutant viruses FSS13025-G444A, FSS13025-A117V, and FSS13025-K146E in A129 mouse brain tissue (Example 6). Figure 7A ) and testes ( Figure 7B Comparison chart of viral load in ( ).

[0026] Figures 8A-8B This test examines the binding affinity of recombinant mutant viruses FSS-G444A+A117V, FSS-G444A, and FSS-A117V, as well as the parental strain FSS13025, to BHK-21 cells in Example 7. Figure 8A ) and accessibility ( Figure 8B Comparison chart.

[0027] Figure 9 This is a comparison of the replication capabilities of attenuated mutant viruses FSS-A117G and FSS-H401A, as well as the parent strain FSS13025, in the sensitive BHK-21 cell line in test example 8.

[0028] Figure 10 This is a comparison of the lethality of attenuated mutant viruses FSS-A117G and FSS-H401A, as well as the parent strain FSS13025, when injected intracranially into ICR suckling mice in Test Example 9. Detailed Implementation

[0029] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0030] In this invention, unless otherwise specified, (viral) virulence refers to the pathogenicity of the Zika virus strain, especially its ability to replicate in brain tissue / nerve cells after Zika virus infection, i.e., neurovirulence. Viral virulence can usually be determined by detecting the viral load in the brain tissue / nerve cells of experimental animals or nerve cells after a period of infection with the virus strain. The higher the viral load in the brain tissue / nerve cells after a certain period of infection, the stronger the neurotropism of the virus strain, i.e., the stronger its neurovirulence. Testicular adaptability includes the replication ability of Zika virus in testicular tissue / cells and its ability to damage testicular tissue. It can usually be determined by detecting the viral load in the testicular tissue of the cell line / animal and the degree of testicular tissue damage in the infected animal after a period of Zika virus infection with testicular cell lines or experimental animals. The higher the viral load in the testicular cell line / testicular tissue and the more severe the damage to the testicular tissue in the infected animal after a certain period of infection, the stronger the testicular adaptability of the virus strain.

[0031] The inventors of this invention accidentally discovered during their testicular passage study of Zika virus that mutations in the coding genes for amino acids 401, 444, 117, and 146 of the Zika virus genome significantly affected the virulence and testicular adaptability of the Zika virus. Further research confirmed that these gene loci are novel functional sites in the Zika virus genome related to viral virulence and / or testicular adaptability.

[0032] Based on this, the first aspect of the present invention provides the application of a mutated gene site in altering the virulence of Zika virus, wherein the gene site is selected from at least one of the following in the Zika virus genome: a nucleotide encoding amino acid 401 of the E protein, a nucleotide encoding amino acid 444 of the E protein, a nucleotide encoding amino acid 117 of the NS2A protein, and a nucleotide encoding amino acid 146 of the NS1 protein.

[0033] The alteration of Zika virus virulence includes either increasing or decreasing virulence.

[0034] In this invention, the mutation can be a mutation of one of the aforementioned gene loci, or a mutation of any combination of several of the aforementioned gene loci. These mutations will cause changes in the virulence of the Zika virus, but the specific degree of change may vary. This invention does not impose any particular limitation on the number or combination of gene loci involved in the specific mutation.

[0035] According to a preferred embodiment of the present invention, the mutation causes the 401st amino acid of the E protein to be tyrosine (Y) or alanine (A).

[0036] According to a preferred embodiment of the present invention, the mutation causes the 444th amino acid of the E protein to be alanine (A).

[0037] According to a preferred embodiment of the present invention, the mutation causes the 117th amino acid of the NS2A protein to be valine (V) or glycine (G).

[0038] According to a preferred embodiment of the present invention, the mutation causes the 146th amino acid of the NS1 protein to be glutamic acid (E).

[0039] In this invention, a mutant Zika virus with altered virulence (such as increased or decreased) can be obtained by mutating any one or more of the above-mentioned sites. This invention does not impose any particular limitation on the specific mutation sites or combinations of mutation sites; any mutation method that can achieve the above objectives is within the scope of this invention.

[0040] According to some preferred embodiments of the present invention, the mutation may result in amino acid A at position 444 of the E protein and amino acid V at position 117 of the NS2A protein.

[0041] According to some preferred embodiments of the present invention, the mutation results in amino acid Y at position 401 of the E protein and amino acid E at position 146 of the NS1 protein.

[0042] According to some preferred embodiments of the present invention, the mutation may (only) make the 444th amino acid of the E protein A.

[0043] According to some preferred embodiments of the present invention, the mutation may (only) make the 401st amino acid of the E protein Y.

[0044] According to some preferred embodiments of the present invention, the mutation may (only) result in amino acid A at position 401 of the E protein.

[0045] According to some preferred embodiments of the present invention, the mutation may (only) result in amino acid V at position 117 of the NS2A protein.

[0046] According to some preferred embodiments of the present invention, the mutation may (only) result in the NS2A protein having amino acid G at position 117.

[0047] According to some preferred embodiments of the present invention, the mutation may (only) result in amino acid E at position 146 of the NS1 protein.

[0048] In this invention, the mutation at the aforementioned gene loci refers to the mutation of the Zika virus mutant strain relative to the wild type. Since the aforementioned gene loci were discovered based on FSS13025 (GenBank Accession No. KU955593), the actual gene loci causing changes in viral virulence due to mutations may differ for different wild-type Zika viruses, but they should all correspond to the aforementioned loci in FSS13025.

[0049] According to a preferred embodiment of the present invention, the (wild-type) Zika virus is FSS13025.

[0050] Preferably, the mutation causes the amino acid at position 401 of the E protein to change from histidine (H) to tyrosine (Y) or alanine (A).

[0051] Preferably, the mutation causes the 444th amino acid of the E protein to change from glycine (G) to alanine (A).

[0052] Preferably, the mutation causes the amino acid at position 117 of the NS2A protein to change from alanine (A) to valine (V) or glycine (G).

[0053] Preferably, the mutation causes the 146th amino acid of the NS1 protein to change from lysine (K) to glutamic acid (E).

[0054] According to some preferred embodiments of the present invention, the mutation may cause the 444th amino acid of the E protein to mutate from G to A and the 117th amino acid of the NS2A protein to mutate from A to V.

[0055] According to some preferred embodiments of the present invention, the mutation causes the amino acid at position 401 of the E protein to change from H to Y and the amino acid at position 146 of the NS1 protein to change from K to E.

[0056] According to some preferred embodiments of the present invention, the mutation may (only) cause the 444th amino acid of the E protein to be mutated from G to A.

[0057] According to some preferred embodiments of the present invention, the mutation may (only) cause the 401st amino acid of the E protein to be mutated from H to Y.

[0058] According to some preferred embodiments of the present invention, the mutation may (only) cause the 401st amino acid of the E protein to be mutated from H to A.

[0059] According to some preferred embodiments of the present invention, the mutation may (only) cause the amino acid at position 117 of the NS2A protein to change from A to V.

[0060] According to some preferred embodiments of the present invention, the mutation may (only) cause the amino acid at position 117 of the NS2A protein to be mutated from A to G.

[0061] According to some preferred embodiments of the present invention, the mutation may (only) cause the 146th amino acid of the NS1 protein to be mutated from K to E.

[0062] A second aspect of the present invention provides the application of a mutated gene site in altering the testicular adaptability of Zika virus, wherein the gene site is selected from at least one of the following in the Zika virus genome: a nucleotide encoding amino acid 401 of the E protein, a nucleotide encoding amino acid 444 of the E protein, a nucleotide encoding amino acid 117 of the NS2A protein, and a nucleotide encoding amino acid 146 of the NS1 protein.

[0063] The alteration of Zika virus virulence includes increasing or decreasing testicular adaptability.

[0064] In this invention, the mutation can be a mutation of one of the aforementioned gene loci, or a mutation of any combination of several of the aforementioned gene loci. These mutations lead to changes in the testicular adaptability of the Zika virus, but the specific degree of change may vary. This invention does not impose any particular limitation on the number or combination of specific gene loci mutated.

[0065] According to a preferred embodiment of the present invention, the mutation causes the 401st amino acid of the E protein to be tyrosine (Y) or alanine (A).

[0066] According to a preferred embodiment of the present invention, the mutation causes the 444th amino acid of the E protein to be alanine (A).

[0067] According to a preferred embodiment of the present invention, the mutation causes the 117th amino acid of the NS2A protein to be valine (V) or glycine (G).

[0068] According to a preferred embodiment of the present invention, the mutation causes the 146th amino acid of the NS1 protein to be glutamic acid (E).

[0069] According to some preferred embodiments of the present invention, the mutation may result in amino acid A at position 444 of the E protein and amino acid V at position 117 of the NS2A protein.

[0070] According to some preferred embodiments of the present invention, the mutation results in amino acid Y at position 401 of the E protein and amino acid E at position 146 of the NS1 protein.

[0071] According to some preferred embodiments of the present invention, the mutation may (only) make the 444th amino acid of the E protein A.

[0072] According to some preferred embodiments of the present invention, the mutation may (only) make the 401st amino acid of the E protein Y.

[0073] According to some preferred embodiments of the present invention, the mutation may (only) result in amino acid A at position 401 of the E protein.

[0074] According to some preferred embodiments of the present invention, the mutation may (only) result in amino acid V at position 117 of the NS2A protein.

[0075] According to some preferred embodiments of the present invention, the mutation may (only) result in the NS2A protein having amino acid G at position 117.

[0076] According to some preferred embodiments of the present invention, the mutation may (only) result in amino acid E at position 146 of the NS1 protein.

[0077] In this invention, the mutations at the aforementioned gene loci refer to the mutations of Zika virus mutant strains relative to the wild type. Since these gene loci were discovered based on FSS13025 (GenBank Accession No. KU955593), the actual gene loci causing viral testicular adaptation changes may differ for different wild-type Zika viruses, but they should all correspond to the aforementioned loci in FSS13025.

[0078] According to a preferred embodiment of the present invention, the (wild-type) Zika virus is FSS13025.

[0079] Preferably, the mutation causes the amino acid at position 401 of the E protein to change from histidine (H) to tyrosine (Y) or alanine (A).

[0080] Preferably, the mutation causes the 444th amino acid of the E protein to change from glycine (G) to alanine (A).

[0081] Preferably, the mutation causes the amino acid at position 117 of the NS2A protein to change from alanine (A) to valine (V) or glycine (G).

[0082] Preferably, the mutation causes the 146th amino acid of the NS1 protein to change from lysine (K) to glutamic acid (E).

[0083] According to some preferred embodiments of the present invention, the mutation may cause the 444th amino acid of the E protein to mutate from G to A and the 117th amino acid of the NS2A protein to mutate from A to V.

[0084] According to some preferred embodiments of the present invention, the mutation causes the amino acid at position 401 of the E protein to change from H to Y and the amino acid at position 146 of the NS1 protein to change from K to E.

[0085] According to some preferred embodiments of the present invention, the mutation may (only) cause the 444th amino acid of the E protein to be mutated from G to A.

[0086] According to some preferred embodiments of the present invention, the mutation may (only) cause the 401st amino acid of the E protein to be mutated from H to Y.

[0087] According to some preferred embodiments of the present invention, the mutation may (only) cause the 401st amino acid of the E protein to be mutated from H to A.

[0088] According to some preferred embodiments of the present invention, the mutation may (only) cause the amino acid at position 117 of the NS2A protein to change from A to V.

[0089] According to some preferred embodiments of the present invention, the mutation may (only) cause the amino acid at position 117 of the NS2A protein to be mutated from A to G.

[0090] According to some preferred embodiments of the present invention, the mutation may (only) cause the 146th amino acid of the NS1 protein to be mutated from K to E.

[0091] A third aspect of this invention provides a Zika virus mutant strain, which, compared to the wild-type strain, has a mutation in at least one of the following: amino acid position 401 of the E protein, amino acid position 444 of the E protein, amino acid position 117 of the NS2A protein, and amino acid position 146 of the NS1 protein. Compared to the wild-type strain, the mutant strain exhibits altered viral virulence and / or testicular adaptability, which may be increased or decreased.

[0092] According to some preferred embodiments of the present invention, the wild-type virus strain is FSS13025.

[0093] Preferably, in the mutant strain, the 401st amino acid of the E protein is mutated from H to Y or A.

[0094] Preferably, in the mutant strain, the 444th amino acid of the E protein is mutated from G to A.

[0095] Preferably, in the mutant strain, the 117th amino acid of the NS2A protein is mutated from A to V or G.

[0096] Preferably, in the mutant strain, the 146th amino acid of the NS1 protein is mutated from K to E.

[0097] According to a preferred embodiment of the present invention, in the mutant strain, the 444th amino acid of the E protein is mutated from G to A and the 117th amino acid of the NS2A protein is mutated from A to V.

[0098] According to a preferred embodiment of the present invention, in the mutant strain, the 401st amino acid of the E protein is mutated from H to Y and the 146th amino acid of the NS1 protein is mutated from K to E.

[0099] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 444th amino acid of the E protein is mutated from G to A.

[0100] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 401st amino acid of the E protein is mutated from H to Y.

[0101] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 401st amino acid of the E protein is mutated from H to A.

[0102] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 117th amino acid of the NS2A protein is mutated from A to V.

[0103] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 117th amino acid of the NS2A protein is mutated from A to G.

[0104] According to a preferred embodiment of the present invention, in the mutant strain, (only) the 146th amino acid of the NS1 protein is mutated from K to E.

[0105] More preferably, in the mutant strain, amino acid position 401 of the E protein is mutated from H to Y and / or amino acid position 146 of the NS1 protein is mutated from K to E. Compared to the wild type, this mutant strain exhibits improved virulence and testicular adaptability.

[0106] More preferably, in the mutant strain, amino acid position 444 of the E protein is mutated from G to A and / or amino acid position 117 of the NS2A protein is mutated from A to V. Compared to the wild type, this mutant strain exhibits improved virulence and testicular adaptability.

[0107] A fourth aspect of this invention provides an attenuated Zika virus mutant strain, wherein, compared to the wild-type strain, at least one of the following amino acids is mutated: amino acid 401 of the E protein, amino acid 444 of the E protein, amino acid 117 of the NS2A protein, and amino acid 146 of the NS1 protein. The attenuated mutant strain exhibits reduced virulence compared to the wild-type strain, thus possessing the potential for use as a live attenuated vaccine. However, the testicular adaptability of the attenuated mutant strain is not necessarily reduced compared to the wild-type strain; the testicular adaptability may be lower than, higher than, or equal to that of the wild-type strain. It should be noted that the above mutation sites are based on FSS13025 (GenBank Accession No. KU955593). Therefore, the actual mutation sites may differ for different wild-type Zika viruses, but they should all correspond to the sites described above in FSS13025.

[0108] According to some preferred embodiments of the present invention, the wild-type virus strain is FSS13025.

[0109] Preferably, in the attenuated mutant strain, only the 117th amino acid of the NS2A protein is mutated from A to G, relative to the wild-type virus (FSS13025).

[0110] Preferably, relative to the wild-type virus (FSS13025), the attenuated mutant strain has an amino acid mutation at position 401 of the E protein that is changed from H to A.

[0111] A fifth aspect of the present invention provides a DNA molecule comprising an open reading frame in the Zika virus genome, wherein at least one of the nucleotides encoding amino acid 401 of the E protein, amino acid 444 of the E protein, amino acid 117 of the NS2A protein, and amino acid 146 of the NS1 protein is mutated.

[0112] Due to the degeneracy of codons, changes in nucleotides within a gene may not alter the encoded amino acid. Those skilled in the art will understand that, in this invention, the mutation of nucleotides in the DNA molecule refers to a mutation in the nucleotide encoding the amino acid that alters the encoded amino acid.

[0113] According to a preferred embodiment of the present invention, the mutation causes the 401st amino acid of the E protein to be Y or A.

[0114] According to a preferred embodiment of the present invention, the mutation causes amino acid A at position 444 of the E protein.

[0115] According to a preferred embodiment of the present invention, the mutation causes the 117th amino acid of the NS2A protein to be V or G.

[0116] According to a preferred embodiment of the present invention, the mutation causes amino acid E at position 146 of the NS1 protein.

[0117] Preferably, the mutation results in amino acid A at position 444 of the E protein and amino acid V at position 117 of the NS2A protein.

[0118] Preferably, the mutation results in amino acid Y at position 401 of the E protein and amino acid E at position 146 of the NS1 protein.

[0119] Preferably, the mutation (only) makes amino acid A at position 444 of the E protein.

[0120] Preferably, the mutation (only) makes amino acid Y at position 401 of the E protein.

[0121] Preferably, the mutation (only) makes amino acid A at position 401 of the E protein.

[0122] Preferably, the mutation (only) makes amino acid V at position 117 of the NS2A protein.

[0123] Preferably, the mutation (only) makes the 117th amino acid of the NS2A protein G.

[0124] Preferably, the mutation (only) makes amino acid E at position 146 of the NS1 protein.

[0125] More preferably, the DNA molecule encodes the mutant strain described in the third aspect, or the DNA molecule encodes the attenuated mutant strain described in the fourth aspect.

[0126] The sixth aspect of this invention provides the use of the mutant strains described in the third aspect, and / or the attenuated mutant strains described in the fourth aspect, and / or the DNA molecules described in the fifth aspect in constructing animal models of Zika virus infection, particularly in constructing animal models of male reproductive system-related diseases caused by Zika virus infection.

[0127] For example, animal models such as male reproductive system damage models (caused by Zika virus infection) can be constructed using the mutant strains, attenuated mutant strains, and DNA molecules provided by this invention. These models can be used for the research and development and production of related treatment plans and drugs. Other types of animal models can also be constructed using the mutant strains, attenuated mutant strains, and DNA molecules provided by this invention to study the relationship and pathogenesis of Zika virus infection and related diseases of the male reproductive system.

[0128] Based on the Zika virus virulence and testicular adaptive functional sites discovered in this invention, further research on the Zika virus and the development of related drugs are possible. For example, new Zika virus antibodies, live attenuated vaccines, and other drugs for the prevention and / or treatment of diseases caused by Zika virus infection can be developed based on the functional gene sites discovered in this invention.

[0129] Therefore, the seventh aspect of this invention provides the use of the mutant strain or a portion thereof described in the third aspect, and / or the attenuated mutant strain or a portion thereof described in the fourth aspect, and / or the DNA molecule or a fragment thereof described in the fifth aspect in Zika virus research, and / or in the preparation of medicaments for the prevention and / or treatment of diseases caused by Zika virus infection. The term "mutant strain or a portion thereof" or "attenuated mutant strain or a portion thereof" refers to a complete mutant strain or an attenuated mutant strain, or material derived from a mutant strain or an attenuated mutant strain (e.g., using one or more proteins, fragments of one or more proteins, a genome, a genome fragment, etc.); the term "DNA molecule or a fragment thereof" refers to a complete DNA molecule or one or more fragments thereof (e.g., the complete DNA molecule provided by this invention, or one or more fragments thereof, can be used for the development and preparation of related drugs, etc.).

[0130] According to some preferred embodiments of the present invention, the drug preferably includes antibodies and / or vaccines, and the vaccine is preferably a live attenuated vaccine.

[0131] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0132] In the following examples, unless otherwise specified, all reagents and materials used were commercially available products from reputable chemical or biological laboratory supply suppliers, and all reagents were of analytical grade. Unless otherwise specified, the gene sequencing work in the following examples was performed by Norsys.

[0133] Example 1

[0134] This embodiment illustrates the construction and identification of the Zika virus mutant strain provided by the present invention.

[0135] Reference Figure 1 The method described in the paper uses the full-length infectious clone pACNR of the Zika virus Asian strain (FSS13025, GenBank Accession No. KU955593) (construction method refers to Shan et al., 2016, Cell Host & Microbe). Based on strains 19,891–900, continuous passages were performed in A129 mice, and each generation of virus was observed. Two mutant strains with significantly enhanced testicular adaptability and neurotoxicity were found. By performing full genome sequencing on these two mutant strains, it was found that in one strain, amino acid 444 of the E protein was mutated from glycine (G) to alanine (A), and amino acid 117 of the NS2A protein was mutated from alanine (A) to valine (V), denoted as FSS-G444A+A117V; in the other strain, amino acid 401 of the E protein was mutated from histidine (H) to tyrosine (Y), and amino acid 146 of the NS1 protein was mutated from lysine (K) to glutamic acid (E), denoted as FSS-H401Y+K146E.

[0136] To further investigate the relationship between the mutation sites of the two mutant strains and the virulence and testicular adaptability of Zika virus, the following methods were used to construct, identify, and rescue the full-length clone of the recombinant mutant virus.

[0137] I. Construction and Identification of Full-Length Genome Clones of Zika Virus Recombinant Mutant Strains

[0138] The primer sequences used in the following experiments are detailed in Table 1, the PCR reaction system and procedure are detailed in Table 2, and the seamless reaction system is detailed in Table 3.

[0139] Using the full-length infectious cloning plasmid of FSS13025 (GenBank Accession No. KU955593) (construction method can be found in Shan et al., 2016, Cell Host & Microbe 19, 891–900) as a template, PCR amplification was performed using Prime StarMax polymerase (purchased from TaKaRa) with FSS-G444A-F and FSS-A117V-R as the first primer pair and FSS-A117V-F and FSS-G444A-R as the second primer pair, obtaining two DNA fragments containing G444A and A117V mutations. The two amplified DNA fragments were then phosphorylated using seamless enzyme (purchased from BioMed), followed by phosphate group ligation for DNA fragment ligation, circularization, and template removal through specific recognition of E. coli methylation, ultimately yielding the recombinant mutant viral plasmid of FSS-G444A+A117V mutant virus.

[0140] Using the same method as described above, with the full-length infectious cloning plasmid of FSS13025 as a template, and FSS-H401Y-F and FSS-K146E-R as the first primer pair and FSS-K146E-F and FSS-H401Y-R as the second primer pair, the recombinant mutant virus plasmid of FSS-H401Y+K146E mutant virus was obtained.

[0141] Using the same method as described above, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-G444A-F and FSS-G444A-R as primer pairs, the recombinant mutant virus plasmid of FSS-G444A mutant virus was obtained.

[0142] Using the same method as described above, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-A117V-F and FSS-A117V-R as primer pairs, the recombinant mutant virus plasmid of FSS-A117V mutant virus was obtained.

[0143] Using the same method as described above, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-H401Y-F and FSS-H401Y-R as primer pairs, the recombinant mutant virus plasmid of FSS-H401Y mutant virus was obtained.

[0144] Using the same method as described above, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-K146E-F and FSS-K146E-R as primer pairs, the recombinant mutant virus plasmid of FSS-K146E mutant virus was obtained.

[0145] Using the same method as described above, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-A117G-F and FSS-A117G-R as primer pairs, the recombinant mutant virus plasmid of FSS-A117G mutant virus was obtained.

[0146] Using the same method as described above, with the full-length infectious clone plasmid of FSS13025 as a template and FSS-H401A-F and FSS-H401A-R as primer pairs, the recombinant mutant virus plasmid of FSS-H401A mutant virus was obtained.

[0147] Table 1

[0148] Primer name Sequence (5′-3′) FSS-G444A-F GGTGCTCTCAACTCACTGGGCAAGGCCATCCATCAAATTT FSS-G444A-R GGTGCTCTCAACTCACTGGGCAAGGCCATCCATCAAATTT FSS-A117V-F TTGGCCTCGTGTCTTCTGCAAACTGTGATCTCCGCCTT FSS-A117V-R AAGACACGAGGCCAAGGCCAGCAGCATGCTCTCACG FSS-H401Y-F GGAAAAGAAGATCACCCACCACTGGTACAGGAGTGGCAGC FSS-H401Y-R GTGATCTTCTTTTCCCCGACTCCTATGACAATGTAAGAGT FSS-K146E-F GGTGACACACTGAAGGAATGCCCACTCGAACATAGAGCAT FSS-K146E-R CTTCAGTGTGTCACCATCCACGACAAAGCTGTTATTTGTC FSS-A117G-F CTCGTGTCTCTGCAAACTGGGATCTCCGCC FSS-A117G-R AAGACACGAGGCCAAGGCCAGCAGCA FSS-H401A-F GGAAAAGAAGATCACCCACCACTGGGCCAGGAGTGGCAGC FSS-H401A-R GTGATCTTCTTTTCCCCGACTCCTATGACAATGTAAGAGT

[0149] Table 2

[0150]

[0151] Table 3

[0152]

[0153] The seamless product was transformed into competent E. coli HB101 (purchased from TaKaRa), and single clones were selected and sent to Norsys for sequencing. The sequencing results of the full-length infectious clone plasmid with recombinant mutation were compared with the FSS13025 genome sequence, and the results are detailed in Table 4.

[0154] Table 4

[0155]

[0156] As can be seen from the results in Table 4, the full-length clones of both the two-point and single-point mutant viruses were constructed correctly.

[0157] II. Rescue of Zika virus recombinant mutant strains

[0158] 1. In vitro transcription of the full-length infectious clone of the Zika virus recombinant mutant strain

[0159] The full-length infectious clone plasmids of the recombinant mutant viruses in Table 4 were extracted using a plasmid large-scale extraction kit (purchased from Invitrogen). After digestion with Cla I enzyme, the plasmids were extracted with phenol-chloroform. The linearized plasmids were quantified, aliquoted, and stored at -20°C for later use.

[0160] Table 5

[0161]

[0162] Using the reaction system and conditions in Table 5, and with the full-length infectious clonal plasmid of the linearized recombinant mutant virus as a template, in vitro transcription was performed using the RiboMAX Large Scale RNA Production System-T7RiboMAX (purchased from Promega) to obtain transcriptomic RNA.

[0163] 2. Rescue of Zika virus recombinant mutant viruses

[0164] Transcriptosomal RNA was transfected into monolayer BHK-21 cells (purchased from ATCC, catalog number CCL-10) using Lipofectamine 3000 (Invitrogen). The procedure was as follows: First, 50 μL of OPTI-MEM was mixed with 4 μL of liposomes and incubated at room temperature for 5 min. Then, 10 μL of RNA (5 μg) and 50 μL of OPTI-MEM were mixed and incubated at room temperature for another 20 min. This mixture was then added to one well of a 6-well plate, along with 450 μL of OPTI-MEM. The plate was incubated at 37°C with 5% CO2 for 6 h. After removing the supernatant, DMEM maintenance medium containing 2% FBS was added, and the plate was incubated at 37°C with 5% CO2. Once cytopathic effects appeared, the supernatant was collected by centrifugation. The supernatant was reseeded into BHK-21 cells, and once cytopathic effects appeared, the supernatant was collected by centrifugation. The supernatant is the seed culture for the recombinant mutant strain to restore the virus. It is named according to the mutation as FSS-G444A+A117V, FSS-H401Y+K146E, FSS-G444A, FSS-A117V, FSS-H401Y, FSS-K146E, FSS-A117G, and FSS-H401A, and stored at -80℃ for later use. Among them, FSS-G444A+A117V and FSS-H401Y+K146E are recombinant double-point mutant viruses; FSS-G444A, FSS-A117V, FSS-H401Y, and FSS-K146E are recombinant single-point mutant viruses; and FSS-A117G and FSS-H401A are recombinant attenuated mutant viruses.

[0165] Test Example 1

[0166] This test case illustrates the plaque characteristics of BHK-21 cells infected with the recombinant two-point mutant strain obtained in Example 1.

[0167] The recombinant mutant virus was diluted 10-fold to 10... -1 10 -2 10 -3 10 -4 10 -5 10 -6 and 10 -7 400 μL / well was seeded into a monolayer of BHK-21 cells in 12-well plates. After adsorption for 1-2 h, the virus solution was discarded, and 1% agar containing DMEM medium (2% FBS) was added as a cap. The plates were then incubated at 37°C with 5% CO2. After 4 days, the cells were fixed with 4% formaldehyde at room temperature for 1 h, the agar cap was discarded, and the cells were stained with crystal violet at room temperature for 10 min. The morphology of the plaques was observed, and the plaque-forming units (PFU) were calculated. The plaques of the parental virus strain (i.e., wild-type strain FSS13025) were measured and analyzed using the same method as a control.

[0168] The results of the plaque assay showed that the recombinant mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E could form plaques of relatively uniform size and clear edges. Furthermore, the plaque diameter of the recombinant double-point mutant virus was significantly larger than that of the parent strain FSS13025, thus exhibiting a significant large-plaque characteristic (see details). Figure 2A and Figure 2B ).

[0169] Test Example 2

[0170] This test case illustrates the replication characteristics of the recombinant two-point mutant strain obtained in Example 1 within primary Sertoli cells of the human testis.

[0171] Recombinant double-point mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E, along with the parental virus strain, were inoculated at MOI=1 into 24-well human primary Sertoli cells (purchased from Beina Chuanglian Biotechnology Co., Ltd.). After adsorption for 1 h in a 37°C, 5% CO2 incubator, the virus solution was discarded, and DMEM containing 2% FBS was added. The cells were then incubated at 37°C with 5% CO2. Cell supernatant was collected at 24 h, 48 h, and 72 h post-inoculation. Virus titer was determined using plaque titer, and a one-step growth curve was plotted. The results are shown below. Figure 3 As shown. The parental strain of virus (i.e., wild-type strain FSS13025) was measured and analyzed using the same method as a control.

[0172] from Figure 3 It can be seen that the recombinant double-point mutant viruses FSS13025-G444A+A117V and FSS13025-H401Y+K146E exhibited stronger replication capabilities in human primary Sertoli cells than their parental virulent strains. Replication peaks were reached in human primary Sertoli cells at 48 hours post-infection. This indicates that the recombinant double-point mutant viruses replicate effectively in testicular cell lines, and their replication efficiency is significantly stronger than that of the parental strains.

[0173] Test Example 3

[0174] This test case illustrates the replication characteristics of the recombinant two-point mutant strain obtained in Example 1 within a mouse testicular cell line.

[0175] Recombinant double-point mutant viruses FSS-G444A+A117V and FSS-H401Y+K146E, along with the parental virus strain FSS13025, were inoculated at MOI=1 into 15P-1 and TM3 cells (all purchased from Wuhan Pronosei Life Sciences Co., Ltd.). After adsorption for 1 h in a 37℃, 5% CO2 incubator, the virus solution was discarded, and DMEM containing 2% FBS was added. The cells were then incubated at 37℃, 5% CO2. Cell supernatants were collected at 24 h, 48 h, and 72 h post-inoculation, and virus titers were determined using plaque titer. One-step growth curves were plotted, and the results are shown in Figure 4. The parental virus strain (i.e., wild-type strain FSS13025) was measured and analyzed using the same method as a control.

[0176] from Figures 4A-4B It can be seen that the recombinant double-point mutant virus in the mouse testicular cell line: 15P-1 (mouse Sertoli testicular cells, Figure 4A ) and TM3 (mouse testicular Leydig cells, Figure 4B The replication capacity of the recombinant double-point mutant virus was stronger than that of the parent strain. In mouse testicular cell lines, the replication peak was reached at 48 hours post-infection. This indicates that the recombinant double-point mutant virus replicates effectively in testicular cell lines, and its replication efficiency is significantly higher than that of the parent strain.

[0177] Test Example 4

[0178] This test case illustrates the characteristics of the recombinant two-point mutant strain obtained in Example 1, such as its testicular adaptability and its impact on pathological damage to testicular tissue.

[0179] The recombinant double-point mutant viruses FSS-G444A+A117V and FSS-H401Y+K146E and the parental strain FSS13025 were mixed at a ratio of 10 5 PFU was administered intraperitoneally to 7-8 week old C57BL / 6J male rats pretreated with type I anti-IFNAR antibody (purchased from Leinco).

[0180] Viral load in mouse testicular tissue was measured on days 3 and 9 after infection, and the results are as follows: Figure 5A As shown in the figure, at 3 days, the viral load of recombinant double-point mutant viruses FSS-G444A+A117V and FSS-H401Y+K146E in the testes was not significantly different from that of the parent strain. However, at 9 days, the viral load of recombinant double-point mutant viruses in the testes was significantly higher than that of the parent strain.

[0181] Pathological damage was examined in mouse testicular tissue at 3 days and 14 days after infection, and the results are as follows: Figure 5BAs shown in the figure, at 14 days, the recombinant double-point mutant viruses FSS-G444A+A117V and FSS-H401Y+K146E disrupted the seminiferous tubule structure of the testes (black arrows) and reduced sperm count (red arrows), while the parent strain did not show similar effects.

[0182] The above results indicate that, compared with the parental strain FSS13025, FSS-G444A+A117V and FSS-H401Y+K146E exhibit significantly enhanced proliferation in the testes, and testicular tissue damage can be observed, suggesting that the recombinant double-point mutant virus has stronger testicular adaptability.

[0183] Test Example 5

[0184] This test case illustrates the neurotoxicity characteristics of the recombinant two-point mutant strain obtained in Example 1.

[0185] Recombinant double-point mutant viruses FSS-G444A+A117V, FSS-H401Y+K146E, and the parental strain FSS13025 were intraperitoneally injected at a dose of 100 PFU into 7-8 week old A129 male mice (purchased from Cyagen Biosciences Co., Ltd.). The viral load in the brain tissue of the mice was measured at 3 days and 6 days after inoculation.

[0186] The results are as follows Figure 6 As shown in the figure, the viral load of recombinant double-point mutant viruses FSS-G444A+A117V and FSS-H401Y+K146E in brain tissue showed an increasing trend compared to the parental strain at 3 days, and this increase was significant at 6 days. The viral load of recombinant double-point mutant viruses in brain tissue was significantly higher than that of the parental strain. These results indicate that compared to the parental strain FSS13025, FSS-G444A+A117V and FSS-H401Y+K146E showed significantly enhanced proliferation in brain tissue, suggesting that the recombinant double-point mutant viruses have stronger neurotropism and greater neurovirulence.

[0187] Test Example 6

[0188] This test case illustrates the neurotoxicity and testicular adaptation characteristics of the recombinant single-point mutant strain obtained in Example 1.

[0189] Recombinant single-point mutant viruses FSS-G444A, FSS-A117V, FSS-K146E and parental strain FSS13025 were intraperitoneally injected at a dose of 100 PFU into 7-8 week old A129 male mice (purchased from Cyagen Biosciences Co., Ltd.) with the type I interferon receptor gene deleted. The viral load in the brain tissue and testes of the mice was detected 6 days after inoculation.

[0190] Brain tissue viral load test results as follows Figure 7AAs shown in the figure, at 6 days post-infection, the viral load of recombinant single-point mutant viruses FSS-G444A, FSS-A117V, and FSS-K146E in brain tissue was significantly higher than that of the parental strain. These results indicate that compared to the parental strain FSS13025, FSS-G444A, FSS-A117V, and FSS-K146E exhibited significantly enhanced proliferation in brain tissue, suggesting that the recombinant single-point mutant viruses possess stronger neurotropism and greater neurovirulence.

[0191] Testicular viral load test results as follows Figure 7B As shown in the figure, at 6 days post-infection, the viral load of recombinant single-point mutant viruses FSS-G444A, FSS-A117V, and FSS-K146E in the testes was significantly higher than that of the parental strain. These results indicate that compared to the parental strain FSS13025, the proliferation of FSS-G444A, FSS-A117V, and FSS-K146E in the testes was significantly enhanced, suggesting that the recombinant single-point mutant viruses have stronger testicular adaptability.

[0192] Test Example 7

[0193] This test case is used to illustrate the characteristics of the ability of the recombinant mutant strain obtained in Example 1 to infect cells.

[0194] BHK-21 cells were infected with recombinant mutant viruses FSS-G444A+A117V, FSS-G444A, and FSS-A117V, as well as the parental strain FSS13025, at an MOI of 1, and then treated in the following two ways:

[0195] (1) After incubation at 4℃ for 1 h, cells were lysed, viral RNA was extracted, and the ability of the virus to bind to cells was detected.

[0196] (2) After incubating at 4℃ for 1 hour, the cells were transferred to 37℃ and incubated for another 1 hour. The cells were lysed, viral RNA was extracted, and the ability of the virus to enter the cells was detected.

[0197] The results are as follows Figures 8A-8B As shown in the figure, compared with the parental strain FSS13025, the mutant strains FSS-G444A+A117V and FSS-G444A significantly enhanced cell binding ability. Figure 8A ) and the ability to enter cells ( Figure 8B The mutant strain FSS-A117V exhibited cell-binding ability that was essentially the same as that of the parent strain. Figure 8A ) and the ability to enter cells ( Figure 8BThe above results indicate that, compared with the parental strain FSS13025, the mutant viruses FSS-G444A+A117V and FSS-G444A have a stronger ability to infect cells, while the mutant virus FSS-A117V has no significant difference in its ability to infect cells compared with the parental strain.

[0198] Test Example 8

[0199] This test case illustrates the replication characteristics of the recombinant attenuated mutant strain obtained in Example 1 in sensitive cell lines.

[0200] Recombinant attenuated mutant viruses FSS-A117G and FSS-H401A, along with the parental virus strain, were inoculated into 24-well BHK-21 cells at an MOI of 0.1. After adsorption for 1 h in a 37°C, 5% CO2 incubator, the virus solution was discarded, and DMEM containing 2% FBS was added. The cells were then incubated at 37°C with 5% CO2. Cell supernatants were collected at 6 h, 24 h, 48 h, and 72 h post-inoculation. One-step growth curves were plotted by measuring viral RNA copy number. The results are shown below. Figure 9 As shown. The parental strain of virus (i.e., wild-type strain FSS13025) was measured and analyzed using the same method as a control.

[0201] from Figure 9 It can be seen that the replication capacity of the recombinant attenuated mutant viruses FSS-A117G and FSS-H401A in BHK-21 cells is weaker than that of the wild-type parent strain. This indicates that the above-mentioned recombinant attenuated mutant viruses can replicate effectively in BHK-21 cells, and the replication efficiency is significantly weaker than that of the wild-type parent strain.

[0202] Test Example 9

[0203] This test case illustrates the lethal characteristics of intracranial injection of the recombinant attenuated mutant strain obtained in Example 1 into ICR suckling mice.

[0204] Recombinant attenuated mutant viruses FSS-A117G and FSS-H401A, along with the parental virus strain, were intracranially inoculated into 1-day-old ICR suckling mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) at a dose of 1000 PFU. The morbidity and mortality of the mice were observed within 15 days, with deaths within 24 hours of inoculation considered as non-specific deaths.

[0205] For detailed results, please see [link to results]. Figure 10As shown in the figure, within 15 days post-infection, 1000 PFU of the parental strain caused the death of 100% of mice, while the same dose of the attenuated strain FSS-A117G caused the death of 60% of suckling mice, and the same dose of the attenuated strain FSS-H401A was not lethal. At this dose, the average survival time of mice infected with the parental strain was 11.2 days, while the average survival time of suckling mice infected with FSS-A117G virus was 13.3 days. These results indicate that the neurovirulence of the recombinant attenuated mutant viruses FSS-A117G and FSS-H401A in mice is significantly weaker than that of the parental strains, exhibiting obvious attenuation characteristics.

[0206] Further research showed that the recombinant attenuated mutant viruses FSS-A117G and FSS-H401A could induce mice to produce neutralizing antibodies.

[0207] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. Use of mutating a genetic site in altering the virulence of a Zika virus, wherein, The genetic site is selected from the nucleotide encoding the 401st amino acid of the E protein and / or the nucleotide encoding the 146th amino acid of the NS1 protein in the Zika virus genome; The mutation makes the 401st amino acid of the E protein tyrosine and the 146th amino acid of the NS1 protein glutamic acid; or the mutation makes the 146th amino acid of the NS1 protein glutamic acid; The change in the virulence of the Zika virus includes increasing the virulence or decreasing the virulence; The Zika virus is FSS13025, GenBank Accession No. KU955593.

2. Use of mutating a genetic site in altering testis adaptability of Zika virus, wherein, The genetic site is selected from the nucleotide encoding the 401st amino acid of the E protein and / or the nucleotide encoding the 146th amino acid of the NS1 protein in the Zika virus genome; The mutation makes the 401st amino acid of the E protein tyrosine and the 146th amino acid of the NS1 protein glutamic acid; or the mutation makes the 146th amino acid of the NS1 protein glutamic acid; The change in the testis adaptability of the Zika virus includes increasing the testis adaptability or decreasing the testis adaptability; The testis adaptability includes the replication ability of the Zika virus in testis tissue or cells and the damage ability to the testis tissue; The Zika virus is FSS13025, GenBank Accession No. KU955593.

3. A Zika virus mutant strain, characterized in that, The mutation of the 401st amino acid of the E protein and / or the 146th amino acid of the NS1 protein of the mutant strain is compared with that of the wild-type virus strain; The mutation makes the 401st amino acid of the E protein tyrosine and the 146th amino acid of the NS1 protein glutamic acid; or the mutation makes the 146th amino acid of the NS1 protein glutamic acid; The wild-type virus strain is FSS13025, GenBank Accession No. KU955593.

4. A DNA molecule encoding the mutant strain of claim 3.

5. A DNA molecule, characterized in that, The DNA molecule includes an open reading frame in the Zika virus genome, wherein the mutation occurs in the nucleotide encoding the 401st amino acid of the E protein and / or the nucleotide encoding the 146th amino acid of the NS1 protein; The mutation makes the 401st amino acid of the E protein tyrosine and the 146th amino acid of the NS1 protein glutamic acid; or the mutation makes the 146th amino acid of the NS1 protein glutamic acid; The Zika virus is FSS13025, GenBank Accession No. KU955593.

6. Use of the mutant strain of claim 3, and / or the DNA molecule of claim 4 or 5 in constructing an animal model of Zika virus infection.

7. Use according to claim 6, wherein, The animal model is an animal model of male reproductive system-related diseases caused by Zika virus infection.

8. Use of the mutant strain of claim 3, and / or the DNA molecule of claim 4 or 5 in preparing a medicine for preventing and / or treating diseases caused by Zika virus infection.

9. Use according to claim 8, wherein, The medicine includes an antibody and / or a vaccine.

10. Use according to claim 9, wherein, The vaccine is a live attenuated vaccine.

Images