Construction method of amylase high-yield strain

Abstract

The invention discloses a construction method of an amylase high-yield strain, and belongs to the technical field of fermentation engineering. According to the two recombinant bacillus licheniformis for expressing different CcpA protein mutants, glucose and xylose can be synchronously utilized, the utilization efficiency of a complex carbon source in a crude raw material is effectively improved, the growth and enzyme production level of the strain is improved, the cell quantity is increased by 1.45 times compared with that of a control group after fermentation is carried out for 72 hours, and the yield of the CcpA protein mutants is increased by 1.45 times compared with that of the control group. And the activity of the high-temperature-resistant alpha-amylase in the supernatant of the fermentation liquor is improved by 1.72 times compared with that of a control group.

Description

Technical Field

[0001] The invention relates to a method for constructing a high-yield amylase strain, and belongs to the technical field of fermentation engineering. Background Art

[0002] Bacillus licheniformis is a Gram-positive bacterium with the advantages of heat resistance, rich enzyme system, high enzyme production, moderate growth rate, protein folding, and open genome information. Compared with Escherichia coli engineered bacteria, it has the advantages of high heat resistance, low pH tolerance, and high biomass. It is not only widely used as an expression host for exogenous genes, but also has great potential in the fermentation industry. Bacillus licheniformis has been used in the production of thermostable α-amylase in industry for a long time. The full utilization of complex carbon sources in fermentation raw materials by bacteria is an important factor affecting production efficiency. Bacillus licheniformis can utilize xylose, but the utilization of xylose is inhibited by glucose. Xylose, as a high-quality carbon source, can be obtained by hydrolysis of lignocellulose. With the current environmental and energy pressures, renewable carbon such as lignocellulose is increasingly favored by people. Since lignocellulose produces a large amount of xylose and glucose at the same time during the hydrolysis process, the presence of carbon catabolism repression will inhibit the utilization of xylose. In order to eliminate the carbon catabolism repression caused by the presence of glucose, many attempts to relieve or reduce carbon catabolism repression have been carried out in other microorganisms. The main attempts are mainly divided into two categories: one is to increase the utilization of xylose by artificially constructing metabolic pathways. The second is to construct an engineered bacterium with reduced carbon catabolism repression by intervening in the metabolic pathways of the bacteria themselves. However, when the carbon catabolism repression is inhibited by knocking out the carbon catabolism regulatory protein (Catabolite control protein A) CcpA protein, the inhibition of xylose utilization by glucose is reduced, and the utilization efficiency of xylose is increased, the growth of the bacteria will be significantly inhibited, and other metabolic pathways will also be significantly affected. Therefore, the engineered bacteria constructed by gene knocking out the CcpA protein have not been put into commercial production. There is an urgent need for a genetically engineered bacterium and a construction method that can utilize xylose and glucose at the same time, and the growth of the bacteria is not inhibited, and is suitable for industrial production. Summary of the invention

[0003] In view of the above situation, the present invention starts from Bacillus licheniformis, clones the genomic sequence of the carbon catabolism regulatory protein CcpA protein, performs site-directed mutation on the amino acid encoding the DNA binding domain, and performs heterologous expression and purification in Escherichia coli. The binding ability of the CcpA protein to the regulatory site cre site is determined in vitro, and the CcpA mutant protein with a significant gap in binding ability to the cre site is preliminarily screened out. The mutant protein is expressed in a Bacillus licheniformis CcpA defective strain to verify the effect of the mutant on xylose utilization in the presence of glucose.

[0004] One of the objectives of the present invention is to provide a CcpA mutant in Bacillus licheniformis.

[0005] In one embodiment, the mutant is based on the amino acid sequence shown in SEQ ID NO.1, and any of the following mutations are performed:

[0006] (1) Mutate leucine at position 96 to alanine;

[0007] (2) mutating valine at position 23 to alanine;

[0008] (2) mutating the valine at position 23 to alanine and the leucine at position 96 to alanine;

[0009] The second object of the present invention is to provide a gene encoding the CcpA mutant.

[0010] The third object of the present invention is to construct a recombinant expression vector for expressing the mutant CcpA protein and a recombinant strain that can successfully express the mutant protein.

[0011] The fourth object of the present invention is to construct a recombinant Bacillus licheniformis, knock out the CcpA gene, and express the mutant.

[0012] In one embodiment, the mutant of claim 1 is expressed episomally, and the expression vector includes but is not limited to pET28a.

[0013] The protein of the present invention can be produced by artificial manipulation. These manipulation methods are usually means commonly used in this professional field, such as by site-specific replacement of one or more amino acids.

[0014] The expression vector for recombinantly expressing the CcpA mutant comprises a promoter, a mutant CcpA protein gene, and a tetracycline resistance gene, wherein the mutant CcpA protein gene is located downstream of the promoter.

[0015] The recombinant expression vector is first transformed in Escherichia coli by chemical transformation, and then the plasmid is extracted and the recombinant plasmid is transformed into Bacillus licheniformis by electroporation.

[0016] The recombinant Bacillus licheniformis bacteria expressing the CcpA mutant protein constructed by the present invention can grow in a culture medium containing a mixed carbon source of xylose and glucose, and the preference of the recombinant bacteria for xylose is enhanced in the presence of glucose.

[0017] A fifth object of the present invention is to provide a method for enabling Bacillus licheniformis to utilize xylose and glucose simultaneously, knocking out the CcpA gene, and expressing the mutant.

[0018] In one embodiment, the nucleotide sequence of the knocked-out CcpA gene is as shown in SEQ ID NO.2.

[0019] The sixth object of the present invention is to provide a method for increasing the yield of thermostable α-amylase in Bacillus licheniformis, knocking out the CcpA gene, and expressing the mutant.

[0020] The seventh object of the present invention is to provide a method for improving the utilization efficiency of complex carbon source raw materials, wherein the recombinant Bacillus licheniformis is added to a system containing complex carbon source raw materials for fermentation, wherein the complex carbon source raw materials contain glucose and xylose.

[0021] The eighth object of the present invention is to provide the use of the mutant or the recombinant bacteria or the recombinant Bacillus licheniformis in inhibiting the catabolism repression of xylose by glucose.

[0022] The ninth object of the present invention is to provide the use of the recombinant bacteria or the recombinant Bacillus licheniformis in the fermentation production of thermostable α-amylase.

[0023] Beneficial effects:

[0024] The invention provides a CcpA protein mutant. Compared with the wild type, the mutant Val23AlaLeu96Ala has significantly reduced binding ability with the cre site, showing the potential of alleviating carbon catabolism inhibition.

[0025] The recombinant Bacillus licheniformis expressing the CcpA protein mutant constructed by the present invention can synchronously utilize glucose and xylose, effectively improve the utilization efficiency of complex carbon sources in crude raw materials, and enhance the growth and enzyme production level of the strain. After fermentation for 72 hours, the cell amount is increased by 1.2-1.4 times compared with the control, and the activity of the high temperature resistant alpha-amylase in the supernatant of the fermentation liquid is increased by 1.3-1.6 times compared with the control. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 : Fluorescence polarization values ​​of different mutants binding to the target site;

[0027] Figure 2 : Site-directed mutation colony PCR amplification verification product of Bacillus licheniformis CcpA protein mutant; from left to right, lane 1 is the nucleic acid molecular weight marker, lane 2 is the coding gene fragment of wild-type ccpA, lanes 3-7 are the coding gene fragments of mutants Val23Ala, Leu96Ala, Ile6Ala, Val9Ala, Val23AlaLeu96Ala, respectively, and lane 8 is the coding gene fragment of wild-type ccpA;

[0028] Figure 3 : Flowchart of knockout of Bacillus licheniformis CcpA protein;

[0029] Figure 4 : Glucose consumption curves of the control bacteria and mutant bacteria in a medium containing a mixture of xylose and glucose as carbon sources;

[0030] Figure 5 : The consumption curve of xylose by the control bacteria and the mutant bacteria in the medium with xylose and glucose mixed carbon source;

[0031] Figure 6 :The process of fermentation production of thermostable α-amylase by control bacteria and mutant strains. DETAILED DESCRIPTION

[0032] The present invention will be further described below in conjunction with specific embodiments. The advantages and features of the present invention will be reflected as the present invention is described. However, these examples are only exemplary, and researchers in the field may modify or replace the details and forms of the technical solution of the present invention without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the protection scope of the present invention.

[0033] Primer synthesis and sequencing were completed by Sangon Biotechnology (Shanghai) Co., Ltd.

[0034] The molecular biology experiments in the embodiments include plasmid construction, enzyme digestion, competent cell preparation, transformation, etc., mainly with reference to "Molecular Cloning Experiment Guide" (3rd edition), compiled by J. Sambrook, DW Russell (USA), translated by Huang Peitang, etc., Science Press, Beijing, 2002). For example, the competent cell transformation method and the competent preparation method are all carried out with reference to "Molecular Cloning Experiment Guide" (3rd edition), Chapter 1, page 96. If necessary, the specific experimental conditions can be determined by simple experiments.

[0035] The Bacillus licheniformis involved in the following examples is Bacillus licheniformis CICIM B1391.

[0036] Culture medium for strain construction and transformation:

[0037] Luria-Bertani (LB) medium (1 L): 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl (plus 20 g / L agar powder for solid medium).

[0038] Medium I: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 0.5 M D-sorbitol.

[0039] Buffer BW: 0.5 M D-sorbitol, 0.5 M mannitol and 10% glycerol.

[0040] Recovery medium (BR): 10 g / L trypsin, 5 g / L yeast extract, 5 g / L NaCl, 0.5 M D-sorbitol, 0.5 M mannitol and 10% glycosides.

[0041] Preparation of Bacillus licheniformis competent cells:

[0042] The strain was streaked onto a solid LB plate with tetracycline (20 μg / mL) resistance the night before and cultured for 16 hours. After that, a single colony was picked and inoculated into 15 ml LB medium, 7.5 μl tetracycline (20 μg / mL) solution was added, and cultured at 37 ° C, 250 rpm for 16 hours. Take 1 ml and inoculate it into medium I, add 7.5 μl tetracycline (20 μg / mL) solution, culture at 37 ° C, 250 rpm for 2-3 hours, and then centrifuge at 8000 rpm for 5 minutes to collect the bacteria. Each tube of bacteria was added with 20 ml BW medium (0.5 M sorbitol + 0.5 M mannitol + 10% glycerol) for washing the bacteria, and the washing was repeated 2-3 times. After the last wash, 2 ml BW medium was added, and 80 μl was taken each time and divided into 1.5 ml centrifuge tubes and stored in a -70 refrigerator for standby use.

[0043] Bacillus licheniformis electrotransformation method:

[0044] Take 10μl of plasmid and add it to the competent cells. After 5 minutes of ice bath, add the mixture of plasmid and competent cells to the electroporation cup and click at 1800-2200V. After clicking, add 800μl of recovery medium immediately for growth recovery after transformation. Incubate at 37℃ and 250rpm for 2-3h. After the post-culture, centrifuge at 8000rpm for 5min, pour off the excess medium, and resuspend the bacteria with the remaining 200μl medium. Spread on a double-resistant plate of tetracycline (20μg / mL) and chloramphenicol (10μg / mL).

[0045] Example 1 Construction of CcpA-deficient strain of Bacillus licheniformis

[0046] Reference: Yupeng Z, Youran L, Fengxu X, et al. CcpA mutants influenceselective carbon source utilization by changing interactions with targetgenes in Bacillus licheniformis[J]. Systems Microbiology and Biomanufacturing, 2022. DOI: 10.1007 / s42393-021-00055-7. The CcpA-deficient strain of Bacillus licheniformis was constructed. Figure 3 As shown, the details are as follows:

[0047] First, the genome of Bacillus licheniformis CICIM B1391 was used as a template, and the fragment containing the CcpA coding gene and the homologous arms at both ends was obtained by PCR amplification using the primer pair CcpATY-F / CcpATY-R. The cloned fragment was purified after adding A and connected with pMD19T to obtain the TCFCR plasmid. Subsequently, the primer pair ReTC-F / ReTC-R was used to perform reverse PCR with the TCFCR plasmid as a template, and the plasmid was linearized while removing the CcpA protein coding gene. The primer pair Kan-F / Kan-R was used to amplify the FRTKan-FRT fragment and purified it. The purified FRT-Kan-FRT fragment was connected to the TCFCR plasmid that removed the CcpA protein coding gene and linearized by one-step cloning to construct the plasmid TCFKCR containing the complete knockout cassette fragment. Subsequently, TCFKCR and pNZT plasmids were digested with KpnI and XhoI, respectively, and the knockout box containing the homology arms was ligated to the pNZT plasmid using T4 ligase to obtain the temperature-sensitive knockout plasmid pNTCFKFC containing the ccpA homology arms and the complete knockout box.

[0048] The constructed pNTCFKFC plasmid was transformed into CICIM B1391 by electroporation to construct a recombinant bacterium containing a knockout plasmid encoding the CcpA protein. The constructed recombinant strain was first activated on a plate, and then the activated single colony was inoculated into a shake flask containing 15 mL of LB medium and cultured at 30°C and 250 rpm for 16 h. Subsequently, the cultured bacterial solution was inoculated into a new shake flask containing 15 mL of LB medium and cultured at 42°C and 250 rpm for 24 h, and then the bacterial solution was diluted 10% with sterile water. -6 ,10 -7 Spread the kana plate and place it in a 37°C incubator for 16 hours. Then use the primers to knock out ccpAYZF / ccpAYZ-R. Pick the transformants that have undergone double exchange, inoculate them into 15mL of LB medium, place it at 42°C for 16 hours, and streak out single colonies. Streak the single colonies onto the kana plate and tetracycline plate respectively. The bacteria that grow normally on the kana plate but not on the tetracycline plate are the plasmid elimination strains.

[0049] The primer sequences for knocking out the gene encoding the CcpA protein of Bacillus licheniformis are as follows:

[0050] CcpATY-F: 5'cggggtaccgctttcgagcggtcctttttttagtt3';

[0051] CcpATY-R: 3'caggcgcgcaaacaaggaattctcgagcgg5';

[0052] ReTC-F: 5'atcggtgccgtagcgatgaga3';

[0053] ReTC-R: 3'atcttcgattcccctcgccagc5';

[0054] Kan-F: 5'cgaggtaccgaagttcctattccgaagttcctattctctgaaagtataggaacttcggccagtttgttgaagattaga3';

[0055] Kan-R: 3'gaaaggggattttatgcgtggaagttcctattccgaagttcctattctctctagaaagtataggaacttcgatatccgg5';

[0056] ccpAYZ-F: 5'tttttcaaaaacgggtctttcatttcattgatattg3';

[0057] ccpAYZ-R:3'ccgctcgttcaagtaaaagcataagattc5'.

[0058] Example 2 Construction of Bacillus licheniformis CcpA protein expression vector and site-directed mutagenesis of CcpA protein

[0059] 1. Using pET28a as a vector and NheI and HindIII as restriction sites, the nucleotide sequence encoding the CcpA protein shown in SEQ ID NO.2 was connected to the vector to construct the Bacillus licheniformis CcpA protein expression vector pET28a-CcpA, and the expression vector pET28a-CcpA was transformed into the Bacillus licheniformis CcpA-deficient strain obtained in Example 1 to obtain a control strain.

[0060] 2. Use this vector as a template to perform site-directed mutagenesis on the CcpA protein of Bacillus licheniformis.

[0061] The primer sequences for site-directed mutagenesis of Bacillus licheniformis CcpA protein are as follows:

[0062] Val23Ala-F: 5'gaaatccgaacgtcgcgccgacgacgagaaagaaggtgcttgaagccatc3';

[0063] Val23Ala-R: 3'ttctcgtcgtcggcgcgacgttcggatttccgttcacaaccctggaaacg5';

[0064] Leu96Ala-F: 5'aaggtgcttgaagccgccgagcgtcttggctatcgtccaaatgccgtggc3';

[0065] Leu96Ala-F: 3'agccaagacgctcggcggcttcaagcaccttctttctcgtcgtcggcttg5';

[0066] Ile6Ala-F: 5'TGAGTAATGTGACAGCATATGATGTAGCACGCGAAGCAAATGTAA

[0067] GTAT3';

[0068] Ile6Ala-R: 3'GTGCTACATCATATGCTGTCACATTACTCATCATATGGCTGCCGCG5';

[0069] Val9Ala-F: 5'TGACAATATATGATGCAGCACGCGAAGCAAATGTAAGTATGGCAAC CGTT3';

[0070] Val9Ala-R: 3'TTTGCTTCGCGTGCTGCATCATATATTGTCACATTACTCATCATATGG CT5'.

[0071] On the basis of the obtained Val23Ala mutant gene, PCR was performed again to obtain a site-directed mutant gene with Val23AlaLeu96Ala superimposed. The recombinant vector expressing CcpA protein after site-directed mutation was transformed into Escherichia coli for heterologous expression and purification ( Figure 2 The obtained pure mutant protein was tested for its ability to bind to the cre site using fluorescence polarization in vitro ( Figure 1 ), the results showed that the mutant Val23AlaLeu96Ala had a significantly reduced ability to bind to the target site, which may help alleviate the carbon catabolism repression effect.

[0072] The obtained recombinant expression vector corresponding to the mutant CcpA protein with a significant difference in binding ability to the cre site was transformed into the Bacillus licheniformis CcpA-deficient strain obtained in Example 1 for heterologous expression. The strain expressing the Val23Ala mutant was named Val23Ala-BL2-ΔCcpA; the strain expressing the Leu96Ala mutant was named Leu96Ala-BL2-ΔCcpA; the strain expressing the Ile6Ala mutant was named Ile6Ala-BL2-ΔCcpA; the strain expressing the Val9Ala mutant was named Val9Ala-BL2-ΔCcpA; the strain expressing the Val23AlaLeu96Ala mutant was named Val23AlaLeu96Ala-BL2-ΔCcpA.

[0073] Example 3: Utilization of complex sugars in culture medium by bacterial strains

[0074] The obtained strain expressing the recombinant CcpA protein mutant was cultured in a medium with xylose and glucose as mixed carbon sources. After the culture was completed, samples were taken and the contents of xylose and glucose in the medium were determined by high performance liquid chromatography.

[0075] Mixed carbon source shake flask medium: 30 g / L glucose, 30 g / L xylose, 20 g / L tryptone, 10 g / L yeast extract, 10 g / L NaCl. The strain expressing the recombinant CcpA protein mutant was first activated in a shake flask, and then inoculated with 5% of the shake flask fermentation culture medium and cultured in a shaker at 37 degrees Celsius (the initial inoculation concentration was OD 600 4.0, culture volume 0.9 mL), rotation speed 200 rpm.

[0076] The high performance liquid chromatography (HPLC) method for detecting glucose and xylose in the culture medium is as follows:

[0077] Centrifuge 1 ml of bacterial culture at 12000 rpm for 5 min, then take the supernatant, add 10% trichloroacetic acid at a ratio of 1:1 (v / v), and place at 4°C for precipitation for more than 4 hours. Then centrifuge at 12000 rpm for 20 min, take the supernatant and filter through a 0.22 μm filter. Chromatographic conditions: RI detector, chromatographic column (8×300 mm, Dikma CarboPac Ca2+6 μm), mobile phase ultrapure water, flow rate 0.8 ml / min, column temperature 80°C, running time 20 min.

[0078] Figure 4 , 5The results show that the control strain and all mutants can utilize glucose quickly, but there are significant differences in the level of xylose utilization before glucose is completely consumed. Compared with the control, at the end of fermentation, not only was glucose almost exhausted in the mutant strain Val23AlaLeu96Ala-BL2-ΔCcpA (Val23AlaLeu96Ala), but xylose was also mostly consumed, with the residual xylose being only 7.9% of that in the control strain, and the cell concentration was also improved (Table 1); at the end of fermentation, glucose was exhausted in the mutant strains Val23Ala-BL2-ΔCcpA (Val23Ala) and Leu96Ala-BL2-ΔCcpA (Leu96Ala), and the residual xylose was 6.3 g / L and 3.6 g / L, respectively; while at the end of fermentation, glucose was exhausted in the control strain, Ile6Ala-BL2-ΔCcpA (Ile6Ala) and Val9Ala-BL2-ΔCcpA (Val9Ala), but xylose could not be utilized.

[0079] Table 1 Bacterial concentration of control bacteria and mutant strains after fermentation in glucose / xylose mixed carbon source medium

[0080]

[0081] Example 4: Application of mutant strains in the production of thermostable α-amylase fermentation

[0082] Fermentation medium: 100 g / L cellulose hydrolyzate, 20 g / L tryptone, 10 g / L yeast extract, 2 g / L corn steep liquor powder, 15 g / L (NH4)2SO4, 1 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 3 g / L CaCO3. The strain expressing the recombinant CcpA protein mutant Val23AlaLeu96Ala and the strain expressing the recombinant CcpA protein mutant Leu96Ala were first activated in a shake flask, and then 5% of the shake flask fermentation broth was inoculated and transferred to a 37°C shaker for culture (the initial inoculation concentration was OD 600 4.2, culture volume 35 mL), rotation speed 220 rpm.

[0083] The results show that Figure 6), after 72h of fermentation, the activity of the thermostable α-amylase in the supernatant of the fermentation broth of the strain expressing the CcpA protein mutant Val23AlaLeu96Ala was 6610U / mL, which was 1.72 times higher than that of the control (3845U / mL); the activity of the thermostable α-amylase in the supernatant of the fermentation broth of the strain recombinantly expressing the CcpA protein mutant Leu96Ala was 6152U / mL, which was 1.6 times higher than that of the control (3845U / mL).

[0084] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A global regulatory factor CcpA mutant, characterized in that: The mutant is based on the amino acid sequence shown in SEQ ID NO.1, and any of the following mutations are performed: (1) Mutate leucine at position 96 to alanine; (2) mutating valine at position 23 to alanine; (3) The valine at position 23 was mutated to alanine, and the leucine at position 96 was mutated to alanine.

2. A gene encoding the mutant according to claim 1.

3. A recombinant bacterium expressing the mutant according to claim 1 or carrying the gene according to claim 2.

4. A recombinant Bacillus licheniformis, characterized in that The CcpA gene is knocked out, and the mutant according to claim 1 is expressed.

5. The recombinant Bacillus licheniformis according to claim 4, characterized in that The mutant of claim 1 is expressed episomally, and the expression vector includes but is not limited to pHY300.

6. A method for allowing Bacillus licheniformis to simultaneously utilize xylose and glucose, characterized in that: The CcpA gene is knocked out, and the mutant according to claim 1 is expressed.

7. A method for increasing the yield of thermostable α-amylase in Bacillus licheniformis, characterized in that: The CcpA gene is knocked out, and the mutant according to claim 1 is expressed.

8. A method for improving the utilization efficiency of complex carbon source raw materials, characterized in that: The recombinant Bacillus licheniformis according to claim 4 or 5 is added to a system containing a complex carbon source raw material for fermentation; the complex carbon source raw material contains glucose and xylose.

9. Use of the mutant according to claim 1, the recombinant bacterium according to claim 3, or the recombinant Bacillus licheniformis according to claim 4 or 5 in inhibiting the catabolism repression of xylose by glucose.

10. Use of the recombinant bacterium according to claim 3 or the recombinant Bacillus licheniformis according to claim 4 or 5 in producing thermostable α-amylase.

Images