Wheat plant type gene and application

Abstract

The invention discloses a wheat plant type gene and application, and belongs to the technical field of genetic engineering breeding. The technical problem to be solved by the invention is how to regulate and control the plant height or ear type of wheat. In order to solve the technical problem, the invention provides the application of the protein or the biological material related to the protein in regulating and controlling the plant height and / or the panicle type of the plant, the protein is QIP3 protein, and the QIP3 protein can be three, any two or any one of the three proteins with the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. The candidate gene QIP3 which affects the plant height and / or the ear length of wheat is excavated, the plant height of a knockout strain of the candidate gene QIP3 is remarkably reduced, and the ear length is remarkably increased. The research on the functions of the QIP3 and the application of the QIP3 in wheat breeding have important meanings for improving the growth traits and yield of wheat.

Description

Technical Field

[0001] The present application belongs to the technical field of genetic engineering breeding, and specifically relates to a wheat plant type gene and its application. Background Art

[0002] Wheat is one of the world's major food crops, providing 21% of human food calories and 20% of protein sources. Varieties contribute more than 40% to increasing crop yields, and the discovery and use of key genes has played an important role in promoting genetic improvement of wheat yields. Green Revolution Genes Rht-B1b , Rht-D1b By significantly reducing wheat plant height, improving the harvest index and solving the problem of plant lodging, the yield per unit area was significantly increased. Rht-B1b , Rht-D1b Dwarfing alleles cause significant reductions in grain weight and nitrogen use efficiency. Therefore, discovering new wheat dwarfing genes is the key to wheat genetics and breeding.

[0003] Based on the forward genetics research strategy, the Wheat Research Center of the College of Agriculture of China Agricultural University identified a semi-dwarf locus on the short arm of chromosome 4B that synergistically improves wheat yield and nitrogen utilization efficiency. This locus is a large fragment deletion of about 500Kb, resulting in the loss of three closely linked genes, namely Rht-B1 / EamA-B / ZnF-B , named rez haplotype. Rht-B1b In comparison, the rez-deficient haplotype maintained a semi-dwarf plant type, and the stem strength, density tolerance, harvest index, 1000-grain weight and yield were significantly improved. TaMYB30-A1 Natural variation in the promoter affects its transcriptional repression by WFZP. TaMYB30-A1 Superior haplotypes have higher expression levels, increase spike length, number of fertile spikelets and number of grains per spike, and are selected during wheat domestication and breeding, and may have played an important role in the improvement of Chinese wheat varieties. Wheat yield is mainly determined by the number of spikes per mu, thousand-grain weight and number of grains per spike. Spike structure affects the number of spikelets, number of grains per spike and yield of wheat, and is an important selective trait for breeding and improvement. Exploring important regulatory genes for wheat spike development is of great significance for the molecular design and precise improvement of wheat spike type and breaking through the bottleneck of yield. Summary of the invention

[0004] The technical problem to be solved by the present application is: how to regulate the plant height or ear shape of wheat. More specifically, the technical problem to be solved by the present application is: how to reduce the plant height of wheat and / or increase the ear length of wheat.

[0005] In order to solve the above technical problems, the present application provides the use of a protein or a biological material related to the protein in any of the following items: A1) Application in regulating plant strains; A2) Application in the preparation of products for regulating plant height; A3) Application in regulating plant spike type; A4) Application in the preparation of products for regulating plant spike shape; A5) Application in plant breeding or plant assisted breeding; A6) Use in the preparation of products for plant breeding or plant-assisted breeding; The protein is QIP3 protein, and the QIP3 protein can be any of the following: a1) the amino acid sequences of the three proteins of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively, are three, any two or any one; a2) a protein obtained by substituting, deleting and / or adding amino acids to the amino acid sequence of the protein shown in a1) and having more than 80% identity with the amino acid sequence shown in a1) and associated with plant height and / or panicle type; a3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a1) or a2).

[0006] In the present application, the protein may be derived from wheat.

[0007] In the present application, SEQ ID NO: 1 consists of 333 amino acids. In the present application, SEQ ID NO: 2 consists of 339 amino acids. SEQ ID NO: 3 consists of 336 amino acids.

[0008] a3) The connection can be made through a peptide bond. Specifically, the C-terminus of the tag and the amino acid at the N-terminus of the protein in a1) or a2) are dehydrated and condensed to form a peptide bond.

[0009] Alternatively, the N-terminus of the tag is linked to the amino acid at the C-terminus of the protein a1) or a2) by dehydration condensation to form a peptide bond.

[0010] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0011] The protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0012] In the present application, the regulation may be increasing, promoting or upregulating.

[0013] In the present application, the regulation may also be reduction, inhibition or down-regulation.

[0014] In the present application, the plant type includes but is not limited to plant height and / or ear type.

[0015] In the present application, the plant breeding assessment index includes plant height and / or ear type of the plant. The ear type may be ear length.

[0016] In the present application, the purpose of the plant breeding may be to obtain a target plant with a lower plant height than the parent and / or to obtain a target plant with a higher ear length than the parent.

[0017] In the application, the substance that regulates the protein content may be a substance that knocks out the gene encoding the protein and / or a substance that reduces the expression of the gene encoding the protein.

[0018] In the application, the substance that regulates the protein content may also be a substance that increases the expression of the gene encoding the protein.

[0019] In the application, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated by the gene).

[0020] In the application, the regulation of gene expression may be inhibition or reduction of gene expression, and the inhibition or reduction of gene expression may be achieved by gene knockout or gene silencing.

[0021] The gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene by changing the DNA sequence. The gene silencing refers to the phenomenon of making the gene non-expressed or low-expressed without damaging the original DNA. Gene silencing is based on the premise of not changing the DNA sequence, making the gene non-expressed or low-expressed. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specific inhibition of target RNA, including antisense RNA, co-suppression, gene repression (quelling), RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0022] In the application, the substance regulating gene expression may be an agent that inhibits or reduces the gene expression. The agent that inhibits or reduces the gene expression may be an agent that knocks out the gene, such as an agent that knocks out the gene by homologous recombination, or an agent that knocks out the gene by CRISPR-Cas9. The agent that inhibits or reduces the gene expression may include a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0023] Furthermore, in the application, the biomaterial may be any of the following: B1), a nucleic acid molecule that inhibits or reduces the expression of the QIP3 protein encoding gene; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7), transgenic plant organs containing the nucleic acid molecule described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3); B8), a nucleic acid molecule encoding the QIP3 protein; B9), an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue and / or a transgenic plant organ containing the gene encoding the nucleic acid molecule described in B8).

[0024] Furthermore, in the application, B1) the nucleic acid molecule may be an RNA molecule whose target site nucleotide sequence is SEQ ID NO: 7 and / or SEQ ID NO: 8, or a DNA encoding the RNA molecule.

[0025] Furthermore, in the application, the nucleic acid molecule in B8) may be a DNA molecule as described in any of the following: g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO: 4, 5 or 6; g2), a DNA molecule whose reference sequence number of the nucleotide sequence of the coding strand is TraesCS2A02G286900, TraesCS2B02G303900 or TraesCS2D02G285500; g3) is a DNA molecule that has more than 80% identity with any of the DNA molecules in g1) or g2) and regulates plant height and / or panicle type.

[0026] Furthermore, in the application, the recombinant microorganism can specifically be yeast, bacteria, algae and fungi.

[0027] Furthermore, in the application, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0028] Furthermore, in the application, the transgenic plant organ can be the root, stem, leaf, flower, fruit and seed of the transgenic plant.

[0029] Furthermore, in the application, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ may or may not include propagation materials.

[0030] The present application also provides a method for regulating plant height and / or ear type, the method comprising regulating the plant height and / or ear type of the recipient plant by regulating the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant.

[0031] Furthermore, the method comprises reducing the plant height of the recipient plant and / or increasing the ear length of the recipient plant by reducing the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant, wherein the recipient plant contains the encoding gene.

[0032] Furthermore, the method described herein reduces the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant by knocking out the gene encoding the QIP3 protein in the recipient plant.

[0033] The present application also provides a method for preparing a target plant with reduced plant height and / or increased ear length, the method comprising reducing the expression amount of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant, thereby obtaining a target plant with a lower plant height and / or a higher ear length than the recipient plant.

[0034] Furthermore, in the method described above, the coding gene is a DNA molecule described in any one of the following: g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO: 4, 5 or 6; g2), a DNA molecule whose reference sequence number of the nucleotide sequence of the coding strand is TraesCS2A02G286900, TraesCS2B02G303900 or TraesCS2D02G285500; g3) is a DNA molecule that has more than 80% identity with any of the DNA molecules in g1) or g2) and regulates plant height and / or panicle type.

[0035] In the present application, the plant or recipient plant can be selected from monocotyledonous plants.

[0036] In the present application, the monocotyledonous plant can be selected from the Poaceae family.

[0037] In the present application, the grass plant can be selected from the genus Triticum.

[0038] In the present application, the Triticum plant can be selected from wheat ( Triticum aestivum L.).

[0039] Furthermore, in the method described above, reducing the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant is achieved by any one of the following M1) to M4): M1), knocking out the gene encoding the QIP3 protein in the recipient plant by a genome editing system to reduce the expression amount of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant; Further, the genome editing system is a CRISPR / Cas system; Furthermore, the CRISPR / Cas system can express a gRNA targeting the gene encoding the QIP3 protein and an effector protein of the CRISPR / Cas system: Cas9 protein; Further, the target site nucleotide sequence of the gRNA is SEQ ID NO: 7 and / or SEQ ID NO: 8; M2), subjecting the gene in the recipient plant to any one, two or three mutations of the following M21)-M23), wherein the plant is wheat: M21), deleting the 698th cytosine deoxyribonucleotide (C) of the QIP3-2A gene of the recipient wheat with the reference sequence number TraesCS2A02G286900, thereby knocking out the QIP3-2A gene; M22), inserting a thymidine deoxyribonucleotide (T) between positions 764 and 765 of the QIP3-2B gene of the recipient wheat reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; M23), an adenine deoxyribonucleotide (A) was inserted between positions 672 and 673 of the QIP3-2D gene of the recipient wheat reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0040] M3), subjecting the gene in the recipient plant to any one, two or three mutations in the following M31)-M33), wherein the plant is wheat: M31), the guanine deoxyribonucleotide (G) at position 697 of the QIP3-2A gene of the recipient wheat reference sequence number TraesCS2A02G286900 was deleted, thereby knocking out the QIP3-2A gene; M32), an adenine deoxyribonucleotide (A) was inserted between positions 764 and 765 of the QIP3-2B gene of the recipient wheat reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; M33), and inserted a cytosine deoxyribonucleotide (C) between positions 672 and 673 of the QIP3-2D gene of the recipient wheat reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0041] M4), subjecting the gene in the recipient plant to any one, two or three mutations in the following M41)-M43), wherein the plant is wheat: M41), deleting the four deoxyribonucleotides (TTTG) at positions 694 to 697 of the QIP3-2A gene of the recipient wheat with the reference sequence number TraesCS2A02G286900, thereby knocking out the QIP3-2A gene; M42), the two deoxyribonucleotides (CT) at positions 462 to 463 of the QIP3-2B gene of the recipient wheat reference sequence number TraesCS2B02G303900 were deleted, and a thymine deoxyribonucleotide (T) was inserted between positions 764 and 765 of TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; M42), and inserted a thymidine deoxyribonucleotide (T) between positions 672 and 673 of the QIP3-2D gene of the recipient wheat reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0042] The present application also provides a protein or a composition comprising the protein, wherein the protein is three, any two or any one of the three proteins whose amino acid sequences are SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0043] The present application also provides biological materials related to the protein or a composition comprising the protein, wherein the biological materials are as shown in the above B1) to B9).

[0044] The present application also provides a composition for genome editing. The composition is the above-mentioned genome editing system.

[0045] Furthermore, the genome editing system is a CRISPR / Cas system.

[0046] Furthermore, the CRISPR / Cas system can express a gRNA targeting the gene encoding the QIP3 protein and the effector protein of the CRISPR / Cas system: Cas9 protein.

[0047] Furthermore, the target site nucleotide sequence of the gRNA is SEQ ID NO:7 and / or SEQ ID NO:8.

[0048] As used herein, "editing" or "genome editing" refers to the use of targeted genome editing technology to generate targeted mutations, deletions, inversions or substitutions of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 1000, at least 2500, at least 5000 or at least 10,000 nucleotides of an endogenous plant genomic nucleic acid sequence.

[0049] In the present application, "editing" or "genome editing" also encompasses the targeted insertion or site-directed integration of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 750, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 4000, at least 5000 or at least 10,000 nucleotides into the endogenous genome of a plant using targeted genome editing technology.

[0050] In this application, a "target site" for genome editing refers to the position of a polynucleotide sequence in a plant genome, which is targeted and cut by a site-specific nuclease, thereby introducing a double-strand break (or a single-strand nick) into the nucleic acid backbone of the polynucleotide sequence and / or its complementary DNA strand. Site-specific nucleases can be bound to the target site, for example, via non-coding guide RNAs (such as, but not limited to, CRISPR RNA (crRNA) or single-stranded guide RNAs (sgRNA)). The non-coding guide RNA provided herein can be complementary to the target site (e.g., complementary to the strand of a double-stranded nucleic acid molecule or the chromosome of the target site). "Target site" also refers to the position of a polynucleotide sequence in a plant genome that is bound and cut by another site-specific nuclease, which may not be guided by a non-coding RNA molecule, such as a large range of nucleases, zinc finger nucleases (ZFNs), or transcription activator-like effector nucleases (TALENs), to introduce double-strand breaks (or single-strand nicks) into a polynucleotide sequence and / or its complementary DNA strand.

[0051] As used herein, the term "guide RNA" or "gRNA" is a short RNA sequence that comprises (1) a structural or scaffold RNA sequence required for binding or interacting with an RNA-guided nuclease and / or with other RNA molecules (e.g., tracrRNA), and (2) an RNA sequence that is identical or complementary to a target sequence or target site (referred to herein as a "guide sequence"). A "single-stranded guide RNA" (or "sgRNA") is an RNA molecule that comprises a tracrRNA and a crRNA covalently linked by a linker sequence, which can be expressed as a single RNA transcript or molecule. The guide RNA comprises a guide or targeting sequence ("guide sequence") that is identical or complementary to a target site within a plant genome, for example, at or near a GA oxidase gene. A protospacer adjacent motif (PAM) may be present in the genome immediately 5' to and upstream of a genomic target site sequence that is complementary to the targeting sequence of the guide RNA, i.e., immediately downstream (3') of the sense (+) strand of the genomic target site as known in the art (relative to the targeting sequence of the guide RNA). The genomic PAM sequence on the sense (+) strand adjacent to the target site (relative to the targeting sequence of the guide RNA) may comprise 5'-NGG-3'. However, the corresponding sequence of the guide RNA (i.e., immediately downstream (3') of the targeting sequence of the guide RNA) is typically not complementary to the genomic PAM sequence. The guide RNA may typically be a non-coding RNA molecule that does not encode a protein.

[0052] In this application, "RNA-guided nuclease" refers to an RNA-guided DNA endonuclease associated with the CRISPR system. Non-limiting examples of RNA-guided nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, homologs thereof, or modified forms thereof. In one embodiment, the RNA-guided nuclease is Cas9. In one embodiment, the RNA-guided nuclease comprises an N-terminal and a C-terminal nuclear localization sequence (NLS).

[0053] In some embodiments of the present application, the composition for genome editing can be co-delivered with a DNA molecule containing a selection or screening marker gene.

[0054] Furthermore, the Cas9 protein described in the present application is not limited to a specific protein, as long as it can be used in combination with the gRNA or sgRNA of the present application. Further, the Cas9 protein described in this article is selected from Streptococcus pyogenes Cas9 (spCas9, subtype II-A), spCas9HF (high fidelity), notchase Cas9 (nCas9), Staphylococcus aureus Cas9 (saCas9, subtype II-A), Neisseria meningitidis Cas9 (NmCas9, subtype II-C), Francisella novicida Cas9 (FnCas9, subtype II-B), Streptococcus thermophilus Cas9 (St1Cas9, St3Cas9), Campylobacter jejuni Cas9 (CjCas9) and Treponema sp. Cas9, as well as Cas9 orthologs of other organisms but are not limited thereto. The Cas9 protein may also include high-fidelity Cas9 mutants (such as SpCas9-HF1, eSpCas9-1.1 and TrueCut™HiFiCas9 protein), etc.

[0055] In this application, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence (or a nucleotide sequence) can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gapcost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the identity value (%) can be obtained.

[0056] The aforementioned 90% or more identity may be 90% or 95% or more identity.

[0057] The above-mentioned 80% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0058] The 80% or more identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or more identity may be at least 95%, 96%, 97%, 98%, or 99% identity.

[0059] The beneficial technical effects achieved by this application are as follows: Plant height and ear type are important factors that directly affect wheat growth traits and yield. This application has discovered a candidate gene that affects wheat plant height and / or ear length, and the plant height of its knockout strain is significantly reduced and the ear length is significantly increased. Studying the function of QIP3 and applying it in wheat breeding is of great significance to improving wheat growth traits and yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 The sequencing results and phenotypic verification of the QIP3 gene-edited strains. (a) The nucleotide sequence of the target site of the QIP3 gene double knockout and the genotype of the homozygous mutant strain. (b) The plant height phenotype of the QIP3 gene-edited strain and Fielder. (c) The panicle type (panicle length) phenotype of the QIP3 gene-edited strain and Fielder. (d) The statistical results of the plant height of the QIP3 gene-edited strain and Fielder and the results of the significant difference analysis. (e) The statistical results of the panicle type (panicle length) of the QIP3 gene-edited strain and Fielder and the results of the significant difference analysis.

[0061] Figure 2 This is the structure diagram of the 964bp PCR product in Example 1. DETAILED DESCRIPTION

[0062] The present application is further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present application, not for limiting the scope of the present application. The examples provided below can be used as a guide for further improvements by ordinary technicians in the technical field, and do not constitute a limitation of the present application in any way.

[0063] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0064] The pBUE411 and pCBC-MT1T2 vectors in the following examples are described in the following literature: He, G., Zhang, Y., Liu, P., Jing, Y., Zhang, L., Zhu, Y. et al. (2021) The transcriptionfactor TaLAX1 interacts with Q to antagonistically regulate grain threshability and spike morphogenesis in bread wheat. New phytologist, 230, 988-1002.

[0065] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0066] The following examples used Excel statistical software to process the data, and the experimental results were expressed as mean ± standard deviation and tested using t-test. ** indicates a significant difference (P < 0.01).

[0067] Example 1: Functional verification of the QIP3 gene and its encoded protein Through yeast two-hybrid screening, we identified a wheat spike-type regulatory protein Q interacting protein QIP3. According to the different chromosome distribution of the coding gene of the QIP3 protein, it is divided into three subgenomes, named: QIP3-2A gene, QIP3-2B gene and QIP3-2D gene.

[0068] The reference sequence number of the QIP3-2A gene in EnsemblPlants is TraesCS2A02G286900, and the location is Chromosome 2A: 488841530-488853598.

[0069] The reference sequence number of the QIP3-2B gene in EnsemblPlants is TraesCS2B02G303900, and the location is Chromosome 2B: 431523309-431536849.

[0070] The reference sequence number of the QIP3-2D gene in EnsemblPlants is TraesCS2D02G285500, and the position is Chromosome 2D: 363322221-363334390.

[0071] The genome sequence search results are from EnsemblPlants (Ensembl Plants release 60 -October 2024 ©EMBL-EBI), URL: https: / / plants.ensembl.org / Triticum_aestivum / Info / Index.

[0072] The coding sequences of the three alleles of the QIP3 gene, QIP3-2A, QIP3-2B and QIP3-2D, and the sequences encoding proteins are as follows: The nucleotide sequence of the coding region (CDS) of the QIP3-2A gene is shown in SEQ ID NO: 4, which encodes a protein with an amino acid sequence shown in SEQ ID NO: 1, and the protein is named QIP3-2A.

[0073] The nucleotide sequence of the coding region (CDS) of the QIP3-2B gene is shown in SEQ ID NO: 5, which encodes a protein with an amino acid sequence shown in SEQ ID NO: 2. The protein is named QIP3-2B.

[0074] The nucleotide sequence of the coding region (CDS) of the QIP3-2D gene is shown in SEQ ID NO: 6, which encodes a protein with an amino acid sequence shown in SEQ ID NO: 3, and the protein is named QIP3-2D.

[0075] 1.1. Construction of QIP3 gene editing vector In order to verify the function of the QIP3 gene, we constructed the QIP3-2A / 2B / 2D (TraesCS2A02G286900 / TraesCS2B02G303900 / TraesCS2D02G285500) CRRISPR / Cas9 gene editing vector. Since the three genes are highly homologous, we designed CRISPR / Cas9 dual targets for the conserved sequence of the QIP3 gene. The nucleotide sequences of the designed sgRNA target sites are as follows: sgRNA1 target site: 5'-GCCGGCGTCAACGCTCTGA-3' (SEQ ID NO:7), sgRNA2 target site: 5'-GACATCGATCTCTTTGCGG-3' (SEQ ID NO: 8).

[0076] The target site of sgRNA1 is located on the QIP3-2A, QIP3-2B and QIP3-2D genes; the target site of sgRNA2 is also located on the QIP3-2A, QIP3-2B and QIP3-2D genes; sgRNA1 and sgRNA1 dual-target targeting QIP3-2A, QIP3-2B and QIP3-2D genes are used to achieve knockout of QIP3-2A, QIP3-2B and QIP3-2D genes (also called QIP3-2A / 2B / 2D genes) using the CRISPR / Cas9 system.

[0077] According to the target site of sgRNA1 and the target site of sgRNA2, design the PCR amplification primer sequences (5' to 3') as follows.

[0078] QIP3-F: aataatggtctcAGGCGGCCGGCGTCAACGCTCTGA; QIP3-R: ATTATTGGTCTCTAAAACCCGCAAAGAGATCGATGTC; QIP3-F0: gGCCGGCGTCAACGCTCTGAgttttagagctagaaatagc; QIP3-R0: CCGCAAAGAGATCGATGTCCGCTTCTTGGTGCC.

[0079] The gene editing vector construction process is as follows: 1) PCR amplification Dissolve and mix the above four primers, where the concentrations of QIP3-F / R primers are 10 µM, and the concentrations of QIP3-F0 / R0 primers are 0.5 µM. The PCR reaction system is as follows: 47 µL of KOD Plus PCR reaction solution (can be premixed), 2 µL of four primer mixture, 1 µL of pCBC-DT1T2 (diluted 100 times), and the final volume of the system is 50 µL. The components of KOD Plus PCR reaction solution are as follows: 5 µL of KOD Plus buffer, 5 µL of 2 mM dNTP, 25 mM MgSO 4 5µL, KOD-Plus 1µL.

[0080] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; 30 cycles of (94°C for 5 s; 60°C for 30 s; 68°C for 1 min); and 68°C for 6 min.

[0081] 2) Enzyme digestion and ligation The above PCR product fragment (964 bp) was recovered, and the nucleotide sequence of the PCR product fragment was SEQ ID NO: 9. Its structure is as follows Figure 2 As shown in FIG. 9 , positions 18 to 36 of SEQ ID NO: 9 are the target site nucleotide sequence of sgRNA1, and positions 929 to 947 are the target site nucleotide sequence of sgRNA2.

[0082] The above PCR product fragment was digested with BsaI and ligated to the pBUE411 vector via T4 Ligase. The digestion-ligation reaction system was as follows: PCR fragment (964-bp) 2µL, pBUE411 2µL, 10×NEB T4 Buffer 1.5µL, 10×BSA 1.5µL, BsaI (NEB) 1µL, T4 Ligase (NEB) 1µL, ddH2O 6µL, total system volume 15µL.

[0083] The recombinant vector pBUE411-QIP3 contains two sgRNA expression cassettes and one Cas9 protein expression cassette. It can express sgRNA1 with a target site of SEQ ID NO:7, sgRNA2 with a target site of SEQ ID NO:2, and CRISPR / Cas9 effector protein Cas9. After being introduced into the receptor, the two transcribed guide RNAs (i.e., sgRNA1 and sgRNA2) can target the target sequence near the PAM of the receptor genome through complementary base pairing, i.e., target the QIP3-2A, QIP3-2B, and QIP3-2D genes. The Cas9 protein causes DNA double-strand breaks at the target sites of the QIP3-2A, QIP3-2B, and QIP3-2D genes. Through the organism's own DNA damage repair response mechanism, gene mutations occur in the sheared regions during the repair process, thereby achieving the knockout of the QIP3-2A, QIP3-2B, and QIP3-2D genes.

[0084] 1.2. Preparation of homozygous gene-edited strains The recombinant vector pBUE411-QIP3 was transformed into the recipient wheat Fielder according to the conventional Agrobacterium-mediated transformation method in the art to obtain multiple transformation events. The gene-edited positive strains were screened and self-pollinated for three consecutive generations. After PCR sequencing identification, three QIP3-2A / 2B / 2D homozygous gene-edited strains c were obtained, see Figure 1 In (a), they were named qip3-1, qip3-2, and qip3-3 respectively.

[0085] The sequencing results showed that: (1) Compared with wild-type wheat Fielder, in the qip3-1 mutant: The genome of QIP3-2A on two homologous chromosomes of wheat underwent the following changes: the cytosine deoxyribonucleotide (C) at position 698 of the QIP3-2A gene with the reference sequence number TraesCS2A02G286900 was deleted, thereby knocking out the QIP3-2A gene; The following changes occurred in the genome of QIP3-2B on the two homologous chromosomes of wheat: a thymidine deoxyribonucleotide (T) was inserted between positions 764 and 765 of the QIP3-2B gene with the reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; The following changes occurred in the genome of QIP3-2D on the two homologous chromosomes of wheat: an adenine deoxyribonucleotide (A) was inserted between positions 672 and 673 of the QIP3-2D gene with the reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0086] (2) Compared with wild-type wheat Fielder, in the qip3-2 mutant: The genome of QIP3-2A on two homologous chromosomes of wheat underwent the following changes: the guanine deoxyribonucleotide (G) at position 697 of the QIP3-2A gene with the reference sequence number TraesCS2A02G286900 was deleted, thereby knocking out the QIP3-2A gene; The following changes occurred in the genome of QIP3-2B on the two homologous chromosomes of wheat: an adenine deoxyribonucleotide (A) was inserted between positions 764 and 765 of the QIP3-2B gene with the reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; The following changes occurred in the genome of QIP3-2D on the two homologous chromosomes of wheat: a cytosine deoxyribonucleotide (C) was inserted between positions 672 and 673 of the QIP3-2D gene with the reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0087] (3) Compared with wild-type wheat Fielder, in the qip3-3 mutant: The genome of QIP3-2A on two homologous chromosomes of wheat underwent the following changes: 4 deoxyribonucleotides (TTTG) at positions 694 to 697 of the QIP3-2A gene with the reference sequence number TraesCS2A02G286900 were deleted, thereby knocking out the QIP3-2A gene; The following changes occurred in the genome of QIP3-2B on the two homologous chromosomes of wheat: 2 deoxyribonucleotides (CT) at positions 462 to 463 of the QIP3-2B gene with reference sequence number TraesCS2B02G303900 were deleted, and a thymine deoxyribonucleotide (T) was inserted between positions 764 and 765 of TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; The following changes occurred in the genome of QIP3-2D on the two homologous chromosomes of wheat: a thymidine deoxyribonucleotide (T) was inserted between positions 672 and 673 of the QIP3-2D gene with the reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0088] 1.3 Phenotypic identification of QIP3 gene-edited wheat materials Phenotypic verification was carried out in the spring planting of wheat experimental fields in the Chinese Academy of Agricultural Sciences, and the growth period was from March to July 2024. The experiment adopted the branch area planting, with 5 rows of each strain, 10 plants per row, 30 cm row spacing, and 10 cm plant spacing, with a total of three replicates.

[0089] At maturity, the plant height and ear length of each strain were measured and counted. Twelve trees of each strain were randomly measured and the results were averaged. The results showed that the gene-edited strains showed excellent agronomic traits of reduced plant height and increased ear length. The phenotypes and statistical data of each strain are shown in Figure 1 The above results indicate that QIP3 gene-edited wheat materials have the potential to increase wheat yield.

[0090] The present application has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present application, and without the need to carry out unnecessary experimental conditions, the present application can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present application provides specific embodiments, it should be understood that further improvements can be made to the present application. In a word, according to the principles of the present application, the present application is intended to include any changes, uses or improvements to the present application, including departure from the disclosed scope in the present application and changes made with conventional techniques known in the art.

Claims

1. Use of a protein or a biological material related to the protein in any of the following: A1) Application in regulating plant strains; A2) Application in the preparation of products for regulating plant height; A3) Application in regulating plant spike type; A4) Application in the preparation of products for regulating plant spike shape; A5) Application in plant breeding or plant assisted breeding; A6) Use in the preparation of products for plant breeding or plant-assisted breeding; The protein is QIP3 protein, and the QIP3 protein is any one of the following: a1) the amino acid sequences of the three proteins of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, respectively, are three, any two or any one; a2) a protein obtained by substituting, deleting and / or adding amino acids to the amino acid sequence of the protein shown in a1) and having more than 80% identity with the amino acid sequence shown in a1) and associated with plant height and / or panicle type; a3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a1) or a2).

2. The use according to claim 1, characterized in that: The biological material is any of the following: B1), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the QIP3 protein of claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7), transgenic plant organs containing the nucleic acid molecule described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3); B8), a nucleic acid molecule encoding the QIP3 protein of claim 1; B9), an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue and / or a transgenic plant organ containing the gene encoding the nucleic acid molecule described in B8).

3. The use according to claim 2, characterized in that: B1) the nucleic acid molecule is an RNA molecule whose target site nucleotide sequence is SEQ ID NO: 7 and / or SEQ ID NO: 8 or a DNA encoding the RNA molecule; B8) The nucleic acid molecule is a DNA molecule and / or an RNA encoded by the DNA molecule as described in any of the following: g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO: 4, 5 or 6; g2), the reference sequence number of the nucleotide sequence of the coding chain is TraesCS2A02G286900, TraesCS2B02G303900 or TraesCS2D02G285500 DNA molecules; g3) is a DNA molecule that has more than 80% identity with any of the DNA molecules in g1) or g2) and regulates plant height and / or panicle type.

4. A method for regulating plant height and / or panicle shape, characterized in that: The method comprises regulating the plant height and / or panicle type of the recipient plant by regulating the expression amount of the gene encoding the QIP3 protein of claim 1 and / or the content of the QIP3 protein in the recipient plant.

5. The method according to claim 4, characterized in that The method comprises reducing the plant height of the recipient plant and / or increasing the ear length of the recipient plant by reducing the expression amount of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant, wherein the recipient plant contains the encoding gene.

6. The method according to claim 5, characterized in that The expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant is reduced by knocking out the gene encoding the QIP3 protein in the recipient plant.

7. A method for preparing a target plant with reduced plant height and / or increased ear length, the method comprising reducing the expression level of the gene encoding the QIP3 protein according to claim 1 and / or the content of the QIP3 protein in the recipient plant, thereby obtaining a target plant with a lower plant height and / or a higher ear length than the recipient plant.

8. The method according to claim 5 or 7, characterized in that: The coding gene is a DNA molecule as described in any of the following: g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO: 4, 5 or 6; g2), the reference sequence number of the nucleotide sequence of the coding chain is TraesCS2A02G286900, TraesCS2B02G303900 or TraesCS2D02G285500 DNA molecules; g3) is a DNA molecule that has more than 80% identity with any of the DNA molecules in g1) or g2) and regulates plant height and / or panicle type.

9. The method according to any one of claims 5 to 8, characterized in that: Reducing the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant is achieved by any one of the following M1) to M4): M1), knocking out the gene encoding the QIP3 protein in the recipient plant by a genome editing system to reduce the expression amount of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant; Further, the genome editing system is a CRISPR / Cas system; Furthermore, the CRISPR / Cas system can express a gRNA targeting the gene encoding the QIP3 protein and an effector protein of the CRISPR / Cas system: Cas9 protein; Further, the target site nucleotide sequence of the gRNA is SEQ ID NO: 7 and / or SEQ ID NO: 8; M2), subjecting the gene in the recipient plant to any one, two or three mutations of the following M21)-M23), wherein the plant is wheat: M21), deleting the 698th cytosine deoxyribonucleotide of the QIP3-2A gene of the recipient wheat with the reference sequence number TraesCS2A02G286900, thereby knocking out the QIP3-2A gene; M22), inserting a thymidine deoxyribonucleotide between positions 764 and 765 of the QIP3-2B gene of the recipient wheat reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; M23), an adenine deoxyribonucleotide was inserted between positions 672 and 673 of the QIP3-2D gene of the recipient wheat reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene; M3), subjecting the gene in the recipient plant to any one, two or three mutations in the following M31)-M33), wherein the plant is wheat: M31), the guanine deoxyribonucleotide at position 697 of the QIP3-2A gene of the recipient wheat reference sequence number TraesCS2A02G286900 was deleted, thereby knocking out the QIP3-2A gene; M32), an adenine deoxyribonucleotide was inserted between positions 764 and 765 of the QIP3-2B gene of the recipient wheat reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; M33), inserting a cytosine deoxyribonucleotide between positions 672 and 673 of the QIP3-2D gene of the recipient wheat reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene; M4), subjecting the gene in the recipient plant to any one, two or three mutations in the following M41)-M43), wherein the plant is wheat: M41), deleting the four deoxyribonucleotides at positions 694 to 697 of the QIP3-2A gene of the recipient wheat with the reference sequence number TraesCS2A02G286900, thereby knocking out the QIP3-2A gene; M42), two deoxyribonucleotides at positions 462 to 463 of the QIP3-2B gene of the recipient wheat reference sequence number TraesCS2B02G303900 were deleted, and a thymine deoxyribonucleotide was inserted between positions 764 and 765 of TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; M42), and inserted a thymidine deoxyribonucleotide between positions 672 and 673 of the QIP3-2D gene of the recipient wheat reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

10. Any of the following substances: C1), a protein or a composition comprising the protein, wherein the protein is three, any two or any one of the three proteins whose amino acid sequences are SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 as described in claim 1; C2), C1) the protein-related biological material, the biological material as described in any one of claims 1-3; C3), a composition for genome editing, wherein the composition is the genome editing system according to claim 9; Further, the genome editing system is a CRISPR / Cas system; Furthermore, the CRISPR / Cas system can express a gRNA targeting the gene encoding the QIP3 protein and an effector protein of the CRISPR / Cas system: Cas9 protein; Furthermore, the target site nucleotide sequence of the gRNA is SEQ ID NO:7 and / or SEQ ID NO:8.

Images