Dengue attenuated strain and application thereof

Abstract

The invention discloses a dengue attenuated strain and application thereof, and relates to the technical field of biomedicine. The dengue attenuated strain comprises a functional structural domain of a recoded NS2A protein, a functional structural domain of a recoded NS2B protein and / or a functional structural domain of an NS1 protein. The coding sequence of the recoded functional structure domain of the NS2A protein, the recoded functional structure domain of the NS2B protein and / or the recoded functional structure domain of the NS1 protein has reduced codon pair preference compared with the coding sequence of the corresponding parent protein structure domain. The dengue vaccine can initiate good host protective immune response, has excellent hereditary stability, and is helpful for rapid development of effective dengue vaccines.

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, in particular to an attenuated dengue strain and application thereof. Background Art

[0002] Dengue fever is an acute insect-borne infectious disease caused by dengue virus (DENV). It is widely prevalent in more than 100 tropical and subtropical countries and regions. Nearly 3 billion people worldwide are at risk of dengue virus infection. Dengue virus belongs to the genus Flavivirus and is a single-stranded positive-strand RNA virus. Its genome is about 11kb long and consists of 5 terminal non-coding regions, 3 terminal non-coding regions, and a single open reading frame in the middle. The open reading frame encodes the precursor protein of the virus, which will eventually be cut into 3 viral structural proteins (C, prM, E) and 7 viral non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5). According to the different antigenicity of the E protein, dengue virus is divided into four serotypes: DENV-1, DENV-2, DENV-3 and DENV-4. After dengue virus infects the human body, it often induces antibody-dependent enhancement, making many vaccines that can only induce humoral immunity ineffective, and there are deficiencies in protecting young children and inducing a balanced immune response. Summary of the invention

[0003] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes a dengue attenuated strain that significantly weakens the virus pathogenicity and can induce a good host protective immune response, which is helpful for the rapid development of an effective dengue vaccine.

[0004] The present invention also provides a method for preparing the attenuated dengue strain.

[0005] The invention also provides a biomaterial.

[0006] The present invention also provides the application of the above-mentioned dengue attenuated strain or biological material.

[0007] The present invention also provides a vaccine comprising the above-mentioned attenuated dengue strain.

[0008] An attenuated dengue strain according to the first aspect of the present invention, the attenuated dengue strain comprises a re-encoded functional domain of NS2A protein, a functional domain of NS2B protein and / or a functional domain of NS1 protein;

[0009] The coding sequence of the re-encoded functional domain of the NS2A protein, the functional domain of the NS2B protein and / or the functional domain of the NS1 protein has a reduced codon pair preference compared to the corresponding parent protein domain coding sequence;

[0010] The furin cleavage site of the prM protein of the attenuated dengue strain has at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight or at least nine amino acid mutations.

[0011] The attenuated dengue strain according to the embodiment of the present invention has at least the following beneficial effects:

[0012] The dengue attenuated strain of the embodiment has good safety, can be used to prevent dengue virus infection, can induce a good host protective immune response, and has excellent genetic stability, which is conducive to the rapid development of an effective dengue vaccine. By selecting a suitable mutation at the furin protease cleavage site of the prM protein, the maturation process of the virus can be significantly promoted, which is conducive to the amplification of the dengue attenuated strain in the cell line, and full maturation is conducive to reducing the ADE effect.

[0013] According to some embodiments of the present invention, the attenuated dengue strain comprises a re-encoded functional domain of a non-structural protein, wherein the non-structural protein comprises NS2A protein, NS2B protein and / or NS1 protein.

[0014] According to some embodiments of the present invention, the attenuated dengue strain includes at least one of dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV.

[0015] According to some embodiments of the present invention, the attenuated dengue strain is dengue virus type I, and the amino acid sequence of the functional domain of the NS2A protein is positions 1 to 218 of the NS2A protein.

[0016] According to some embodiments of the present invention, the attenuated dengue strain is type II dengue virus, and the amino acid sequence of the functional domain of the NS2A protein is positions 1 to 218 of the NS2A protein.

[0017] According to some embodiments of the present invention, the attenuated dengue strain is type II dengue virus, and the amino acid sequence of the functional domain of the NS2B protein is positions 1 to 130 of the NS2B protein.

[0018] According to some embodiments of the present invention, the attenuated dengue strain is type II dengue virus, and the amino acid sequence of the functional domain of the NS1 protein is positions 1 to 352 of the NS1 protein.

[0019] According to some embodiments of the present invention, the attenuated dengue strain contains a re-encoded NS2A protein, NS2B protein and / or NS1 protein; the coding sequence of the re-encoded NS2A protein, NS2B protein and / or NS1 protein has a reduced codon pair preference compared to the corresponding parent protein coding sequence.

[0020] According to some embodiments of the present invention, the reduced codon pair preference is a codon pair preference reduced relative to a mammal. The mammal is susceptible to dengue virus.

[0021] According to some embodiments of the present invention, the mammal includes but is not limited to humans and mice.

[0022] According to some embodiments of the present invention, the codon pair bias (CPB) of the coding sequence of the re-encoded NS2A protein, NS2B protein and / or NS1 protein of the attenuated dengue strain is reduced by more than 0.3 compared with the parent protein. The CPB value is calculated with reference to the literature "Virus Attenuation by Genome-Scale Changes in Codon Pair Bias" (Coleman JR, Papamichail D, Skiena S, et al. Virus Attenuation by Genome-Scale Changes in Codon Pair Bias [J]. Science, 2008, 320 (5884): p. 1784-1787. DOI: 10.1126 / science.1155761.). For example: the CPB value can be reduced by 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44 or 0.45.

[0023] According to some embodiments of the present invention, the furin cleavage site is the amino acid sequence from position 83 to 92 of the prM protein.

[0024] According to some embodiments of the present invention, at least one, at least two or at least three of the amino acids at positions 85, 86 and 89 of the prM protein of the attenuated dengue strain are mutated.

[0025] According to some embodiments of the present invention, there are mutations in amino acids 85, 86, and 89 of the prM protein of the attenuated dengue strain.

[0026] According to some embodiments of the present invention, the attenuated dengue strain is a type II dengue virus, and the amino acid mutations E85A, H86G, and E89S exist at position 89 of the prM protein of the attenuated dengue strain.

[0027] According to some embodiments of the present invention, there is an amino acid mutation at position 89 of the prM protein of the attenuated dengue strain.

[0028] According to some embodiments of the present invention, the attenuated dengue strain is dengue virus type I, and there is an amino acid mutation D89K at position 89 of the prM protein of the attenuated dengue strain.

[0029] According to some embodiments of the present invention, the attenuated dengue strain is type II dengue virus, and the coding sequence of the re-encoded NS2A protein of the attenuated dengue strain is shown in the nucleotide sequence of positions 3478 to 4131 of SEQ ID NO:2.

[0030] According to some embodiments of the present invention, the attenuated dengue strain is a type II dengue virus, and the coding sequence of the re-encoded NS2B protein of the attenuated dengue strain is shown in the nucleotide sequence at positions 4132 to 4521 of SEQ ID NO:3.

[0031] According to some embodiments of the present invention, the attenuated dengue strain is dengue virus type II, and the coding sequence of the re-encoded NS1 protein of the attenuated dengue strain is shown in the nucleotide sequence at positions 2422 to 3477 of SEQ ID NO:4.

[0032] According to some embodiments of the present invention, the attenuated dengue strain is dengue virus type I, and the coding sequence of the re-encoded NS2A protein of the attenuated dengue strain is shown in the nucleotide sequence of positions 3476 to 4129 of SEQ ID NO:6.

[0033] According to some embodiments of the present invention, the attenuated dengue strain further includes C protein, prM protein, E protein, NS3 protein, NS4A protein, NS4B protein, and NS5 protein.

[0034] According to some embodiments of the present invention, the nucleotide sequence of the cDNA corresponding to the genomic RNA of the attenuated dengue strain is shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 6. Thus, the codon pair preference can be reduced without changing the overall codon usage rate and maintaining a significant change in the local and overall free energy of the RNA.

[0035] According to the second aspect of the present invention, the method for preparing the attenuated dengue strain comprises the following steps:

[0036] The attenuated dengue strain is obtained by rescuing the attenuated dengue strain in cells through reverse genetic technology using a vector carrying the genome of the attenuated dengue strain.

[0037] According to some embodiments of the present invention, the culture temperature of the cells is 34°C to 37°C.

[0038] A biomaterial according to the third aspect of the present invention is selected from any one of A1) to A6);

[0039] A1) an isolated nucleic acid molecule comprising the nucleic acid sequence of the whole genome of the above-mentioned attenuated dengue strain;

[0040] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0041] A3) a vector containing the nucleic acid molecule described in A1) or the expression cassette described in A2);

[0042] A4) a recombinant microorganism containing the nucleic acid molecule described in A1), the expression cassette described in A2) or the vector described in A3);

[0043] A5) a cell containing the nucleic acid molecule described in A1), the expression cassette described in A2) or the vector described in A3);

[0044] A6) The attenuated dengue strain produced by culturing the cells described in A5).

[0045] According to some embodiments of the present invention, the nucleic acid sequence is gene RNA or its corresponding cDNA.

[0046] According to some embodiments of the present invention, the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:6.

[0047] According to some embodiments of the present invention, the vector is an expression vector or a cloning vector. For example, the vector is a pCC1 vector.

[0048] According to some embodiments of the present invention, the 5' end of the nucleic acid molecule contains a promoter. The promoter includes at least one of a T7 promoter and a CMV promoter. The nucleotide sequence of the T7 promoter is shown in SEQ ID NO:7.

[0049] According to some embodiments of the present invention, the 3' end of the nucleic acid molecule contains a hepatitis D ribozyme sequence, the nucleotide sequence of which is shown in SEQ ID NO:8.

[0050] According to some embodiments of the present invention, the recombinant microorganism is a bacterium, a yeast, an algae or a fungus.

[0051] According to some embodiments of the present invention, the cell is an in vitro animal cell. For example, the cell may be a Vero cell.

[0052] According to some embodiments of the invention, the cells do not comprise propagation material.

[0053] According to the fourth aspect of the present invention, the use of the attenuated dengue strain or the biological material in any one of B1) to B3):

[0054] B1) preparing products for screening drugs against dengue virus;

[0055] B2) Screening for drugs to prevent and / or treat dengue virus;

[0056] B3) Preparation of products for evaluating the efficacy of anti-dengue virus drugs.

[0057] According to some embodiments of the present invention, the product is selected from a drug and a kit.

[0058] According to a fifth aspect of the present invention, a vaccine, wherein the active ingredient of the vaccine comprises the attenuated dengue strain. Since the vaccine adopts all the technical solutions of the attenuated dengue strain of the above embodiment, it has at least all the beneficial effects brought by the technical solutions of the above embodiment.

[0059] According to some embodiments of the present invention, the vaccine further comprises a pharmaceutically acceptable adjuvant or carrier.

[0060] According to some embodiments of the present invention, the dosage form of the vaccine is at least one of a liquid injection, an injection powder and an injection tablet.

[0061] According to some embodiments of the present invention, the adjuvant is selected from at least one of oil adjuvants, oil-in-water adjuvants, water-in-oil adjuvants, water-in-oil-in-water adjuvants, aluminum salts and polysaccharide adjuvants.

[0062] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 It is a schematic diagram of the region for negative optimization of codon pairs for the dengue virus genome;

[0064] Figure 2 The DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, DENV2-NS2B-CPD recombinant virus, and DENV1-NS2A-CPD recombinant virus were diluted 10 3 After that, the 16681 recombinant virus and the Western Pacific recombinant virus were diluted 10 4 The subsequent viral plaque morphology;

[0065] Figure 3Replication levels of 16681 recombinant virus, DENV2-NS2A-CPD recombinant virus, DENV2-NS2B-CPD recombinant virus, and DENV2-NS1-CPD recombinant virus after infecting human cell lines; "ns" means no significant difference, "**" means significant difference (p<0.01), and "****" means extremely significant difference (p<0.0001);

[0066] Figure 4 Represents the replication level of human cell lines infected with Western Pacific recombinant virus and DENV1-NS2A-CPD recombinant virus; "ns" means no significant difference, and "****" means extremely significant difference (p<0.0001);

[0067] Figure 5 Replication levels of DENV2-NS2A-CPD recombinant virus at different temperatures; "*" indicates significant difference (p<0.05), and "****" indicates extremely significant difference (p<0.0001);

[0068] Figure 6 The changes in the levels of viral RNA in the blood of AG6 mice after infection with 16681 recombinant virus, DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus; "*" indicates a significant difference relative to the 16681 recombinant virus group (p<0.05), "***" indicates an extremely significant difference relative to the 16681 recombinant virus group (p<0.001), and "****" indicates an extremely significant difference relative to the 16681 recombinant virus group (p<0.0001);

[0069] Figure 7 The survival of AG6 mice infected with 16681 recombinant virus, DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus;

[0070] Figure 8 The specific IgG antibody titers in the serum of AG6 mice 25 days after infection with 16681 recombinant virus, DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus; A: specific IgG antibody titer of E protein; B: specific IgG antibody titer of NS1 protein; "ns" means no significant difference, and "*" means significant difference (p<0.05);

[0071] Fig. 9 The virus infection status of mice immunized with different methods 2 and 4 days after challenge with dengue virus type Ⅱ;

[0072] Fig.10 The weight changes of mice after different immunization methods were challenged with dengue virus type II; "**" means there is a very significant difference relative to the DPBS group (p<0.01), "***" means there is a very significant difference relative to the DPBS group (p<0.001), and "****" means there is a very significant difference relative to the DPBS group (p<0.0001);

[0073] Fig.11 The changes in the viral RNA levels in the blood of AG6 mice after infection with Western Pacific recombinant virus and DENV1-NS2A-CPD recombinant virus; "**" indicates a very significant difference relative to the Western Pacific recombinant virus group (p<0.01), and "****" indicates a very significant difference relative to the Western Pacific recombinant virus group (p<0.0001);

[0074] Fig.12 The survival of AG6 mice infected with Western Pacific recombinant virus and DENV1-NS2A-CPD recombinant virus;

[0075] Fig.13 Shown are the viral infection conditions of mice immunized with different methods 2 and 4 days after being challenged with dengue virus type 1. DETAILED DESCRIPTION

[0076] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0077] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0078] Example 1: Obtaining attenuated dengue strains

[0079] (1) Negative optimization of codon pairs of dengue virus gene:

[0080] The codon pair bias of the gene was calculated based on the human codon pair preference table and CPB calculation formula provided in the paper "Virus Attenuation by Genome-Scale Changes in Codon Pair Bias" published by Coleman et al.

[0081] Based on the type II dengue wild-type strain 16681 (the viral genome cDNA sequence is shown in SEQ ID NO: 1), the nucleotide sequences of its NS1, NS2A and NS2B genes were rearranged respectively to reduce the codon pair preference of these three genes. The NS2A gene was negatively optimized, and its CPB value was reduced from -0.031995392 to -0.339525346, and three amino acid mutations were introduced into the prM gene, specifically, the glutamic acid at position 85 of prM was changed to alanine (E85A), the histidine at position 86 was changed to glycine (H86G), and the glutamic acid at position 89 was changed to serine (E89S), and the type II dengue attenuated strain DENV2-NS2A-CPD was obtained, and the viral genome cDNA sequence is shown in SEQ ID NO: 2. The NS2B gene was negatively optimized, and its CPB value was reduced from 0.038294574 to -0.368937984, and three amino acid mutations (E85A, H86G, E89S) were introduced into the prM gene to obtain the type II dengue attenuated strain DENV2-NS2B-CPD, and its viral genome cDNA sequence is shown in SEQ ID NO: 3. The NS1 gene was negatively optimized, and its CPB value was reduced from 0.038102564 to -0.329988604, and three amino acid mutations (E85A, H86G, E89S) were introduced into the prM gene to obtain the type II dengue attenuated strain DENV2-NS1-CPD, and its viral genome cDNA sequence is shown in SEQ ID NO: 4.

[0082] Based on the wild-type dengue strain Western Pacific (the viral genome cDNA sequence is shown in SEQ ID NO:5), the nucleotide sequence of its NS2A gene was rearranged to reduce CPB. The NS2A gene was negatively optimized, and its CPB value was reduced from -0.011981567 to -0.375963134; and an amino acid mutation was introduced into the prM gene, specifically, aspartic acid at position 89 of prM was changed to lysine (D89K), and the type I dengue attenuated strain DENV1-NS2A-CPD was obtained, and its viral genome cDNA sequence is shown in SEQ ID NO:6.

[0083] The regions in the dengue virus genome where codon pairs were negatively optimized are as follows Figure 1 shown.

[0084] (2) Construction of infectious clone plasmid of dengue attenuated strain:

[0085] The viral genome cDNA sequences of synthesized type II dengue wild-type strain 16681, type II dengue attenuated strain DENV2-NS2A-CPD, type II dengue attenuated strain DENV2-NS2B-CPD, type II dengue attenuated strain DENV2-NS1-CPD, type I dengue wild-type strain Western Pacific, and type I dengue attenuated strain DEN V1-NS2A-CPD (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6). The viral cDNA fragment was amplified by PCR and cloned into the pCC1 vector. The T7 promoter (TAATACGACTCACTATAG (SEQ ID NO: 7)) and the hepatitis D ribozyme sequence (HDVr) (GGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCTGGGCTACTTCGGTA GGCTAAGGGAGAAG (SEQ ID NO: 8)) were added to the 5' and 3' ends of the viral cDNA, respectively, to obtain infectious clone plasmids pCC1-16681, pCC1-DENV2-NS2A-CPD, pCC1-DENV2-NS2B-CPD, pCC1-DENV2-NS1-CPD, pCC1-WesternPacific, and pCC1-DENV1-NS2A-CPD, respectively.

[0086] (3) Acquisition of recombinant viruses:

[0087] DENV2 infectious clone plasmids (pCC1-16681, pCC1-DENV2-NS2A-CPD, pCC1-DENV2-NS2B-CPD, pCC1-DENV2-NS1-CPD) were digested with restriction endonuclease ClaI, and DENV1 infectious clone plasmids (pCC1-Western Pacific, pCC1-DENV1-NS2A-CPD) were digested with restriction endonuclease PacI, and the digestion products were extracted and purified by phenol chloroform method, and ethanol precipitation was performed to obtain linearized plasmid fragments. Subsequently, in vitro transcription was performed using the T7 promoter located upstream of the viral genome to obtain the full-length RNA of 16681, DENV2-NS2A-CPD, DENV2-NS2B-CPD, DENV2-NS1-CPD, Western Pacific, and DENV1-NS2A-CPD viruses, respectively. The viral RNA was transfected into BHK-21 cells via liposomes. After culturing at 30°C for 6 days, the 16681 recombinant virus, DENV2-NS2A-CPD recombinant virus, DENV2-NS2B-CPD recombinant virus, DENV2-NS1-CPD recombinant virus, Western Pacific recombinant virus, and DENV1-NS2A-CPD recombinant virus were collected from the cell supernatant culture medium.

[0088] Experimental Example 1: Plaque morphology and growth characteristics of dengue attenuated vaccine

[0089] (1) According to 1×10 5 BHK-21 cells were plated in 24-well plates and 10 5 ~10 7The 16681 recombinant virus, DENV2-NS2A-CPD recombinant virus, DENV2-NS2B-CPD recombinant virus, DENV2-NS1-CPD recombinant virus, Western Pacific recombinant virus, and DENV1-NS2A-CPD recombinant virus with a PFU / mL titer were respectively diluted 10-fold in a continuous gradient with culture medium, and each virus was diluted 6 gradients. 200 μL of virus dilution solution was added to each well and infected at 37°C for 1 hour. Subsequently, 1 mL of culture medium (Overlay medium) containing 0.8% methylcellulose was added to each well and cultured at 37°C. On the 6th day after infection, the culture medium was removed, and 1 mL of fixative (acetone and methanol mixed in a volume ratio of 1:1) was added to each well for fixation for 30 minutes. The fixative was removed and 0.5 mL The cells were washed with PBS for 3 times, and then 0.5 mL of blocking solution (PBS containing 3% FBS) was added and incubated at room temperature for 1 h. The blocking solution was removed, and 150 μL of dengue virus antibody diluent (dengue virus antibody D1-11 (3) (Invitrogen, MA1-27093) was diluted with blocking solution at a ratio of 1:2000) was added. The cells were incubated at 4°C overnight, and then the antibody was removed. The cells were washed with PBS for 3 times, and 150 μL of secondary antibody diluent (horseradish peroxidase-labeled mouse secondary antibody (Thermo, 31430) was diluted with blocking solution at a ratio of 1:1000) was added. The cells were incubated at room temperature for 1 h. The secondary antibody was removed, and the cells were washed with PBS for 3 times. Then 150 μL of peroxidase substrate (Seracare, 5510-0030) was added and protected from light for 30 min. The reaction was terminated by washing with water for 3 times, and the staining of virus plaques was recorded by photographing.

[0090] The results are as follows Figure 2 shown.

[0091] The DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus all have smaller plaque morphology than the 16681 recombinant virus, and the DENV1-NS2A-CPD recombinant virus has smaller plaque morphology than the Western Pacific recombinant virus. This indicates that the cytopathic effect induced by the DENV2-NS1-CPD recombinant virus, the DENV2-NS2A-CPD recombinant virus, the DENV2-NS2B-CPD recombinant virus, and the DENV1-NS2A-CPD recombinant virus is weakened compared with the corresponding wild-type viruses 16681 and Western Pacific.

[0092] (2) The 16681 recombinant virus, DENV2-NS2A-CPD recombinant virus, DENV2-NS2B-CPD recombinant virus, DENV2-NS1-CPD recombinant virus, Western Pacific recombinant virus, and DENV1-NS2A-CPD recombinant virus were used to infect Huh7 cells (4×10 5 cells / well), the virus solution was removed after infection at 37°C for 1 h, the cells were washed three times with PBS, and fresh culture medium was replaced and cultured in a 37°C incubator. 150 μL of cell supernatant was collected from each well 24 h, 48 h, 72 h, 96 h, and 120 h after infection, viral RNA was extracted, and the number of viral RNA copies was detected by real-time quantitative fluorescence PCR.

[0093] The results are as follows Figure 3 , Figure 4 shown.

[0094] The viral copy numbers of the DENV2-NS2A-CPD recombinant virus, the DENV2-NS2B-CPD recombinant virus, and the DENV2-NS1-CPD recombinant virus were significantly decreased compared with the 16681 recombinant virus 72h, 96h, and 120h after infection of the cells; among them, the copy numbers of the 16681 recombinant virus were reduced by more than 100 times after 120h of infection. The viral copy numbers of the DENV1-NS2A-CPD recombinant virus were significantly decreased compared with the Western Pacific recombinant virus 96h and 120h after infection of the cells; among them, the copy numbers of the Western Pacific recombinant virus were reduced by more than 50 times after 120h of infection. This indicates that the replication ability of the DENV2-NS2A-CPD recombinant virus, the DENV2-NS2B-CPD recombinant virus, the DENV2-NS1-CPD recombinant virus, and the DENV1-NS2A-CPD recombinant virus in cells is reduced, revealing its attenuated properties in the cell system.

[0095] Experimental Example 2: Optimization of growth conditions for attenuated dengue strains

[0096] The DENV2-NS2A-CPD recombinant virus was used to infect Vero cells (4×10 5 cells / well), the virus solution was removed after infection at 37°C for 1 hour, the cells were washed with PBS three times, and fresh culture medium was replaced. The cells were cultured in incubators at 37°C and 34°C, respectively. 150 μL of cell supernatant was collected from each well 72h and 96h after infection, viral RNA was extracted, and the number of viral RNA copies was detected by real-time quantitative fluorescence PCR.

[0097] The results are as follows Figure 5 shown.

[0098] The DENV2-NS2A-CPD recombinant virus had a higher viral copy number at 34°C compared to 37°C; 72 hours after infection, the viral copy number increased by more than 20 times. This indicates that 34°C is more suitable for the growth of the DENV2-NS2A-CPD recombinant virus.

[0099] Experimental Example 3: Safety and efficacy evaluation of attenuated dengue strains

[0100] Animal experiments were performed using C57BL / 6 mice (AG6) deficient in type Ⅰ and Ⅱ interferon receptors provided by the Shanghai Pasteur Institute of the Chinese Academy of Sciences.

[0101] (1) Twenty-five 4-week-old female AG6 mice were randomly divided into five groups, with five mice in each group. The mice in the control group were subcutaneously injected with 100 μL of DPBS; the mice in the other four groups were subcutaneously immunized with an equal volume of 10 5 TCID 50 The mice were given 16681 doses of recombinant virus, DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus. Blood was collected 2 to 7 days after immunization, and viral RNA levels were detected by qPCR. The survival of mice after immunization was also monitored. Serum was collected 25 days after immunization, and the specific IgG antibody titers against DENV2 viral protein E or NS1 were detected by ELISA test. The challenge experiment was carried out 28 days after immunization, and all mice were intraperitoneally injected with 10 6 TCID 50 The mice were inoculated with a dose of wild-type dengue virus type 2 strain 43 (NCBI Sequence ID: AF204178), and blood was collected 2 and 4 days after challenge. The virus titer was detected by plaque assay, and the weight changes of mice were monitored daily.

[0102] The results are as follows Figures 6 to 10 shown.

[0103] On the 4th day after immunization, the viremia of mice caused by the DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus was significantly reduced compared with the 16681 recombinant virus (reduced by 488 times, 19 times, and 60 times, respectively). In addition, there was no death in mice immunized with the DENV2-NS1-CPD recombinant virus, the DENV2-NS2A-CPD recombinant virus, and the DENV2-NS2B-CPD recombinant virus, while the 16681 recombinant virus caused the death of mice.

[0104] DENV2-NS1-CPD recombinant virus, DENV2-NS2A-CPD recombinant virus, and DENV2-NS2B-CPD recombinant virus can induce antibodies in mice after immunization. Among them, DENV2-NS2A-CPD recombinant virus and DENV2-NS2B-CPD recombinant virus have higher antibody levels after immunization; compared with DENV2-NS1-CPD, the E protein specific antibody titer of DENV2-NS2A-CPD recombinant virus immunization increased significantly by more than 4 times.

[0105] Infectious viruses were detected in the blood of mice immunized with DPBS or DENV2-NS1-CPD recombinant virus after challenge, and the weight of mice began to decrease from the 4th day after challenge; while mice pre-immunized with DENV2-NS2A-CPD recombinant virus or DENV2-NS2B-CPD recombinant virus could completely prevent infection with type 2 dengue virus, and their body weight was significantly higher than that of mice immunized with DPBS 4 to 8 days after challenge.

[0106] This shows that the DENV2-NS2A-CPD recombinant virus and the DENV2-NS2B-CPD recombinant virus can prevent infection with type 2 dengue virus and protect the health of mice, and have the potential to be used as attenuated vaccines.

[0107] (2) Thirty 4-week-old female AG6 mice were randomly divided into three groups, with 10 mice in each group. The mice in the control group were subcutaneously injected with 100 μL of DPBS; the mice in the other two groups were subcutaneously immunized with an equal volume of 10 4 TCID 50 The Western Pacific recombinant virus and DENV1-NS2A-CPD recombinant virus were injected intraperitoneally with 10 6 TCID 50 The mice were infected with a dose of type Ⅰ dengue wild-type strain DENV1-1_AUS_H_T1_9 (NCBI Sequence ID: OK605753), and blood was collected 2 and 4 days after the challenge, and the virus titer was detected by plaque assay.

[0108] The results are as follows Figures 11 to 13 shown.

[0109] On days 4, 6, and 7 after immunization, the viremia of mice caused by the DENV1-NS2A-CPD recombinant virus was significantly reduced compared with that caused by the Western Pacific recombinant virus; among them, the RNA copy number decreased by more than 5,000 times on the 4th day.

[0110] All 10 mice immunized with the Western Pacific recombinant virus died 11-17 days after immunization, while only 2 mice immunized with the DENV1-NS2A-CPD recombinant virus died at day 20. This indicates that the toxicity of DENV1-NS2A-CPD is significantly lower than that of Western Pacific.

[0111] Infectious viruses were detected in the blood of mice immunized with DPBS after challenge, while mice pre-immunized with the DENV1-NS2A-CPD recombinant virus were completely protected from infection with dengue virus type 1. This suggests that the DENV1-NS2A-CPD recombinant virus has the potential to be used as an attenuated vaccine.

[0112] The embodiments of the present invention are described in detail above in conjunction with the embodiments, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge scope of ordinary technicians in the relevant technical field without departing from the purpose of the present invention.

Claims

1. A dengue attenuated strain, characterized in that: The attenuated dengue strain comprises a re-encoded functional domain of NS2A protein, a functional domain of NS2B protein and / or a functional domain of NS1 protein; The coding sequence of the re-encoded functional domain of the NS2A protein, the functional domain of the NS2B protein and / or the functional domain of the NS1 protein has a reduced codon pair preference compared to the corresponding parent protein domain coding sequence; The furin cleavage site of the prM protein of the attenuated dengue strain has at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight or at least nine amino acid mutations.

2. The attenuated dengue strain according to claim 1, characterized in that The codon pair preference of the coding sequence of the re-encoded NS2A protein, NS2B protein and / or NS1 protein of the attenuated dengue strain is reduced by more than 0.3 compared with the parent protein.

3. The attenuated dengue strain according to claim 1, characterized in that The 89th amino acid of the prM protein of the attenuated dengue strain is mutated.

4. The attenuated dengue strain according to claim 1, characterized in that The amino acids at positions 85, 86 and 89 of the prM protein of the attenuated dengue strain are mutated.

5. The attenuated dengue strain according to claim 1, characterized in that The attenuated dengue strain is type II dengue virus, and the coding sequence of the re-encoded NS2A protein of the attenuated dengue strain is shown in the nucleotide sequence of positions 3478 to 4131 of SEQ ID NO: 2; And / or, the attenuated dengue strain is type II dengue virus, and the coding sequence of the re-encoded NS2B protein of the attenuated dengue strain is shown in the nucleotide sequence of positions 4132 to 4521 of SEQ ID NO:3; And / or, the attenuated dengue strain is type II dengue virus, and the coding sequence of the re-encoded NS1 protein of the attenuated dengue strain is shown in the nucleotide sequence of positions 2422 to 3477 of SEQ ID NO: 4; And / or, the attenuated dengue strain is type I dengue virus, and the coding sequence of the re-encoded NS2A protein of the attenuated dengue strain is shown in the nucleotide sequence at positions 3476 to 4129 of SEQ ID NO:

6.

6. The method for preparing the attenuated dengue strain according to any one of claims 1 to 5, characterized in that: The steps include: The attenuated dengue strain is obtained by rescuing the attenuated dengue strain in cells through reverse genetic technology using a vector carrying the genome of the attenuated dengue strain.

7. A biomaterial, characterized in that: The biological material is selected from any one of A1) to A6); A1) An isolated nucleic acid molecule comprising the nucleic acid sequence of the whole genome of the attenuated dengue strain according to any one of claims 1 to 5; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a vector containing the nucleic acid molecule described in A1) or the expression cassette described in A2); A4) a recombinant microorganism containing the nucleic acid molecule described in A1), the expression cassette described in A2) or the vector described in A3); A5) a cell containing the nucleic acid molecule described in A1), the expression cassette described in A2) or the vector described in A3); A6) The attenuated dengue strain produced by culturing the cells described in A5).

8. The biomaterial according to claim 7, characterized in that The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:

6.

9. Use of the attenuated dengue strain according to any one of claims 1 to 5 or the biological material according to any one of claims 7 to 8 in any one of B1) to B3): B1) preparing products for screening drugs against dengue virus; B2) Screening for drugs to prevent and / or treat dengue virus; B3) Preparation of products for evaluating the efficacy of anti-dengue virus drugs.

10. A vaccine, characterized in that The active ingredient of the vaccine comprises the attenuated dengue strain according to any one of claims 1 to 5.

Images