Method for improving disease and pest resistance of cotton

Abstract

The invention relates to a method for improving plant disease and insect pest resistance of cotton. The plant disease and insect pest resistance of the cotton is improved by inhibiting expression and / or activity of protein coded by a VQ22 gene in the cotton. The invention also relates to cotton obtained by inhibiting the expression and / or activity of the protein encoded by the VQ22 gene, a composition for inhibiting the expression and / or activity of the protein encoded by the VQ22 gene and application of the composition.

Description

Technical Field

[0001] The invention relates to the field of plant biotechnology, and in particular to a method for improving the disease and insect pest resistance of cotton. Background Art

[0002] Cotton is one of the most important economic crops in the world. The pigment glands of cotton plants accumulate a large amount of secondary metabolites such as gossypol to protect the plant from pathogen infection and insect feeding. Therefore, by increasing the content of secondary metabolites in the glands of cotton leaves, the cotton's resistance to diseases and pests can be enhanced and the use of pesticides during the planting process can be reduced.

[0003] Cotton pigment glands are cavity structures unique to the genus Gossypium and its closely related plants. They are distributed in various tissues of the plant and are black or brown spherical structures visible to the naked eye. It is currently believed that mature pigment glands are composed of 1-3 layers of sheath cells surrounding a cavity containing secretions. The formation of the pigment gland cavity is a typical lysozygous development, which is formed by certain primitive cells after undergoing cell lysis and programmed cell death. Pigment glands synthesize and accumulate a large amount of terpene secondary metabolites such as cotton, thereby helping cotton resist pests. Therefore, pigment glands are also called cotton's defensive structure, and their size directly affects the synthesis and accumulation capacity of terpene secondary metabolites such as cottonpol, which in turn affects the plant's ability to resist diseases and pests.

[0004] The development of pigment glands in cotton is closely related to its resistance to diseases and insect pests. Existing studies have shown that cotton without pigment glands is more susceptible to bollworms than cotton with pigment glands, and cotton varieties with high gossypol content have better insect resistance (Zhang Jianxian and Chen Qihu, Brief report on the study of cotton varieties' resistance to bollworms, Journal of Zhejiang Agricultural University, 1989, 16(1):14-19; Benedict, J., et al. "Glandless Acala cotton: more susceptible to insects." California Agriculture 31.4(1977):14-15.).

[0005] Therefore, it is necessary to develop methods to increase the content of secondary metabolites such as gossypol in cotton, thereby improving the disease and insect pest resistance of cotton. Summary of the invention

[0006] The present invention obtains for the first time a gene that negatively regulates the size of cotton glands, the cotton VQ22 gene. After inhibiting the expression of the VQ22 gene or knocking out the VQ22 gene, the diameter of the pigment glands of the mutant cotton significantly increases, and the secondary metabolites change significantly. Compared with wild-type cotton, the mutant cotton has significantly improved resistance to diseases and insect pests.

[0007] Accordingly, in a first aspect, the present invention provides a method for improving the disease and insect pest resistance of cotton, the method comprising inhibiting the expression and / or activity of a protein encoded by a VQ22 gene in the cotton.

[0008] As used herein, the terms "comprising," "having," "including," and "containing" should be construed as open-ended terms (ie, meaning "including, but not limited to, ").

[0009] In this article, "and / or" refers to and includes any and all possible combinations of one or more items in the associated listed items. For example, a composition comprising A and / or B can be interpreted as a composition comprising A, a composition comprising B, or a composition comprising A and B.

[0010] The terms "protein", "protein", "peptide", "polypeptide" and "amino acid sequence" are used interchangeably and in their broadest sense refer to a polymeric form of two or more amino acid subunits, amino acid analogs or peptidomimetics. "Protein", "protein", "peptide", "polypeptide" and "amino acid sequence" contain at least two amino acids, and there is no limitation on the maximum number of amino acids. The term "amino acid" as used herein refers to natural and / or non-natural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0011] The terms "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", "nucleotide sequence" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, the term includes, but is not limited to, single-stranded, double-stranded or double-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising, consisting of, or consisting essentially of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases.

[0012] When the term "encoding" is applied to a nucleotide sequence (e.g., the VQ22 gene described herein), it refers to a nucleotide sequence that can be transcribed to produce mRNA and / or translated to produce a polypeptide in its native state or when manipulated by methods well known to those skilled in the art, then it is called "encoding" RNA or "encoding" a polypeptide. The antisense strand is the complement of this nucleic acid, and the coding sequence can be deduced from it.

[0013] As used herein, "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, amino acid sequence or protein. In some cases, "expression" as described herein also includes splicing, modification, processing, etc. of mRNA molecules.

[0014] "Inhibiting the expression and / or activity of the protein encoded by the VQ22 gene in the cotton" includes but is not limited to inhibiting the initiation of VQ22 gene transcription, mediating the degradation of mRNA generated by its transcription, reducing the stability of mRNA generated by its transcription, terminating VQ22 gene transcription prematurely, destroying the VQ22 gene expression frame, mediating the degradation of the protein encoded by the VQ22 gene, and destroying the function of the protein encoded by the VQ22 gene.

[0015] In some embodiments, inhibiting the expression and / or activity of the protein encoded by the VQ22 gene in the cotton is achieved by one or more methods selected from the group consisting of gene knockout, gene silencing, gene mutation, and introduction of agents that inhibit the expression and / or activity of the protein encoded by the VQ22 gene.

[0016] In some embodiments, the gene knockout of the VQ22 gene of the present invention is achieved by gene editing technology. In some preferred embodiments, the gene editing technology includes one or more selected from the group consisting of zinc finger nuclease (ZFN) technology, transcription activating effector nuclease (TALEN) technology, and CRISPR / Cas system-mediated gene editing technology.

[0017] In some specific embodiments, the method of the present invention comprises the following steps:

[0018] (1) contacting cotton seeds, tissues, cells, organs or plants with reagents for gene editing;

[0019] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0020] In some preferred embodiments, the method of the present invention comprises the following steps:

[0021] (1) contacting cotton seeds, tissues, cells, organs or plants with a reagent comprising a guide RNA (gRNA) targeting a VQ22 gene and a Cas protein;

[0022] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0023] In some preferred embodiments, the method of the present invention comprises the following steps:

[0024] (1) contacting cotton seeds, tissues, cells, organs or plants with a reagent comprising a vector containing a nucleotide sequence encoding a gRNA targeting a VQ22 gene and a Cas protein;

[0025] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0026] "Vector" refers to a delivery tool or element of genetic material. In this article, the term "vector" refers to one or a series of macromolecules comprising polynucleotides, which promote the delivery of polynucleotides to target cells, target tissues or target organs in vitro or in vivo. The polynucleotides to be delivered are sometimes referred to as "target genes", including but not limited to coding sequences of certain proteins or polypeptides that can enhance, inhibit, weaken, protect, trigger or prevent certain biological functions and physiological functions, coding sequences of RNAi components or optional markers. In the vector, the coding sequences of proteins, polypeptides, RNAi components, etc. are usually operably connected to expression control elements, such as promoters. In some embodiments, the vector can be a straight-chain DNA molecule. In some embodiments, the vector can be a circular DNA molecule. In some embodiments, the vector can be a single-stranded DNA molecule, a single-stranded RNA molecule, a double-stranded DNA molecule or a double-stranded RNA molecule.

[0027] In some more preferred embodiments, the method of the present invention comprises the following steps:

[0028] (1) transforming a vector containing a nucleotide sequence encoding a gRNA targeting the VQ22 gene and a Cas protein into Agrobacterium;

[0029] (2) contacting the stem tip isolated from the cotton seed with the Agrobacterium from step (1);

[0030] (3) Cultivating the stem tip from step (2) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0031] Any Cas protein that can be used for gene editing can be used in the method described in the present invention, including but not limited to Cas9 protein, Cas12a protein, Cas12b protein, Cas13a protein and Cas14 protein.

[0032] In some embodiments, gene silencing of the VQ22 gene described in the present invention is achieved by one or more methods selected from the following group: RNA interference (RNAi), virus-induced gene silencing (VIGS), transcription factor deficiency and CRISPR-Cas9 system-mediated gene silencing.

[0033] In some specific embodiments, the method of the present invention comprises the following steps:

[0034] (1) contacting cotton seeds, tissues, cells, organs or plants with an agent for gene silencing;

[0035] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0036] In some preferred embodiments, the method of the present invention comprises the following steps:

[0037] (1) contacting cotton seeds, tissues, cells, organs or plants with a reagent comprising Agrobacterium that mediates VIGS;

[0038] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0039] In some preferred embodiments, the method of the present invention comprises the following steps:

[0040] (1) contacting cotton seeds, tissues, cells, organs or plants with a reagent containing a gRNA and a dCas protein targeting a VQ22 gene;

[0041] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0042] The term "dCas" protein refers to a mutant of the Cas protein, which loses its cleavage enzyme activity but retains the ability to target the target gene guided by gRNA. In some preferred embodiments, the dCas protein is a dCas9 protein.

[0043] In some preferred embodiments, the method of the present invention comprises the following steps:

[0044] (1) contacting cotton seeds, tissues, cells, organs or plants with a reagent comprising a vector containing a nucleotide sequence encoding a gRNA targeting a VQ22 gene and a dCas protein;

[0045] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0046] In some more preferred embodiments, the method of the present invention comprises the following steps:

[0047] (1) transforming a vector containing a nucleotide sequence encoding a gRNA targeting the VQ22 gene and a dCas protein into Agrobacterium;

[0048] (2) contacting the stem tip isolated from the cotton seed with the Agrobacterium from step (1);

[0049] (3) Cultivating the stem tip from step (2) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0050] In some embodiments, the gene mutation of the VQ22 gene described in the present invention is achieved by one or more methods selected from the following group: screening natural variation, physical mutagenesis, chemical mutagenesis, biological mutagenesis and gene editing technology.

[0051] In some embodiments, physical mutagenesis includes, but is not limited to, alpha ray mutagenesis, beta ray mutagenesis, gamma ray mutagenesis, X-ray mutagenesis, neutron and other particle mutagenesis, ultraviolet mutagenesis, and microwave radiation mutagenesis.

[0052] In some embodiments, chemical mutagenesis includes, but is not limited to, the use of alkylating agents (e.g., ethyl methanesulfonate (EMS), ethyleneimine (EI), nitrosoethylurethane (NEU), nitrosomethylurethane (NMU), diethyl sulfate (DES), nitrosoguanidine (NG)), nucleic acid base analogs (e.g., 5-bromouracil (BU), 5-bromodeoxyuridine (BudR)), and antibiotics (e.g., azaserine, mitotoxin C).

[0053] In some embodiments, biological mutagenesis includes, but is not limited to, viral or bacterial-mediated mutagenesis.

[0054] In some embodiments, the gene editing technology includes one or more selected from the following groups: zinc finger nuclease (ZFN) technology, transcription activating effector nuclease (TALEN) technology and CRISPR / Cas system-mediated gene editing technology.

[0055] In some embodiments, the agent that inhibits the expression and / or activity of the protein encoded by the VQ22 gene includes one or more selected from the following groups: siRNA, miRNA, dsRNA, shRNA, hpRNA, ihpRNA, antisense RNA, antisense DNA, ribozymes, antibodies or their antigen-binding fragments, small molecule compounds, protein ligands and CRISPR reagents.

[0056] "CRISPR reagents" refers to compositions containing various effective components that can achieve gene expression regulation or gene editing. Typically, CRISPR reagents contain gRNA or its encoding nucleotide sequence, Cas protein or its encoding nucleotide sequence and / or dCas protein or its encoding nucleotide sequence that targets the target gene. In some cases, CRISPR reagents also contain other functional components that promote homologous recombination or gene editing.

[0057] In some specific embodiments, the method of the present invention comprises the following steps:

[0058] (1) contacting cotton seeds, tissues, cells, organs or plants with an agent that inhibits the expression and / or activity of a protein encoded by a VQ22 gene;

[0059] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0060] In some preferred embodiments, the method of the present invention comprises the following steps:

[0061] (1) contacting cotton seeds, tissues, cells, organs or plants with a reagent containing a gRNA and a dCas protein targeting a VQ22 gene;

[0062] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0063] In some preferred embodiments, the method of the present invention comprises the following steps:

[0064] (1) contacting cotton seeds, tissues, cells, organs or plants with a reagent comprising a vector containing a nucleotide sequence encoding a gRNA targeting a VQ22 gene and a dCas protein;

[0065] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0066] In some more preferred embodiments, the method of the present invention comprises the following steps:

[0067] (1) transforming a vector containing a nucleotide sequence encoding a gRNA targeting the VQ22 gene and a dCas protein into Agrobacterium;

[0068] (2) contacting the stem tip isolated from the cotton seed with the Agrobacterium from step (1);

[0069] (3) Cultivating the stem tip from step (2) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0070] In some preferred embodiments, the method of the present invention comprises the following steps:

[0071] (1) contacting cotton seeds, tissues, cells, organs or plants with a reagent containing dsRNA targeting the VQ22 gene;

[0072] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0073] In some preferred embodiments, the method of the present invention comprises the following steps:

[0074] (1) contacting cotton seeds, tissues, cells, organs or plants with a reagent comprising a vector containing a nucleotide sequence encoding a dsRNA targeting a VQ22 gene;

[0075] (2) Cultivating the cotton seeds, tissues, cells, organs or plants from step (1) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0076] In some more preferred embodiments, the method of the present invention comprises the following steps:

[0077] (1) transforming a vector containing a nucleotide sequence encoding a dsRNA targeting the VQ22 gene into Agrobacterium;

[0078] (2) contacting the stem tip isolated from the cotton seed with the Agrobacterium from step (1);

[0079] (3) Cultivating the stem tip from step (2) to obtain cotton seeds, tissues, cells, organs or plants with improved disease and insect pest resistance.

[0080] The protein encoded by the cotton VQ22 gene is a negative regulator of the development of cotton pigment glands. In this article, "VQ22 gene" includes wild-type VQ22 genes from the cotton genome, and also includes mutant VQ22 genes (i.e., functional variants of wild-type VQ22 genes) obtained by screening natural variations, artificial mutagenesis or artificial modification, provided that the expression and / or activity of the protein encoded by the mutant VQ22 gene is no different or substantially no different from that of the wild-type VQ22 gene.

[0081] In some embodiments, the VQ22 gene of the present invention is derived from Gossypium hirsutum, Gossypium arboretum, Gossypium anomalum, Gossypium sturtianum, Gossypium raimondii, Gossypium stocksii, Gossypium longicalyx, Gossypium bickii, Gossypium rotundifolium or Gossypium barbadense. In some preferred embodiments, the VQ22 gene of the present invention is derived from Gossypium hirsutum, Gossypium arboretum, Gossypium anomalum, Gossypium sturtianum, Gossypium raimondii, Gossypium stocksii, Gossypium longicalyx, Gossypium bickii, Gossypium rotundifolium or Gossypium barbadense.

[0082] Upland cotton is one of the most widely cultivated cotton species in the world, with an allotetraploid AD genome. In some embodiments, the VQ22 gene of the present invention is a VQ22 gene located on the D subgenome of Upland cotton. In some embodiments, the VQ22 gene of the present invention is a VQ22 gene located on the A subgenome of Upland cotton. In some embodiments, the VQ22 gene of the present invention is a VQ22 gene located on the D subgenome of Upland cotton and a VQ22 gene located on the A subgenome of Upland cotton.

[0083] In some embodiments, the protein encoded by the VQ22 gene of the present invention comprises an amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:4, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO:2 or SEQ ID NO:4.

[0084] In some embodiments, the VQ22 gene of the present invention comprises a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 3, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO: 1 or SEQ ID NO: 3.

[0085] The term "sequence identity" refers to the sequence similarity between two polypeptides or between two nucleic acid sequences. The percent identity can be determined by comparing the positions in each sequence, which can be aligned for the purpose of comparison. When a position in the compared sequences is occupied by the same base or amino acid, the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. "Unrelated" or "non-homologous" sequences share less than 40% identity, less than 25% identity with one of the sequences of the present invention. By importing the nucleic acid or amino acid sequence into ClustalW (available from https: / / genome.jp / tools-bin / clustalw / ) and using ClustalW, the alignment and percent sequence identity of the nucleic acid or amino acid sequences provided herein can be determined.

[0086] When referring to specific molecules, biological materials or cellular substances, the terms "equivalent" or "functional variant" can be used interchangeably and refer to those with minimal homology to the reference while still maintaining the desired structure or function. Non-limiting examples of equivalent polypeptides include polypeptides having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a reference polypeptide (e.g., a protein encoded by a VQ22 gene described in the present invention); or polypeptides encoded by polynucleotides having at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a reference polynucleotide (e.g., a wild-type VQ22 gene described in the present invention).

[0087] Compared with the reference polypeptide of the present invention (e.g., the protein encoded by the VQ22 gene of the present invention), equivalents having one or more amino acid modifications are also included in the scope of the present invention, provided that the one or more amino acid modifications do not affect or substantially affect the function of the reference polypeptide. As used herein, amino acid modifications may be amino acid substitutions, amino acid deletions, or amino acid insertions. Amino acid substitutions may be conservative amino acid substitutions or non-conservative amino acid substitutions. Conservative substitutions (also known as conservative mutations, conservative substitutions, or conservative variations) are amino acid substitutions in proteins that change a given amino acid to a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity, or size). As used herein, "conservative substitutions" refer to amino acid residues being replaced by another biologically similar residue. Examples of conservative substitutions include substitutions of one hydrophobic residue such as isoleucine, valine, leucine, or methionine for another; or substitutions of one charged or polar residue for another, such as substitutions of arginine for lysine, substitutions of glutamic acid for aspartic acid, substitutions of glutamine for asparagine, and the like. Other illustrative examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine or glutamic acid; phenylalanine to tyrosine, serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and the like.

[0088] The method of the present invention regulates the development of cotton pigment glands by inhibiting the expression and / or activity of the protein encoded by the VQ22 gene in the cotton, thereby increasing the size of the cotton pigment glands and the content of secondary metabolites such as cottonphenol, thereby improving the disease and insect pest resistance of cotton.

[0089] In some embodiments, the pests are one or more selected from the group consisting of cotton bollworm, cotton aphid, red spider, cotton stink bug, cutworm, wireworm, scarab, mole cricket, cotton spider mite, tobacco thrips and pink bollworm. In some preferred embodiments, the pests are cotton bollworm and cotton aphid. In some more preferred embodiments, the pests are cotton bollworm.

[0090] The method described in the present invention can be used to improve the disease and insect pest resistance of various cottons, including but not limited to upland cotton, Asiatic cotton, abnormal cotton, Sterti cotton, Raymond cotton, Stoke's cotton, long-calyx cotton, Bick's cotton, round-leaf cotton or sea island cotton. In some preferred embodiments, the method described in the present invention is used to improve the disease and insect pest resistance of upland cotton. In some more preferred embodiments, the method described in the present invention is used to improve the ability of upland cotton to resist bollworm pests.

[0091] In a second aspect, the present invention provides cotton obtained by the method of the first aspect of the present invention, or cells, seeds, tissues or organs derived from the cotton.

[0092] In a third aspect, the present invention provides a cotton cell, seed, tissue, organ or plant, wherein the expression and / or activity of a protein encoded by a VQ22 gene in the cotton cell, seed, tissue, organ or plant is inhibited.

[0093] In some embodiments, the inhibition is achieved by one or more means selected from the group consisting of gene knockout, gene silencing, gene mutation, and introduction of an agent that inhibits the expression and / or activity of a protein encoded by the VQ22 gene.

[0094] In some embodiments, the gene knockout is achieved by gene editing technology. In some preferred embodiments, the gene editing technology includes one or more selected from the group consisting of zinc finger nuclease (ZFN) technology, transcriptional activation effector nuclease (TALEN) technology, and CRISPR / Cas system-mediated gene editing technology.

[0095] In some embodiments, the gene silencing is achieved by one or more methods selected from the group consisting of RNA interference (RNAi), virus-induced gene silencing (VIGS), transcription factor deletion, and CRISPR-Cas9 system-mediated gene silencing.

[0096] In some embodiments, the gene mutation is achieved by one or more methods selected from the group consisting of: screening natural variation, physical mutagenesis, chemical mutagenesis, biological mutagenesis, and gene editing technology. Wherein, the physical mutagenesis, chemical mutagenesis, biological mutagenesis, and gene editing technology can be achieved by the methods, reagents, or techniques listed in the first aspect of the present invention.

[0097] In some embodiments, the agent that inhibits the expression and / or activity of the protein encoded by the VQ22 gene includes one or more selected from the following groups: siRNA, miRNA, dsRNA, shRNA, hpRNA, ihpRNA, antisense RNA, antisense DNA, ribozymes, antibodies or their antigen-binding fragments, small molecule compounds, protein ligands and CRISPR reagents.

[0098] In some embodiments, the protein encoded by the VQ22 gene comprises an amino acid sequence as shown in SEQ ID NO: 2 or SEQ ID NO: 4, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO: 2 or SEQ ID NO: 4.

[0099] In some embodiments, the VQ22 gene comprises a nucleotide sequence as shown in SEQ ID NO:1 or SEQ ID NO:3, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO:1 or SEQ ID NO:3.

[0100] In the cotton cells, seeds, tissues, organs or plants provided by the present invention, the expression and / or activity of the protein encoded by the VQ22 gene is inhibited, so that the pigment glands are enlarged and the content of secondary metabolites such as cottonphenol is increased, thereby improving the disease and insect pest resistance of the cotton cells, seeds, tissues, organs or plants.

[0101] In some embodiments, the pests are one or more selected from the group consisting of cotton bollworm, cotton aphid, red spider, cotton stink bug, cutworm, wireworm, scarab, mole cricket, cotton spider mite, tobacco thrips and pink bollworm. In some preferred embodiments, the pests are cotton bollworm and cotton aphid. In some more preferred embodiments, the pests are cotton bollworm.

[0102] In some embodiments, the cotton cell, seed, tissue, organ or plant provided by the present invention is derived from upland cotton, Asiatic cotton, abnormal cotton, Sterti cotton, Raymond cotton, Stoke's cotton, long-calyx cotton, Bick's cotton, round-leaf cotton or sea island cotton. In some preferred embodiments, the cotton cell, seed, tissue, organ or plant provided by the present invention is derived from upland cotton.

[0103] In a fourth aspect, the present invention provides a composition comprising an agent that inhibits the expression and / or activity of a protein encoded by the VQ22 gene.

[0104] In some embodiments, the agent that inhibits the expression and / or activity of the protein encoded by the VQ22 gene comprises one or more selected from the following groups: siRNA, miRNA, dsRNA, shRNA, hpRNA, ihpRNA, antisense RNA, antisense DNA, ribozymes, antibodies or their antigen-binding fragments, small molecule compounds, protein ligands and CRISPR reagents.

[0105] In some embodiments, the composition further comprises an agriculturally acceptable carrier.

[0106] The term "agriculturally acceptable carrier" refers to a solvent, suspending agent and / or excipient suitable for delivering the agent for inhibiting the expression and / or activity of the protein encoded by the VQ22 gene of the present invention to the plant. The carrier can be a liquid, solid or semi-solid. In some embodiments, the agriculturally acceptable carrier suitable for the present invention can be selected from one or more of the following groups: water, buffer, DMSO, surfactants such as Tween-20. Any agriculturally acceptable carrier known to those skilled in the art can be used in the composition of the present invention.

[0107] In some embodiments, the composition can be formulated as solutions, emulsions, suspensions, powders, foams, pastes, granules, aerosols, natural and synthetic materials impregnated with active substances, microcapsules in polymers, coatings for seeds.

[0108] In some embodiments, the composition provided by the present invention can be directly applied to cotton cells, seeds, tissues, organs or plants. By culturing the cotton cells, seeds, tissues, organs or plants to which the composition is applied by methods well known to those skilled in the art, cotton cells, seeds, tissues, organs or plants with improved resistance to pests and diseases can be obtained. In addition, the cotton plants with improved resistance to pests and diseases can be further separated or cultured to obtain cotton cells, seeds, tissues, organs or plants with improved resistance to pests and diseases.

[0109] In some embodiments, the composition provided by the present invention can be combined with other substances that are beneficial to plant growth and reproduction (such as plant growth regulators) and applied to cotton cells, seeds, tissues, organs or plants.

[0110] In some embodiments, the composition provided by the present invention is used to improve the disease and insect pest resistance of cotton.

[0111] After the composition provided by the present invention is applied to cotton cells, seeds, tissues, organs or plants, the pigment glands of the cotton cells, seeds, tissues, organs or plants can be enlarged and the content of secondary metabolites such as cottonpol can be increased, thereby improving the disease and insect pest resistance of the cotton cells, seeds, tissues, organs or plants.

[0112] The present invention finds that the cotton VQ22 gene is a gland-specific expression gene. By fusing the promoter of the VQ22 gene with the GUS gene and transferring the fusion expression vector into cotton, it is found that the promoter of the VQ22 gene can drive the gland-specific expression of the GUS gene, indicating that the promoter of the VQ22 gene can be used to mediate the specific expression of other molecules (such as RNA or protein) in the pigment glands of cotton.

[0113] Accordingly, in a fifth aspect, the present invention provides a DNA molecule comprising the nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6, or comprising a nucleotide sequence having 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO:5 or SEQ ID NO:6.

[0114] In some embodiments, the DNA molecules are used to express a gene of interest in the pigment glands of cotton.

[0115] In the sixth aspect, the present invention provides a method for specifically expressing RNA or protein in the pigment glands of cotton, the method comprising introducing a nucleic acid construct comprising a promoter of a VQ22 gene and a nucleotide sequence encoding a target RNA or a target protein into cotton, wherein the nucleotide sequence encoding the target RNA or the target protein is operably linked to the promoter of the VQ22 gene, so that the promoter of the VQ22 gene can mediate the expression of the target RNA or the target protein.

[0116] The present invention also provides a method for specifically expressing RNA or protein in the pigment glands of cotton, the method comprising placing a nucleotide sequence encoding the target RNA or target protein downstream of the promoter of the endogenous VQ22 gene of cotton, so that the promoter of the endogenous VQ22 gene can mediate the expression of the target RNA or target protein.

[0117] In some embodiments, the promoter of the VQ22 gene comprises a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:5 or SEQ ID NO:6. BRIEF DESCRIPTION OF THE DRAWINGS

[0118] Figure 1 The expression of VQ22 gene in non-glandular and glandular tissues of cotton is shown. VQ22_At: VQ22 gene on the A subgenome of upland cotton; VQ22_Dt: VQ22 gene on the D subgenome of upland cotton.

[0119] Figure 2 The diagram shows the construction of the VQ22pro-GUS expression vector and the GUS staining results of the transgenic plants. The transgenic recipient material (i.e., wild-type plants) has no GUS activity; the glandular tissue of the plants transformed with VQ22pro-GUS has GUS activity.

[0120] Figure 3It shows that the pigment glands of cotton tissues increased significantly after transient silencing of VQ22. TRV:CLA is the positive control of albino plants, TRV:00 is the negative control, and TRV:VQ22 is the plant treated with VIGS silencing of VQ22 gene.

[0121] Figure 4 The genotype identification of the VQ22 gene CRISPR knockout strain is shown. The underlined letters represent the PAM site, the bold letters represent the sgRNA, the letters in the box represent the genome editing insertion base, and the genomic bases are upstream of the underlined letters and downstream of the bold letters.

[0122] Figure 5 It showed that the pigment glands of various tissues of cotton were significantly enlarged after VQ22 gene knockout.

[0123] Figure 6 The pseudo-chronological development process of the glands of wild-type plants and vq22-L2 gene knockout plants is shown. Stage 1: gland undeveloped stage, stage 2: gland initiation stage, stage 3: gland proliferation stage, stage 4-stage 9: gland lysis and secondary metabolite accumulation stage.

[0124] Figure 7 The diameter statistics of the glands of wild-type plants and vq22-L2 knockout plants at different developmental stages are shown. *** indicates that the difference reached an extremely significant level (P<0.001).

[0125] Figure 8 Shown are the results of semi-thin section observation of mature glands of wild-type plants and vq22-L2 gene knockout plants.

[0126] Fig. 9 Shown is a color comparison of crude extracts of metabolites from wild-type and vq22-L2 knockout plants.

[0127] Fig.10 The results of LC-MS detection of metabolites of wild-type plants and vq22-L2 knockout plants are compared. The solid arrows represent that the peak area of ​​vq22-L2 metabolites is reduced compared with the wild type, and the dotted arrows represent that the peak area of ​​vq22-L2 metabolites is increased compared with the wild type.

[0128] Fig.11 Shown is the differential metabolite analysis of vq22-L2 knockout plants compared to wild-type plants. DETAILED DESCRIPTION

[0129] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific examples and accompanying drawings, and the advantages and features of the present invention will become clearer as the description progresses. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are carried out according to conventional conditions in the art, for example, the conditions described in Sambrook and Russeii et al., Molecular Cloning: A Laboratory Manual (3rd Edition) (2001), CSHL Press, or according to the conditions recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following examples are all commercially available.

[0130] Example

[0131] Example 1. GhVQ22 gene is a glandular tissue-specific expression gene

[0132] Glandular and non-glandular tissues were isolated from 18-day-old immature embryos of upland cotton TM-1 strain, and library construction, sequencing and transcriptome analysis were performed by Beijing Berry Genomics Co., Ltd. First, the obtained transcriptome sequences were aligned to the cotton genome, and the transcriptional expression levels of each gene were calculated. By comparing the gene expression levels of glandular and non-glandular tissues, the glandular-specific expression gene GhVQ22 ( Figure 1 ). Among them, the coding sequence of the GhVQ22 gene located on the D subgenome of upland cotton is shown as SEQ ID NO:1, and the amino acid sequence encoded by it is shown as SEQ ID NO:2; the coding sequence of the GhVQ22 gene located on the A subgenome of upland cotton is shown as SEQ ID NO:3, and the amino acid sequence encoded by it is shown as SEQ ID NO:4. The promoters of the GhVQ22 gene (the promoter of the GhVQ22 gene located on the D subgenome of upland cotton is shown as SEQ ID NO:5, and the promoter of the GhVQ22 gene located on the A subgenome of upland cotton is shown as SEQ ID NO:6) were fused with the GUS coding sequence (SEQ ID NO:7), respectively, and introduced into cotton by Agrobacterium-mediated cotton stem apex genetic transformation method to obtain GhVQ22_Dt-GUS and GhVQ22_At-GUS transgenic plants. The GUS staining results of the transgenic plants proved that the GhVQ22 gene is a cotton glandular tissue-specific expression gene ( Figure 2 ).

[0133] Example 2. Downregulation or knockout of GhVQ22 gene expression significantly enlarges pigment glands

[0134] Using VIGS gene silencing technology to reduce the expression of GhVQ22, the pigment glands in the leaves, stems, buds, bracts and other tissues of the plants were significantly enlarged ( Figure 3 ).

[0135] Using the CRISPR-P 2.0 (CRISPR-P v2.0 (hzau.edu.cn)) website, target prediction was performed for GhVQ22 (D genome copy: GH_D12G0482, A genome copy: GH_A12G0470), and an excellent target sequence that can target both genes at the same time was selected (GATCATCTCTTCCTGAGCTA AGG (SEQ ID NO: 12), underlined PAM site) for vector construction. The sgRNA sequence (5'-GATCATCTCTTCCTGAGCTA-3' (SEQ ID NO: 13)) was connected to the pU6-7-Cas9 vector (the OsU3 promoter of the pRGEB32-BAR (Plasmid #126072) vector was replaced with the cotton U6-7 promoter), and Agrobacterium was transformed. The stem tips of cotton seeds that had just germinated were used as explants for genetic transformation. After obtaining positive plants with sgRNA, the transgenic seedlings were screened and identified by Hi-TOM technology for mutant lines with complete editing of GhVQ22.

[0136] After using CRISPR-Cas9 genome editing technology to mutate the GhVQ22 gene, two homozygous strains, vq22-L2 and vq22-L5, were screened. Hi-Tom identified the mutation type as a single base insertion leading to premature translation termination ( Figure 4 ).

[0137] Compared with the wild-type strain, the pigment glands in leaves, stems, buds, bracts and other tissues of the GhVQ22 knockout strain were significantly enlarged ( Figure 5 ). Based on the timing of gland development, the knockout strains and wild-type glands were pseudo-sequentially ordered ( Figure 6 ) and found that after knocking out GhVQ22, the diameter of the gland at all stages of gland development increased significantly ( Figure 7 ), the final mature leaf gland diameter is about 2.74 times that of the wild type gland, and the number of mature gland sheath cell layers of the knockout strain is 3-5 layers more than that of the wild type ( Figure 8 ).

[0138] These results indicate that the pigment glands of cotton can be significantly enlarged by reducing or completely eliminating the expression of the GhVQ22 gene.

[0139] Example 3. Significant changes in secondary metabolites in GhVQ22 knockout mutant cotton

[0140] Metabolites of wild-type plants and GhVQ22 knockout mutant plants were initially extracted using 70% methanol. Under the same conditions, the total extracted metabolites of GhVQ22 knockout plants were brown-yellow in color, while those of the wild-type plants were lighter yellow ( Fig. 9 ).

[0141] Liquid chromatography-mass spectrometry (LC-MS) was used to detect the extracted metabolites, and it was found that the total ion current of the metabolites of the GhVQ22 knockout plants was significantly different from that of the wild type, and the area and number of the total particle peak changed significantly ( Fig.10 ). Metabolite differential analysis showed that compared with wild-type plants, GhVQ22 knockout plants had 701 upregulated metabolites and 583 downregulated metabolites ( Fig.11 ).

[0142] These results indicate that the composition of secondary metabolites synthesized by pigment glands changed significantly after GhVQ22 gene knockout.

[0143] Example 4. GhVQ22 knockout mutants show significantly improved resistance to cotton bollworm

[0144] The extent of the toxic effect of cotton varieties on cotton bollworm larvae is an important indicator of its resistance to cotton bollworm. Through the cotton bollworm resistance identification experiment, it was found that the lethality of GhVQ22 knockout mutant leaves to cotton bollworm was significantly higher than that of the control material (Table 1). Five days after the young leaves of the seedling stage were inoculated with cotton bollworm, the corrected mortality of the larvae of the GhVQ22 mutant plants reached 49.07% and 51.2%, respectively, and the live insect index reduction rate reached 67.01% and 70.41%, respectively, and the damage level of the leaves was significantly lower than that of the wild type. The results of the cotton bollworm resistance identification at the bud and boll stage were similar to those at the seedling stage.

[0145] Table 1. Results of the resistance test of VQ22 mutant to cotton bollworm

[0146]

[0147]

[0148] These results indicate that the bollworm resistance of cotton leaves was significantly increased after the pigment glands were enlarged by GhVQ22 knockout, proving that cotton lines with downregulated GhVQ22 gene expression or gene knockout can more effectively resist diseases and pests.

[0149] Experimental methods

[0150] 1. Agrobacterium-mediated genetic transformation of cotton stem apex

[0151] 1) Vector construction and Agrobacterium preparation

[0152] First, the plant expression vector pU6-7-Cas9 vector (the OsU3 promoter of the pRGEB32-BAR (Plasmid #126072) vector was replaced with the cotton U6-7 promoter) was linearized, and the target gene was cloned into the vector using seamless cloning technology. Then, the correctly sequenced target plasmid was transformed into the EHA105 Agrobacterium competent medium (Shanghai Weidi Biological Co., Ltd., CAT #: AC1010). The glycerol bacteria were stored in a -80°C refrigerator and taken out when used. 3 days before infection, the glycerol bacteria were dipped with a disposable inoculation loop and evenly spread on the YP medium containing the corresponding antibiotics. The edge of the bacterial plate was sealed with a sealing film, and it was inverted and cultured in a 28°C incubator for 2 days to obtain activated Agrobacterium. The activated Agrobacterium was expanded and cultured at 28°C, and the A660 was measured by a spectrophotometer to be about 0.9, and it was set aside.

[0153] 2) Seed germination

[0154] One day before infection, take 300 cotton seeds delinted by sulfuric acid and place them in a sterile conical flask, add 75% alcohol, shake for 30 seconds, and discard the waste liquid; then add 6% H2O2 and shake on a shaker for 15 minutes; discard the waste liquid, rinse with sterile water 4 times, and soak and culture in a dark room at 28℃ overnight for 18-24 hours.

[0155] 3) Infection and co-cultivation

[0156] After the seed culture is completed, the seed coat is cut with a scalpel, and the cotyledons are peeled off under a dissecting microscope to expose the embryo tip, and the embryo tip and hypocotyl are retained as explants. The explants are placed in the prepared Agrobacterium suspension and ultrasonically treated at 40KHz for 40 seconds, and then subcultured in a shaker at 80r / min for 50 minutes. After infection, they are placed in a co-culture medium covered with double-layer sterile filter paper and co-cultured in a 23℃ constant temperature incubator in the dark for 3-4 days.

[0157] 4) Resume culture

[0158] After co-cultivation, the explants were transplanted to recovery medium and the radicles were inserted into the medium. 50 explants were transferred to a culture dish and incubated at 35 °C with a 16 h photoperiod at 50 μmol m -2 s -1 The cells were cultured at 25 °C and 16 h photoperiod for 3 days under a light intensity of 50 μmol m -2 s -1 Incubate at 4 °C light intensity for 4 days.

[0159] 5) Bud induction and screening culture

[0160] After 7 days of culture on recovery medium, the elongated roots of cotton explants were cut off and then transferred to shoot induction medium at 25°C and 16 h photoperiod with 50 μmol m -2 s-1 Cultivate under varying light intensity and subcultivate every 2 weeks for 3-4 times in total until resistant buds emerge.

[0161] 6) Elongation culture

[0162] After the resistant buds are fully developed, the explants are transferred to the elongation medium and treated in the same way as the screening. They are cultured at 28°C and under a photoperiod of 16 / 8h, light / dark. Subculture is performed every 2 weeks until the resistant buds grow to 5-6cm on the elongation medium.

[0163] 7) Rooting culture

[0164] The elongated shoots were cut off and transferred to the rooting medium, and when the number of roots of the plants was >2 and the root length was more than 2 cm, they were transplanted to the seedling hardening room for testing and hardening. The rooted T0 plants were grown in a greenhouse at 25°C with a photoperiod of 14 / 10 h.

[0165] The formula of the culture medium involved is as follows:

[0166] CA salt: magnesium sulfate 10g / L, ammonium sulfate 5.36g / L, sodium phosphite hydrate 6g / L, calcium chloride 6g / L, boric acid 30mg / L, manganese sulfate 100mg / L, zinc sulfate heptahydrate 20mg / L, potassium iodide 7.5mg / L, sodium molybdate dihydrate 2.5mg / L, copper sulfate 250μg / L, cobalt (II) chloride hexahydrate 250μg / L, potassium nitrate 100g / L.

[0167] Agrobacterium suspension: CA salt 10 mL / L, glucose 30 g / L, MES 4.2 g / L, B5 vitamin 0.1 mL / L, 6-BA 1 mg / L, NAA 0.1 mg / L, 100 mM acetosyringone 2 mL / L, pH = 5.4.

[0168] Co-culture medium: CA salts 10 mL / L, glucose 30 g / L, MES 4.2 g / L, B5 vitamins 0.1 mL / L, 1 mg / L 6-BA, 0.1 mg / L NAA, 100 mM acetosyringone 2 mL / L, cysteine ​​200 mg / L, pH = 5.4.

[0169] Recovery medium: mixture of MS salts and B5 vitamins 4.4 g / L, glucose 20 g / L, calcium gluconate 1.29 g / L, 1 mg / L 6-BA, 0.1 mg / L NAA, carbenicillin 100 mg / L, cephalosporin 100 mg / L, agar 4 g / L, pH=5.6.

[0170] Resistance medium: mixture of MS salts and B5 vitamins 4.4 g / L, glucose 20 g / L, calcium gluconate 1.29 g / L, 1 mg / L 6-BA, 0.1 mg / L NAA, carbenicillin 100 mg / L, cephalosporin 100 mg / L, spectinomycin 100 mg / L, agar 4 g / L, pH = 5.6.

[0171] Elongation medium: mixture of MS salts and B5 vitamins 4.4 g / L, glucose 20 g / L, calcium gluconate 1.29 g / L, carbenicillin 100 mg / L, cephalosporin 100 mg / L, spectinomycin 100 mg / L, agar 4 g / L, pH = 5.6.

[0172] Rooting medium: mixture of MS salts and B5 vitamins 4.4 g / L, glucose 20 g / L, calcium gluconate 1.29 g / L, carbenicillin 100 mg / L, cephalosporin 100 mg / L, agar 4 g / L, pH = 5.6.

[0173] 2.VIGS treatment

[0174] 1) Sow upland cotton seeds in nutrient pots.

[0175] 2) Place in a 25°C light incubator with humidity at 70% and incubate in the dark for 2 days. After the cotyledons emerge, change the culture conditions to 16 hours of light and 8 hours of darkness.

[0176] 3) When the cotyledons are flattened, VIGS solution can be injected.

[0177] 4) Two nights before inoculation, Agrobacterium strains pTRV1, pTRV2-empty vector, pTRV2-CLA (albinosis positive control, which can mediate CLA gene silencing and make the plant albinose, thus proving the success of VIGS treatment), and pTRV2-GhVQ22 stored at -80°C were activated and incubated at 28°C, 180-220 rpm overnight.

[0178] 5) One night before inoculation, inoculate the activated strain into LB culture medium (100 mL LB + 100 μL Kan + 100 μL Rif). Culture at 28°C, 200 rpm for about 16 hours.

[0179] 6) Wait until the OD of Agrobacterium solution reaches 600 = 1.0-1.2, collect the bacterial solution in a centrifuge tube. Pour away the supernatant and adjust the concentration OD with the resuspension solution. 600 =0.6-0.8. (Resuspension solution: 1 mM MgCl2, 10 mM MES, 200 μM AS) pTRV1 was mixed with pTRV2-empty vector, pTRV2-CLA, and pTRV2-GhVQ22 bacterial suspension in equal volumes.

[0180] 7) Place the resuspended bacterial solution at room temperature for 3 hours.

[0181] 8) Use a needle to poke 1-2 small holes between the veins on the back of the cotton seedling cotyledons to be injected, and use a 1mL syringe to inject the mixed bacterial solution into the cotton cotyledons. After injection, the cotton cotyledons are soaked in water, and try to ensure that both cotyledons are fully injected with Agrobacterium.

[0182] 9) After the injection, cover the cotton plants with black plastic film and culture them in the dark for 12 hours.

[0183] 10) The next morning, the black plastic film was removed and the cells were placed in a light incubator at 25°C with humidity maintained at 70%, 16 hours of light and 8 hours of darkness.

[0184] 11) Generally, two weeks after injection, the cotton plant phenotypes are observed and relevant experimental treatments are carried out.

[0185] The formula of MES / AS / MgCl2 mother liquor is as follows:

[0186] 1) MgCl2 (1M)

[0187] Dissolve 20.3 g MgCl2·6H2O in sufficient water, make up to 100 mL, sterilize by high pressure, and store at 4°C.

[0188] 2) MES (2-(N-morpholino)ethanesulfonic acid) (1.0 M pH 5.6)

[0189] Weigh 4.88 g of MES and dissolve it in 20 mL of sterile distilled water, filter and sterilize it, and store it at -20°C.

[0190] 3) AS (Acetosyringone) (100 mM)

[0191] Weigh 0.1962 g AS and dissolve it in 10 mL dimethyl sulfoxide (DMSO), filter sterilize, and store at -20°C.

[0192] 3. LC-MS Sample Preparation

[0193] 1) Add 1.0 mL of 70% methanol extract (used to extract water-soluble metabolites, containing 0.1 mg / L lidocaine (Lidocaine internal standard) or 0.1 mg / L acyclovir (Acyclovir internal standard)) to every 0.1000 g of sample powder. The above operation is carried out in a fume hood.

[0194] 2) Add 1.0 mL of pure methanol extract (used to extract fat-soluble metabolites, containing 0.1 mg / L lidocaine (Lidocaine internal standard) or 0.1 mg / L acyclovir (Acyclovir internal standard)) to every 0.1000 g of sample powder. The above operation is carried out in a fume hood.

[0195] 3) After adding methanol, vortex mix immediately and store in a 4°C refrigerator. Take out the sample every 10 minutes and vortex again. Repeat three times to improve the extraction rate.

[0196] 4) Place in a 4°C refrigerator overnight (8 hours or more is sufficient, and at least 8 hours is required to ensure sufficient reaction between the sample and the extract).

[0197] 5) Vortex the sample and balance the centrifuge tube, then place it in a centrifuge. Centrifuge at 4°C, 14,000 rpm for 5 minutes.

[0198] 6) Carefully take out the centrifuge tube and handle it with care. Aspirate 600 μL of the supernatant, mix the water-soluble and fat-soluble metabolites in a 1:1 ratio, and place in a new 1.5 mL centrifuge tube.

[0199] 7) Centrifuge at 14000 rpm at 4°C for 5 min.

[0200] 8) Filter the supernatant into a new 1.5 mL centrifuge tube.

[0201] 9) Pipette 150 μL of supernatant into the sample bottle with the inner tube and the sample number written on it.

[0202] 10) Cover the sample bottles with caps and place them neatly in the plastic cryobox in the order of samples for later use.

[0203] 4. Semi-thin Section Preparation

[0204] 1) Sampling and fixation: Add 1 mL of 5% glutaraldehyde and 4% paraformaldehyde fixative to a 2.0 mL round-bottom centrifuge tube. Use a sharp blade to quickly cut 1-2 mm long experimental materials (seeds can be placed directly), immediately put them into the fixative, vacuum on ice for 30 minutes, and then fix them overnight at room temperature.

[0205] 2) Rinse: Aspirate and discard the fixative solution, add 1 mL of 0.1 M phosphate buffer, and rinse twice, 15 min each time.

[0206] 3) Dehydration: Aspirate and discard the rinse solution, and dehydrate with 30%, 50%, 70%, 90%, and 100% (2 times) gradient ethanol, with each dehydration step lasting 30 minutes.

[0207] 4) Soak

[0208] 100% ethanol:LR White embedding medium = 1:1 1h

[0209] Pure embedding medium 1 time 5 hours

[0210] Pure embedding medium 1 time overnight

[0211] 5) Embedding

[0212] First, drip some embedding agent into the capsule, move the sample in, use the dissecting needle to move the sample to the appropriate position, then fill it with embedding agent, cover the capsule, and place it in a 60℃ thermostat for polymerization for 12 hours.

[0213] 6) Sectioning and staining

[0214] Trimming: Place the embedding block on the sample holder, leaving 3-5mm of the top exposed. Use a blade to cut off the embedding medium at the top under a binocular stereoscope to expose the sample. Then trim the four sides to make it a cone, and trim the top to a smooth and flat section.

[0215] Sectioning: Place the repaired embedding block together with the sample clamp on the ultra-thin slicer and tighten it. Fix the glass knife on the knife holder. Under the binoculars, use the knife feed button to bring the knife close to the section of the embedding block. Adjust the angle so that the section is parallel to the blade. Adjust the slice thickness on the controller to 500-1000nm, press the M key to start slicing, and move the sample arm up and down to cut the section flat. Move the glass knife so that the best part of the blade is parallel to the section. Press the M key to start slicing. Observe the slicing under the binoculars. After cutting the section, turn off the controller. Pick up the section with pointed tweezers. Prepare a clean slide in advance, drop a drop of distilled water on it, and let the section float on the water drop.

[0216] Place the slide on a 70℃ baking table to dry, and the slices will adhere to the slide.

[0217] Staining: On a 70°C oven, add a drop of 0.05% crystal violet staining solution to the slice and stain for 10-30 seconds. Rinse the staining solution off the slice with distilled water and bake the slice dry.

[0218] Observation: Add a drop of distilled water on the slice, cover with a coverslip, and observe and photograph under a microscope.

[0219] 5. GUS staining

[0220] 1) Cut the material quickly with a sharp blade and place it in pre-cooled 90% acetone for fixation for 20 minutes.

[0221] 2) Discard the acetone and add 1 mL of GUS washing solution to wash away the residual acetone, and wash twice.

[0222] 3) Add 1 mL of GUS staining solution (Solebio GUS staining kit - ready-to-use, catalog number: G3061) and place on ice in a vacuum condition for 15-20 min away from light.

[0223] 4) Incubate the cells at 37°C in the dark for several hours or overnight.

[0224] 5) Aspirate the staining solution and add 1 mL of 70% ethanol to stop the staining reaction and decolorization.

[0225] 6) Replace with 75% ethanol, 90% ethanol, and 100% ethanol until decolorization is complete.

[0226] 7) Use a dissecting microscope and a microscope to take photos and observe.

[0227] 6. Hi-TOM genotyping

[0228] 1) PCR primer design: Primers were designed according to conventional PCR primer design principles: the target site should be within 10-100 bp from the left primer or the right primer. A forward bridging sequence 5-ggagtgagtacggtgtgc-3' (SEQ ID NO: 8) was added to the 5' end of the forward primer; a reverse bridging sequence 5-gagttggatgctggatgg-3' (SEQ ID NO: 9) was added to the 5' end of the reverse primer, thereby obtaining VQ22 forward primer (ggagtgagtacggtgtgcGGGATTCTCTGATGTTGATGCCACTA (SEQ ID NO: 10)) and VQ22 reverse primer (gagttggatgctggatggGGGCCTCTTCTGTTGTTGGTTGAAA (SEQ ID NO: 11)).

[0229] 2) First round of PCR amplification of target fragment: Use primers to perform conventional PCR amplification of target band (without dye). After PCR, take 3-5 μL of product for electrophoresis detection to ensure that the target band is amplified.

[0230] 3) A second round of PCR was performed using the Hi-TOM method (Liu Q, Wang C, Jiao X, Zhang H, Song L, Li Y, Gao C, Wang K. Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR / Cas systems. Sci China Life Sci. 2019 Jan; 62(1): 1-7. doi: 10.1007 / s11427-018-9402-9. Epub 2018 Nov 13. PMID: 30446870.) to complete library construction.

[0231] PCR reaction system per well:

[0232]

[0233] PCR procedure:

[0234] 94°C, 2 min;

[0235] 94℃, 30s;

[0236] 57°C, 30 s, 33 cycles;

[0237] 72°C, determined by the length of the amplified fragment (1 kb / min);

[0238] 72℃,5min

[0239] After PCR, 3-5 μL of the product was taken for electrophoresis detection. The second round of PCR product was about 100 bp longer than the first round product.

[0240] Mix the second round PCR products, take 200μL of the mixed PCR products for agarose gel electrophoresis, cut the gel for recovery, and purify. Send to Novogene for high-throughput sequencing. The sample library concentration must be greater than 0.8ng / μL, the total amount must be greater than 30ng, and the sample volume must not be less than 10μL. Samples of different target sites can be mixed together for sampling. For common variant detection, 960 PCR reactions are required, and only 1G of sequencing data is needed to obtain reliable results.

[0241] 4) Online analysis of sequencing results

[0242] Upload the compressed sequencing data to the website (http: / / www.hi-tom.net / hi-tom / ) for analysis.

[0243] 7. Identification of resistance to cotton bollworm

[0244] 1) The cotton bollworms for the experiment were collected from the cotton field and placed in a constant temperature insect breeding room and raised with TM-1 to become standard adults. Larvae of the same age were used for the indoor inoculation and identification experiment.

[0245] 2) The cotton leaf inoculation method was used indoors. Seedling stage identification was conducted when the cotton material grew to the 3-leaf stage, and bud stage identification was conducted when the cotton material grew to the bud stage. Ten young leaves were taken from each test material in each block group (one leaf was taken from each plant), and 2 leaves were inoculated for each treatment. Six young larvae of the same age were inoculated. The number of dead insects, the number of live insects, and the degree of leaf damage were recorded and observed 3 and 5 days after inoculation. The degree of leaf damage was statistically calculated according to the classification standards established by Bai Lixin et al. (Bai Lixin, Shu Chun'e, Zhang Longwa et al., Identification methods and comprehensive quantitative evaluation of new cotton varieties (lines) resistant to cotton bollworm, China Cotton, 2004, 31(1): 19-21).

[0246] 3) Data analysis. Using the genome-edited recipient material as the control, the mortality rate of cotton bollworm larvae of the test material was calculated based on the data obtained from the indoor insect resistance identification, and the toxicity of cotton leaves of each test material to cotton bollworm was objectively evaluated. At the same time, the T-test was used to test the significance of the difference with the control material. The relevant calculation formula is as follows:

[0247] Larvae mortality (%) = number of dead larvae * 100% / total number of larvae inoculated;

[0248] Corrected larval mortality (%) = (mortality of experimental group - mortality of control group) * 100% / (1 - mortality of control group);

[0249] Live insect index reduction rate (%) = (control live insect index - treatment live insect index) * 100% / control live insect index

[0250] Average leaf damage level = (number of level 1 damaged leaves * 1 + number of level 2 damaged leaves * 2 + number of level 3 damaged leaves * 3 + number of level 4 damaged leaves * 4) * 100% / total number of leaves

[0251] Equivalent solution

[0252] Although several embodiments have been described and shown herein, a person of ordinary skill in the art will readily imagine a variety of other variations and / or modifications for performing functions and / or obtaining results and / or achieving the advantages described herein, and each of such variations and / or modifications is considered to be within the scope of the inventive embodiments described herein. More generally, a person of ordinary skill in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary only, and that actual parameters, dimensions, materials, and / or configurations will depend on one or more specific applications for which the present invention is used. A person of ordinary skill in the art will recognize or be able to confirm many equivalents of the specific inventive embodiments described herein using only routine experiments. Therefore, it should be understood that the foregoing embodiments are presented only by way of example, and within the scope of the appended claims and their equivalents, the inventive embodiments may be practiced in a manner different from that specifically described and required. The embodiments of the present invention relate to each individual feature, system, article, material, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and / or methods is also included within the scope of the present invention if such features, systems, articles, materials, and / or methods are not mutually contradictory.

[0253] Unless clearly indicated to the contrary, as used herein, "a", "an", and "an" should be understood to mean "at least one".

[0254] As used herein, the term "about" means within an acceptable error range for a particular value determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, according to the practice in the art, "about" may mean within an acceptable standard deviation. Alternatively, "about" may mean a range of up to ±20%, preferably up to ±10%, more preferably up to ±5%, and most preferably up to ±1% of a given value. Where specific values ​​are described in the specification and claims of the present application, unless otherwise stated, the term "about" is implicit and means within an acceptable error range for a particular value in this context.

[0255] It should also be understood that, in any method claimed herein that includes more than one step or action, the order of the steps or actions of the method is not necessarily limited to the order in which the steps or actions are listed in the method illustrated herein unless otherwise indicated to the contrary.

[0256] Sequence Listing

[0257]

[0258]

[0259]

[0260]

Claims

1. A method for improving the disease and insect pest resistance of cotton, the method comprising inhibiting the expression and / or activity of a protein encoded by a VQ22 gene in the cotton.

2. The method of claim 1, wherein the inhibition of the expression and / or activity of the protein encoded by the VQ22 gene in the cotton is achieved by one or more methods selected from the group consisting of gene knockout, gene silencing, gene mutation, and introduction of an agent that inhibits the expression and / or activity of the protein encoded by the VQ22 gene.

3. The method of claim 2, wherein the gene knockout is achieved by gene editing technology; preferably, the gene editing technology includes one or more selected from the following groups: zinc finger nuclease (ZFN) technology, transcription activating effector nuclease (TALEN) technology and CRISPR / Cas system-mediated gene editing technology.

4. The method of claim 2, wherein the gene silencing is achieved by one or more methods selected from the group consisting of RNA interference (RNAi), virus-induced gene silencing (VIGS), transcription factor deletion, and CRISPR-Cas9 system-mediated gene silencing.

5. The method of claim 2, wherein the gene mutation is achieved by one or more methods selected from the group consisting of: screening natural variation, physical mutagenesis, chemical mutagenesis, biological mutagenesis and gene editing technology.

6. The method of claim 2, wherein the agent that inhibits the expression and / or activity of the protein encoded by the VQ22 gene comprises one or more selected from the group consisting of siRNA, miRNA, dsRNA, shRNA, hpRNA, ihpRNA, antisense RNA, antisense DNA, ribozymes, antibodies or their antigen-binding fragments, small molecule compounds, protein ligands, and CRISPR reagents.

7. The method of any one of claims 1-6, wherein the protein encoded by the VQ22 gene comprises the amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:4, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO:2 or SEQ ID NO:

4.

8. The method of any one of claims 1-7, wherein the VQ22 gene comprises a nucleotide sequence as shown in SEQ ID NO:1 or SEQ ID NO:3, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO:1 or SEQ ID NO:

3.

9. The method according to any one of claims 1 to 8, wherein the method increases the pigment glands of cotton by inhibiting the expression and / or activity of the protein encoded by the VQ22 gene in the cotton, thereby improving the disease and insect pest resistance of cotton.

10. The method according to any one of claims 1 to 9, wherein the pest is cotton bollworm.

11. The method of any one of claims 1 to 10, wherein the cotton is Gossypium hirsutum, Gossypium arboretum, Gossypium anomalum, Gossypium sturtianum, Gossypium raimondii, Gossypium stocksii, Gossypium longicalyx, Gossypium bickii, Gossypium rotundifolium, or Gossypium barbadense.

12. Cotton obtained by the method according to any one of claims 1 to 11, or cells, seeds, tissues or organs derived from said cotton.

13. A cotton cell, seed, tissue, organ or plant, wherein the expression and / or activity of a protein encoded by a VQ22 gene in the cotton cell, seed, tissue, organ or plant is inhibited.

14. The cotton cell, seed, tissue, organ or plant of claim 13, wherein the inhibition is achieved by one or more means selected from the group consisting of gene knockout, gene silencing, gene mutation and introduction of an agent that inhibits the expression and / or activity of a protein encoded by the VQ22 gene.

15. The cotton cell, seed, tissue, organ or plant of claim 14, wherein the gene knockout is achieved by gene editing technology; preferably, the gene editing technology comprises one or more selected from the following groups: zinc finger nuclease (ZFN) technology, transcription activating effector nuclease (TALEN) technology and CRISPR / Cas system-mediated gene editing technology.

16. The cotton cell, seed, tissue, organ or plant of claim 14, wherein the gene silencing is achieved by one or more means selected from the group consisting of RNA interference (RNAi), virus-induced gene silencing (VIGS), transcription factor deletion, and CRISPR-Cas9 system-mediated gene silencing.

17. The cotton cell, seed, tissue, organ or plant of claim 14, wherein the gene mutation is achieved by one or more methods selected from the group consisting of: screening natural variation, physical mutagenesis, chemical mutagenesis, biological mutagenesis and gene editing technology.

18. The cotton cell, seed, tissue, organ or plant of claim 14, wherein the agent that inhibits the expression and / or activity of the protein encoded by the VQ22 gene comprises one or more selected from the group consisting of siRNA, miRNA, dsRNA, shRNA, hpRNA, ihpRNA, antisense RNA, antisense DNA, ribozymes, antibodies or antigen-binding fragments thereof, small molecule compounds, protein ligands and CRISPR reagents.

19. The cotton cell, seed, tissue, organ or plant of any one of claims 13-18, wherein the protein encoded by the VQ22 gene comprises the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4, or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO:2 or SEQ ID NO:

4.

20. The cotton cell, seed, tissue, organ or plant of any one of claims 13-19, wherein the VQ22 gene comprises the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:3, or a nucleotide sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:1 or SEQ ID NO:

3.

21. The cotton cell, seed, tissue, organ or plant of any one of claims 13 to 20, wherein the expression and / or activity of the protein encoded by the VQ22 gene is inhibited to enlarge the pigment glands, thereby improving the ability to resist diseases and insect pests.

22. The cotton cell, seed, tissue, organ or plant of claim 21, wherein the pest is cotton bollworm.

23. The method of any one of claims 13-22, wherein the cotton cell, seed, tissue, organ or plant is derived from Gossypium hirsutum, Gossypium arboretum, Gossypium anomalum, Gossypium sturtianum, Gossypium raimondii, Gossypium stocksii, Gossypium longicalyx, Gossypium bickii, Gossypium rotundifolium or Gossypium barbadense.

24. A composition comprising an agent that inhibits the expression and / or activity of a protein encoded by a VQ22 gene.

25. The composition of claim 24, wherein the agent that inhibits the expression and / or activity of the protein encoded by the VQ22 gene comprises one or more selected from the group consisting of siRNA, miRNA, dsRNA, shRNA, hpRNA, ihpRNA, antisense RNA, antisense DNA, ribozymes, antibodies or antigen-binding fragments thereof, small molecule compounds, protein ligands, and CRISPR reagents.

26. The composition of claim 24 or 25, which enlarges the pigment glands of cotton.

27. The composition according to any one of claims 24 to 26, which is used for improving the disease and insect pest resistance of cotton.

28. The composition of claim 27, wherein the pest is cotton bollworm.

Images