Rice NB-ARC protein OsRPM-L1 and application of coding gene thereof in disease-resistant breeding

Abstract

The invention discloses application of a rice NB-ARC protein OsRPM-L1 and a coding gene thereof in disease-resistant breeding, and belongs to the technical field of gene engineering. The rice NB-ARC protein OsRPM-L1 and the coding gene OsRPM-L1 of the rice NB-ARC protein OsRPM-L1 are obtained through screening, wherein the amino acid sequence of the rice NB-ARC protein OsRPM-L1 is shown as SEQ According to the invention, Kittake rice is taken as a background, and a knockout plant and an overexpression plant of the OsRPM-L1 gene are constructed. A bacterium inoculation experiment proves that the susceptibility of an OsRPM-L1 gene knockout plant is not obviously changed, and an OsRPM-L1 gene overexpression plant is more disease-resistant than a background plant; it is indicated that the rice protein OsRPM-L1 positively regulates the disease resistance of plants, and the coding gene OsRPM-L1 can be used as a target gene for molecular breeding for improving the disease resistance of the plants, has a wide application prospect and has important significance on cultivation of rice varieties with improved disease resistance.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to application of rice NB-ARC protein OsRPM-L1 and its encoding gene in disease-resistant breeding. Background Art

[0002] Fungal diseases such as rice blast cause large-scale crop yield reductions, so breeding disease-resistant crops is one of the main goals of the planting industry. Many genes related to plant disease resistance have been reported, including effector molecule genes and regulatory genes, which come from crops such as rice, wheat, corn, soybeans, and model plants such as Arabidopsis. Some of them have been used as target genes in crop disease resistance genetic engineering, and disease-resistant rice, wheat, corn, soybeans, etc. have been successfully bred. However, due to differences in genetic background, some genes have been blocked in application, so new related genes are still needed to meet the needs of breeding.

[0003] As one of the most important food crops, improving rice's disease resistance has important theoretical and practical significance. Summary of the invention

[0004] The purpose of the present invention is to provide an application of rice NB-ARC protein OsRPM-L1 and its encoding gene in disease resistance breeding to solve the problems existing in the above-mentioned prior art. Experimental results show that there is no significant change in the rice blast susceptibility characteristics of OsRPM-L1 gene knockout plants, while OsRPM-L1 gene overexpression plants are more resistant to rice blast, indicating that OsRPM-L1 protein positively regulates rice resistance to rice blast and can be used as a target gene for molecular breeding to improve plant disease resistance.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides an application of rice protein OsRPM-L1 in any of the following items:

[0007] (1) Application in regulating rice resistance to rice blast;

[0008] (2) Application in breeding transgenic rice with improved resistance to rice blast;

[0009] (3) Application in the preparation of products for improving rice resistance to rice blast;

[0010] The amino acid sequence of the protein OsRPM-L1 is shown in SEQ ID NO.2.

[0011] The present invention also provides an application of the gene encoding the rice protein OsRPM-L1 in any of the following:

[0012] (1) Application in regulating rice resistance to rice blast;

[0013] (2) Application in breeding transgenic rice with improved resistance to rice blast;

[0014] (3) Application in the preparation of products for improving rice resistance to rice blast;

[0015] The nucleotide sequence of the coding gene is shown in SEQ ID NO.1.

[0016] The present invention also provides an application of a recombinant vector comprising the encoding gene in any of the following:

[0017] (1) Application in regulating rice resistance to rice blast;

[0018] (2) Application in breeding transgenic rice with improved resistance to rice blast;

[0019] (3) Application in the preparation of products for improving the resistance of rice to rice blast.

[0020] The present invention also provides an application of an engineered bacterium comprising the recombinant vector in any of the following:

[0021] (1) Application in regulating rice resistance to rice blast;

[0022] (2) Application in breeding transgenic rice with improved resistance to rice blast;

[0023] (3) Application in the preparation of products for improving the resistance of rice to rice blast.

[0024] Preferably, the expression level of the rice protein OsRPM-L1 or its encoding gene is up-regulated in rice to improve the resistance of the rice to rice blast.

[0025] Preferably, the method for upregulating the expression level of the rice protein OsRPM-L1 or its encoding gene in rice comprises the steps of constructing an overexpression vector of the encoding gene of the rice protein OsRPM-L1, transforming the overexpression vector into Escherichia coli, and then infecting rice plants.

[0026] The present invention also provides a method for improving the resistance of rice to rice blast, comprising the steps of up-regulating the expression level of a gene encoding rice protein OsRPM-L1 in rice to improve the resistance of the rice to rice blast;

[0027] The nucleotide sequence of the gene encoding the rice protein OsRPM-L1 is shown in SEQ ID NO.1.

[0028] Preferably, the method for upregulating the expression level of the gene encoding the rice protein OsRPM-L1 comprises overexpressing the gene encoding the rice protein OsRPM-L1 in rice.

[0029] Preferably, the method for overexpressing the gene encoding rice protein OsRPM-L1 in rice comprises the following steps:

[0030] An overexpression vector of the coding gene of the rice protein OsRPM-L1 is constructed, and the overexpression vector is transformed into Escherichia coli, and then infects rice plants.

[0031] The present invention also provides a method for breeding rice with improved resistance to rice blast, comprising the following steps:

[0032] Overexpressing a gene encoding rice protein OsRPM-L1 in rice cells, then cultivating the rice cells, and using the rice cells to regenerate rice, thereby obtaining the rice with improved resistance to rice blast;

[0033] The nucleotide sequence of the gene encoding the rice protein OsRPM-L1 is shown in SEQ ID NO.1.

[0034] The present invention discloses the following technical effects:

[0035] The present invention uses Kittake rice as the background to construct knockout plants and overexpression plants of the coding gene of rice protein OsRPM-L1. Inoculation experiments have shown that the effect of knocking out the OsRPM-L1 gene on the disease resistance of rice is not statistically significant, while the overexpression plants of the OsRPM-L1 gene are more disease-resistant than the recipient plants; indicating that the rice protein OsRPM-L1 positively regulates the disease resistance of plants, and its coding gene OsRPM-L1 can be used as a target gene for molecular breeding to improve plant disease resistance, which has broad application prospects and is of great significance for breeding rice varieties with improved disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0037] Figure 1 Sequencing peaks for knockout plant detection;

[0038] Figure 2Figure 2 is the phenotype and statistical results of knockout plants; A is the leaf phenotype of wild-type KT and knockout plant rpm1-l1 ko / KT after infection with rice blast fungus, with a scale of 1 cm; B is the statistics of the length of lesions on the leaves of wild-type KT and knockout plant rpm1-l1ko / KT after infection with rice blast fungus (n=11);

[0039] Figure 3 This is a graph showing the expression level of RPM1-L1 in plants overexpressing Ubi:RPM1-L1-Flag / KT;

[0040] Figure 4 Figure 2 is the phenotype and statistical results of overexpressed plants; A is the phenotype of wild-type KT and overexpressed Ubi:RPM1-L1-Flag / KT leaves after infection with rice blast fungus, and the scale is 1 cm; B is the statistics of lesion length on wild-type KT and overexpressed Ubi:RPM1-L1-Flag / KT leaves after infection with rice blast fungus. DETAILED DESCRIPTION

[0041] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0042] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0043] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0044] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0045] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0046] The biological materials and reagents used in the present invention are as follows:

[0047] The rice variety Kitaake (O. Sativa L. spp. japonica, var kitaake, AA genome, KT) belongs to the japonica subspecies and was provided by Professor Chen Xuewei of Sichuan Agricultural University.

[0048] OsRPM-L1 knockout and overexpression transgenic rice were produced by Boyuan Biotechnology Company.

[0049] The plant binary expression vector pVK005-01 was provided by Professor Wang Yonghong from Shandong Agricultural University.

[0050] The plant binary expression vector pTCK303 was provided by Professor Xuewei Chen from the State Key Laboratory of Sichuan Agricultural University.

[0051] Total RNA extraction kit: TRIzol purchased from Invitrogen, USA, catalog number 15596026.

[0052] Reverse transcription kit: HiScript III RT SuperMix for qPCR (+gDNA wiper) purchased from Vanzyme, China, with the catalog number R323-01.

[0053] Homologous recombination kit: ClonExpress II One Step Cloning Kit purchased from Vanzyme, China, with the catalog number C112-01.

[0054] Example 1 Rice NB-ARC gene OsRPM-L1 and its cloning

[0055] The present invention screened a NB-ARC gene OsRPM-L1 in rice, and designed primers according to the reference gene sequence of the rice KT genome:

[0056] OsRPM-L1-F: ATGGCTGAGGCTGTGATTCT (SEQ ID NO.3);

[0057] OsRPM-L1-R: TCAGAGAGCTCCATCTGTCT (SEQ ID NO. 4).

[0058] Using KT total cDNA as a template, a DNA band of about 2.8 kb was amplified by the above primers. After sequencing, it was confirmed that it was the OsRPM-L1 gene belonging to the NB-ARC protein family. The LOC_Os10g21400 (OsRPM-L1) sequence in the rice genome reference sequence and the clone sequence amplified from KT total cDNA were aligned, indicating that the clone sequence obtained in KT was identical to the LOC_Os10g21400 (OsRPM-L1) sequence. The amino acid sequence of the OsRPM-L1 protein is shown in Sequence 2 in the sequence table. The CDS sequence of the gene OsRPM-L1 encoding the OsRPM-L1 protein (amino acid sequence shown in SEQ ID NO.2) is shown in SEQ ID NO.1.

[0059] SEQ ID NO.1:

[0060]

[0061] SEQ ID NO.2:

[0062] 。

[0063] Example 2 OsRPM-L1 plant knockout vector (pVK005-sgRNA OsRPM-L1 )

[0064] Using the genome of rice KT as a template, the knockout target sequence was designed as follows:

[0065] CGTGAGGTGATAGCGCTGCA(SEQ ID NO.5);

[0066] The following primers were synthesized:

[0067] KO-F: TGTG CGTGAGGTGATAGCGCTGCA G (SEQ ID NO. 6);

[0068] KO-R:AAAAC TGCAGCGCTATCACCTCACG (SEQ ID NO.7);

[0069] After denaturation at 95°C, anneal to form a double strand. Digest the pVK005-01 vector with BsaI and recover the linearized vector. Mix the above DNA double strands and the linearized vector according to the following system, perform T4 DNA ligase ligation reaction and incubate at room temperature for 30 minutes. System: 0.5-4μL of DNA double-stranded fragments, 0.5-4μL of linearized vector, 2μL of T4 ligase, and make up to 10μL with double distilled water.

[0070] Obtain pVK005-sgRNA OsRPM-L1 Knockout vector.

[0071] Transformed into DH5α competent cells, selected by kanamycin, single clones were picked for colony PCR identification, plasmids were extracted from positive colonies and sequenced to confirm pVK005-sgRNA OsRPM-L1 Correct, genetic transformation can be carried out.

[0072] The construction of OsRPM-L1 knockout transgenic rice and the gene sequencing of OsRPM-L1 knockout plants were completed by Boyuan Biotechnology Company.

[0073] Example 3 Construction of OsRPM-L1 plant overexpression vector (pTCK303-35S:OsRPM-L1)

[0074] The cDNA obtained by reverse transcription of total RNA from rice KT was used as template, and the cloning primers were:

[0075] OE-F: TATCCAGATCCAGTGGGATCC ATGGCTGAGGCTGTGATTCT(SEQ ID NO.8);

[0076] OE-R: CGCACTAGTAAGCTTGGTACC TCAGAGAGCTCCATCTGTCT (SEQ ID NO. 9).

[0077] The full-length cDNA of OsRPM-L1 was obtained by PCR amplification, and the pTCK303-35S:eGFP-nosT vector was double-digested with BamHI and Kpn I to recover the linearized vector. The full-length cDNA of OsRPM-L1 recovered by the PCR above and the linearized vector were mixed for homologous recombination according to the following system: 0.5-5μL of DNA fragment, 0.5-5μL of linearized vector, 4μL of 5×CEII buffer, 2μL of ExnaseII, and double-distilled water was added to 20μL.

[0078] Obtain the pTCK303-35S:OsRPM-L1 recombinant vector.

[0079] After transformation to DH5α competent state and selection by kanamycin, single clones were picked for colony PCR identification. Plasmids were extracted from positive colonies and sequenced to confirm that pTCK303-35S:OsRPM-L1 was correct, and genetic transformation could be performed.

[0080] The construction of OsRPM-L1 overexpressing transgenic rice and the determination of OsRPM-L1 expression level in transgenic plants were completed by Boyuan Biotechnology Company.

[0081] Example 4 OsRPM-L1 is involved in regulating plant disease resistance

[0082] The inventors discovered that OsRPM-L1 plays an important role in regulating plant disease resistance, and therefore tested the effect of OsRPM-L1 on rice disease resistance.

[0083] Seedling stage puncture inoculation treatment: The test materials were Kittake (KT), KT background and genetically stable KT knockout strains OsRPM-L1-KO1 and OsRPM-L1-KO2 ( Figure 1 ), OsRPM-L1 overexpression lines OsRPM-L1-OE1 and OsRPM-L1-OE2 ( Figure 3 ).

[0084] Select seeds with full grains, place them in a conical bottle filled with tap water, and place them in a dark incubator at 37°C for germination, changing the water every day. After 2 days, select white seeds and place them in a 96-well seedling plate, place the 96-well seedling plate on a float, and grow them in Hoagland nutrient solution. After 21 days, select the second-to-last rice leaf with the same growth and size, pierce it and inoculate 5 μL of 5×10 5CFU / mL of Zhong10-8-14 rice blast fungus, and observe and count the length of lesions after 5 days.

[0085] The results are as follows Figure 2 and Figure 4 The values ​​are shown as mean ± standard deviation (n = 11), and the Turkey HSD test was used for significance analysis (p < 0.05 represents significant difference). Statistics show that after puncture inoculation, there is no significant difference in the lesions of OsRPM-L1-KO1 and OsRPM-L1-KO2 plants in the KT background compared with KT ( Figure 2 ).

[0086] Compared with KT, the lesion length of OsRPM-L1-OE1 and OsRPM-L1-OE2 plants was significantly reduced under the KT background, and the disease resistance of the plants was significantly enhanced ( Figure 4 ). This indicates that OsRPM-L1 positively regulates plant disease resistance and its encoding gene OsRPM-L1 can be used as a target gene for molecular breeding to improve plant disease resistance.

[0087] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of rice protein OsRPM-L1 in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in breeding transgenic rice with improved resistance to rice blast; (3) Application in the preparation of products for improving rice resistance to rice blast; The amino acid sequence of the protein OsRPM-L1 is shown in SEQ ID NO.

2.

2. Use of the gene encoding the rice protein OsRPM-L1 as claimed in claim 1 in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in breeding transgenic rice with improved resistance to rice blast; (3) Application in the preparation of products for improving rice resistance to rice blast; The nucleotide sequence of the coding gene is shown in SEQ ID NO.

1.

3. Use of a recombinant vector comprising the coding gene according to claim 2 in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in breeding transgenic rice with improved resistance to rice blast; (3) Application in the preparation of products for improving the resistance of rice to rice blast.

4. Use of an engineered bacterium comprising the recombinant vector according to claim 3 in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in breeding transgenic rice with improved resistance to rice blast; (3) Application in the preparation of products for improving the resistance of rice to rice blast.

5. The use according to any one of claims 1 to 4, characterized in that: The expression level of the rice protein OsRPM-L1 or its encoding gene is up-regulated in rice to improve the resistance of the rice to rice blast.

6. The use according to claim 5, characterized in that The method for upregulating the expression of the rice protein OsRPM-L1 or its encoding gene in rice comprises the steps of constructing an overexpression vector of the encoding gene of the rice protein OsRPM-L1, transforming the overexpression vector into Escherichia coli, and then infecting rice plants.

7. A method for improving rice resistance to rice blast, characterized in that: The method comprises the steps of up-regulating the expression level of a gene encoding rice protein OsRPM-L1 in rice to improve the resistance of the rice to rice blast; The nucleotide sequence of the gene encoding the rice protein OsRPM-L1 is shown in SEQ ID NO.

1.

8. The method according to claim 7, characterized in that The method for up-regulating the expression level of the gene encoding the rice protein OsRPM-L1 comprises over-expressing the gene encoding the rice protein OsRPM-L1 in rice.

9. The method according to claim 8, characterized in that The method for overexpressing the gene encoding rice protein OsRPM-L1 in rice comprises the following steps: An overexpression vector of the coding gene of the rice protein OsRPM-L1 is constructed, and the overexpression vector is transformed into Escherichia coli, and then infects rice plants.

10. A method for breeding rice with improved resistance to rice blast, characterized in that: The following steps are involved: Overexpressing a gene encoding rice protein OsRPM-L1 in rice cells, then cultivating the rice cells, and using the rice cells to regenerate rice, thereby obtaining the rice with improved resistance to rice blast; The nucleotide sequence of the gene encoding the rice protein OsRPM-L1 is shown in SEQ ID NO.1.

Images