Application of pyrus betulaefolia ARF transcription factor PbeARF2 gene

Abstract

The invention discloses application of a pyrus betulaefolia ARF transcription factor PbeARF2 gene, and belongs to the technical field of biological genetic engineering. The nucleotide sequence of the PbeARF2 gene is shown as SEQ ID NO.1. The application comprises the steps of improving the resistance of plants to iron deficiency stress, promoting the acidification degree of plant roots, improving the activity of high-iron reductase of the plants under the iron deficiency stress, cultivating plant varieties with high resistance to the iron deficiency stress and improving the chlorophyll content of leaves of the plants under the iron deficiency stress. A biological experiment proves that the pyrus betulaefolia ARF transcription factor gene PbeARF2 and the protein coded by the pyrus betulaefolia ARF transcription factor gene PbeARF2 have the function of promoting iron absorption of plants under iron deficiency stress for the first time, and a theoretical basis is laid for improving plant varieties and creating plant varieties with high iron deficiency resistance.

Description

Technical Field

[0001] The invention relates to the technical field of biological gene engineering, and in particular to an application of a Pyrus betulata ARF transcription factor PbeARF2 gene. Background Art

[0002] Auxin response factors (ARFs) are an important class of transcription factors in the auxin signaling pathway. Typical ARF proteins contain three conserved domains: the N-terminal DNA binding domain (DBD), the middle region (MR), and the C-terminal interaction domain (CTD). These conserved domains are also present at the C-terminus of Aux / IAA and participate in protein-protein interactions through interactions with auxin / indoleacetic acid (Aux / IAA) family dimers and ARFs. When auxin levels are low, Aux / IAA proteins in plants interact with ARF proteins, rendering ARF unable to effectively regulate downstream target genes, thereby shutting down the auxin signaling pathway. In contrast, when auxin levels increase, the binding of auxin receptors to auxin in plants is enhanced, and this binding promotes a closer association between receptors and Aux / IAA proteins, thereby participating in synergistic effects in auxin transduction signals in multiple pathways.

[0003] Studies have shown that there is a crosstalk between iron deficiency signals and auxin signals, and auxin response factor ARF genes play a key role in plant iron absorption. For example, the ARF double knockout mutant arf7arf19 usually does not cause delayed lateral roots (LRs), but under iron deficiency conditions, the number of LRs further increases, thereby affecting the iron absorption of Arabidopsis (Vandna Raiet al 2015). Compared with the wild type, the OsARF16 mutant can enhance the resistance of rice to iron deficiency under iron deficiency conditions (Shen et al., 2015). Knockout of OsARF12 also changed the abundance of mitochondrial regulation (OsMIR), iron (Fe) regulatory transporter 1 (OsIRT1) and post-embryonic short root 1 (OsSPR1) in rice roots, resulting in reduced root iron content (Qi et al, 2011). Due to the large number of auxin response factor ARF genes, there are currently no reports on plant ARF2 genes and plant iron deficiency regulation. Summary of the invention

[0004] The purpose of the present invention is to provide an application of a Pyrus betula ARF transcription factor PbeARF2 gene to solve the problems existing in the above-mentioned prior art. The present invention proves for the first time through biological experiments that the Pyrus betula ARF transcription factor gene PbeARF2 and the protein encoded by it promote the absorption of iron by plants under iron deficiency stress, laying a theoretical foundation for plant variety improvement and creating plant varieties with high resistance to iron deficiency.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides the use of the Pyrus betulata ARF transcription factor PbeARF2 gene or related biological materials in any of the following items:

[0007] 1) Improve the resistance of plants to iron deficiency stress;

[0008] 2) the extent to which it promotes acidification of plant roots;

[0009] 3) Improve the activity of ferric reductase in plants under iron deficiency stress;

[0010] 4) Cultivate plant varieties with high resistance to iron deficiency stress;

[0011] 5) Increase the chlorophyll content in leaves of plants under iron deficiency stress;

[0012] The nucleotide sequence of the PbeARF2 gene is shown in SEQ ID NO.1.

[0013] Optionally, the related biological materials include the protein encoded by the PbeARF2 gene, a recombinant plasmid containing the PbeARF2 gene, and a recombinant microorganism containing the recombinant plasmid.

[0014] Optionally, the amino acid sequence of the protein encoded by the PbeARF2 gene is shown in SEQ ID NO.2.

[0015] Optionally, the plants include Arabidopsis thaliana and Pyrus betulaeformis.

[0016] The present invention also provides a method for improving the resistance of plants to iron deficiency stress, comprising the step of using genetic transformation technology to stably overexpress the PbeARF2 gene in the plants to improve the resistance of the plants to iron deficiency stress.

[0017] Optionally, the plants include Pyrus betula and Arabidopsis thaliana.

[0018] The present invention also provides a method for cultivating plants with high resistance to iron deficiency stress, comprising the steps of using genetic transformation technology to stably overexpress the PbeARF2 gene in the plant to obtain transgenic plants with high resistance to iron deficiency stress.

[0019] Optionally, the plants include Pyrus betula and Arabidopsis thaliana.

[0020] The present invention discloses the following technical effects:

[0021] The present invention proves for the first time through biological experiments that the Pyrus betulus ARF transcription factor gene PbeARF2 and the protein encoded by it promote the absorption of iron by plants under iron deficiency stress. The present invention transforms Arabidopsis thaliana and Pyrus betulus with the gene, and finds that the plants stably overexpressing the gene significantly promote the absorption of iron by transgenic plants under an iron deficiency environment, and at the same time, can also significantly increase the acidification degree of the roots of the transgenic plants and the activity of ferric reductase (FCR) in the plants. The present invention lays a theoretical foundation for plant variety improvement and the creation of plant varieties with high resistance to iron deficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 The relative expression level change diagram of the PbeARF2 gene under iron deficiency treatment in Example 2, the Pyrus betulaeformis seedling material was treated with iron deficiency for 0, 6, 12, 24, and 48 hours, and the expression level of the PbeARF2 gene in each time period of iron deficiency treatment was analyzed;

[0024] Figure 2 The phenotype of Arabidopsis seedlings overexpressing PbeARF2 in Example 4 in MS medium with normal iron content (+Fe) and iron deficiency (-Fe), wherein PbeARF2-OE-1 and PbeARF2-OE-2 represent two overexpressed transgenic lines, and WT is the wild type;

[0025] Figure 3 The results (A) and statistical results (B) of FCR (ferrous iron reductase) activity detection of transgenic Arabidopsis strains (PbeARF2-OE-1, PbeARF2-OE-2) and wild-type materials (WT) in +Fe and -Fe culture in Example 4;

[0026] Figure 4 The chlorophyll content of the transgenic Arabidopsis strains (PbeARF2-OE-1, PbeARF2-OE-2) and the wild-type material (WT) in Example 4 under +Fe and -Fe culture;

[0027] Figure 5 The phenotype diagram of Pyrus betulata overexpressing PbeARF2 in Example 5 cultured under normal iron content (+Fe) and iron deficiency (-Fe) conditions, wherein PbeARF2-OE-1 and PbeARF2-OE-2 represent two overexpressed transgenic strains, and WT is the wild type;

[0028] Figure 6 The chlorophyll content of the transgenic Pyrus betulaeformis lines (PbeARF2-OE-1, PbeARF2-OE-2) and wild-type material (WT) in Example 5 under +Fe and -Fe culture;

[0029] Figure 7 The figure is a phenomenon diagram of the transgenic Pyrus betulaeformis strains (PbeARF2-OE-1, PbeARF2-OE-2) and wild-type material (WT) in Example 5, cultured in a medium supplemented with pH indicator bromocresol purple under normal iron content (+Fe) and iron deficiency (-Fe);

[0030] Figure 8 The FCR (ferrous iron reductase) activity detection results (A) and data statistical results (B) of the transgenic Pyrus betulus strains (PbeARF2-OE-1, PbeARF2-OE-2) and wild-type material (WT) in Example 5 under +Fe and -Fe culture. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Example 1 Acquisition of PbeARF2 gene

[0037] Take young Pyrus betulaeformis leaves and add them to liquid nitrogen to grind them into powder. Follow the steps in the RNA extraction kit manual to extract RNA. After obtaining RNA, use a cDNA reverse transcription kit to synthesize cDNA and store it at -20°C.

[0038] According to the coding sequence of Pyrus betulaeformis PbeARF2 gene, specific upstream and downstream amplification primers P1 and P2 were designed using Primer Premier 5 software:

[0039] Upstream amplification primer P1: ATGACGTCATCGGAGGTTTC (SEQ ID NO. 3),

[0040] Downstream amplification primer P2: CTATGCATATGGAAGTGGTTGAG (SEQ ID NO. 4).

[0041] Using the cDNA of Pyrus betulaeformis as a template, the PbeARF2 gene was amplified by PCR using DNA polymerase. The amplification system was: 25 μL DNA polymerase, 2 μL cDNA, 2 μL upstream primer, 2 μL downstream primer, 19 μL sterile water; the amplification conditions were: 95°C pre-denaturation for 1 min, 95°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 40 s, 35 cycles; 72°C extension for 1 min. The amplified product was detected by agarose gel electrophoresis. After detection, the gel was cut and recovered. The recovered product was sequenced by a sequencing company to obtain the complete sequence of the amplified product. The amplified PbeARF2 gene nucleotide sequence is shown in SEQ ID NO.1:

[0042]

[0043] The amino acid sequence encoded by the PbeARF2 gene is shown in SEQ ID NO.2:

[0044] MTSSEVSIRDNCGNQRGETFSSGFSDHNDARNAGEGHNGRSTVSAAGRDAETALYTELWHACAGPLVTVPRERELVFYFPQGHIEQVEASTNQVADQQMPVYNLPSKILCRVINVSLKAEPDTDEVFAQVTLLPESNQDENAVEKEPPPPPPPRFQVHSFCKTLTASDTSTHGGFSVLRRHADECLPPLDMSRQPPTQELGAKDLHGNEWRFRHIFRGQPRRHLLQSGWSVFVSSKRLVAGDAFIFLRGENGELRVGVRRAMRQQGSVPSSVISSHSMHLGVLATAWHAIITGTMFTVYYKPRTSPAEFIVPFDQYMESVKNNYSIGMRFKMRFEGEEAPEQRFTGTIIGMEDADTKRWRDSKWRCLKVRWDETSTIPRPERVSPWKIEPALAPPAVNPLPMPRPKRSRTNMVPSSPDSSVLTREVGLSKANVDPVMPGGFSRVLQGQELPTLRASFAESESDTAEKSVAWPPSMDEEKIDGVCASRRYGSENWMSSVRHEPTYTDLLSGFGNNGDSSNGICPPFVDQGVVSSNSMRKHSLDKEGKYNLHSWSVLPSSLSLSLDSNQKGRLGNKSYQAQGNSRYGGFGESSVMNGQRVEHPHGNWMMPPPPSPFENLANAREIVPRPQMLLDKHEAVKPKDGNYKLFGIPLITPDPALSHRNAMNESPRNNQAHTFESDLKSEKSRGSKSIDNPMAVSEPALQISQQHTRDAQGKSQGGSTRSCTKVHKQGIALGRSVDLTKFNNYEELIAELDMLFEFGGELMSPKKNWMIVYTDDEGDMMLVGDDPWQEFCSIVRKIFIYTREEVQKMNPGTLNAHGEDNLSLGAEGVDARVGKSQPLPYA(SEQ ID NO.2).

[0045] Example 2 Expression analysis of the PbeARF2 gene

[0046] The tissue culture seedlings of rooted Pyrus betulaeformis were selected and treated with iron deficiency after their growth state stabilized. Samples were taken at 0h, 6h, 12h, 24h, and 48h after treatment, and quickly frozen in liquid nitrogen and stored in a -80℃ refrigerator. The total RNA of the samples was extracted using an RNA extraction kit and reverse transcribed into cDNA.

[0047] Quantitative primers P3 and P4 designed according to the PbeARF2 sequence;

[0048] P3: CCGACCTTGAGAGCCAGTTTT (SEQ ID NO.5);

[0049] P4: ACCATTATTCCCGAAGCCTGA (SEQ ID NO. 6).

[0050] Actin, an internal reference gene of Pyrus betulaeformis, was used as a control. The reaction system was prepared according to the kit operation, and each reaction was repeated 3 times. The reaction program was set on the StepOne Real-time PCR System as follows: 95°C pre-denaturation for 2 min, 95°C denaturation for 15 s, 60°C annealing for 15-20 s, 72°C extension for 20-30 s, and 40 cycles. -ΔΔCT The fluorescence quantitative results were analyzed and calculated by the calculation method of . The results showed that the expression level of PbeARF2 was the highest at 6 hours after iron deficiency treatment (such as Figure 1 shown).

[0051] Example 3 Construction of overexpression vector of PbeARF2 gene

[0052] The PbeARF2 gene was constructed into an overexpression vector, and two restriction sites, KpnI and BamH I, were selected on the overexpression vector pCAMBIA1305. Then, PbeARF2 primers were designed, and the vector homologous sequences corresponding to the restriction sites were added before and after the primers. The primers are as follows:

[0053] P5: acggaattcgagctcggtaccATGACGTCATCGGAGGTTT (SEQ ID NO.7);

[0054] P6: caggtcgactctagaggatccTTATCGAAACCTCCGATGAC (SEQ ID NO. 8).

[0055] The pCAMBIA1305 vector was double-digested with two restriction endonucleases, KpnI and BamH I, to obtain a linearized vector.

[0056] Using the cDNA of Pyrus betulae leaves as a template, primers P1 and P2 were used to amplify the complete coding sequence of PbeARF2. The pCAMBIA1305-PbeARF2 overexpression vector was obtained by retrieving the vector using a kit and then ligating the linearized vector, which was transformed into competent cells of Escherichia coli (DH5α). The ligated product was then placed in ice for 5 minutes, then transferred to a 42°C metal bath for 1 minute, and then transferred to ice again for 10 minutes. Then, LB liquid without antibiotics was added to the tube, and the LB tube was placed in a 37°C shaker for 1 hour of shaking culture. The bacteria were then collected and applied to a plate with the corresponding antibiotics. After 12 hours, a monoclonal colony was picked and placed in a liquid LB medium containing the same concentration of kanamycin sulfate for propagation, and PCR reaction and agarose gel electrophoresis were used to detect whether the target band was contained for the next step of sequencing. After the sequencing alignment was correct, 50% glycerol was added in proportion and stored in a -80°C refrigerator.

[0057] Example 4 Arabidopsis genetic transformation and screening

[0058] Transgenic Arabidopsis was obtained by Agrobacterium-mediated inflorescence infection. Arabidopsis plants in full flowering were selected, and the excess flower pods were removed, leaving the flower buds. Then, the infection solution was prepared, and sucrose (final concentration of 30 g / L) and SilwetL-77 (final concentration of 200 μl / L) were added to the MS liquid medium. After activation, the Agrobacterium containing the PbeARF2 overexpression vector was transferred and the bacteria were shaken to an OD of 1. 600 =0.8~1.0. Centrifuge the Agrobacterium, pour off the supernatant, and then resuspend the Agrobacterium precipitate with the infection solution. Then immerse the Arabidopsis inflorescence completely in the infection solution for 60s. After infection, wrap the flowers completely with plastic wrap to keep them moist, culture them in the dark for 1d, and remove the plastic wrap the next day. Infect again after 5-6d. Wash the seeds, dry them, and evenly sow them on the screening medium containing hygromycin, and culture them in a light incubator. After the seedlings grow 2-3 true leaves, extract leaf DNA from seedlings with normal growth and well-developed root systems for identification. Positive plants are T0 plants. Harvest T0 generation seeds, continue to plant the obtained positive strains, and harvest seeds from individual plants.

[0059] (1) Identification of iron deficiency resistance (MS medium method): Take an appropriate amount of transgenic Arabidopsis seeds and wild-type seeds in a 2 mL centrifuge tube, wash the seeds, air-dry them, and then sow them in normal MS and iron-deficient MS solid medium. Cultivate them normally in a light incubator at 28°C and observe the phenotypic differences. During the entire growth process, the MS plate is placed vertically.

[0060] After growing on the culture medium for 2 weeks, the yellowing degree of leaves of different strains of plants showed differences. The results showed that on the medium with normal iron content, there was no significant difference in the growth status and yellowing degree between wild-type and transgenic plants; on the iron-deficient medium, the leaves of Arabidopsis plants overexpressing PbeARF2 were significantly greener than those of wild-type plants (such as Figure 2 shown).

[0061] (2) Determination of iron deficiency physiological indicators: FCR activity analysis and chlorophyll content determination were performed on wild-type and overexpressing PbeARF2 Arabidopsis under normal and iron-deficient conditions. The results showed that there was no significant difference in FCR activity in roots and chlorophyll content in leaves between overexpressing PbeARF2 Arabidopsis and wild-type Arabidopsis grown on medium with normal iron content ( Figure 3 and Figure 4 ), the FCR activity in the roots of overexpressing PbeARF2 treated with iron deficiency was significantly higher than that in the roots of wild-type Arabidopsis (e.g. Figure 3 Moreover, the chlorophyll content in the leaves of the plants overexpressing PbeARF2 was significantly higher than that of the wild-type plants (as shown in Figure 4 ). This indicates that overexpression of PbeARF2 significantly promoted the absorption of iron in Arabidopsis plants under iron deficiency stress.

[0062] Example 5 Genetic transformation and iron deficiency treatment of Pyrus betula

[0063] The pCAMBIA1305-PbeARF2 overexpression vector constructed in Example 3 was used to extract the plasmid, and the Agrobacterium competent state was transferred to obtain the root-generating Agrobacterium successfully transferred into the PbeARF2 gene. Healthy and uniform Pyrus betula seedlings were used for root transformation for 2-3 weeks. The seedlings were cut obliquely from the bottom of the stem, and the treated seedlings were directly immersed in a glass beaker containing a root-generating Agrobacterium suspension. The treated seedlings were then vacuumed for 10 minutes with a vacuum pump. Finally, they were transplanted into the soil and grown in a high humidity environment of 25°C with a 16h / 8h day and night light cycle to obtain two transgenic Pyrus betula plants PbeARF2-OE-1 and PbeARF2-OE-2.

[0064] Identification of iron deficiency resistance: Two transgenic Pyrus betulaeformis lines, PbeARF2-OE-1 and PbeARF2-OE-2, and WT were cultured in an iron-rich Hoagland nutrient solution for 7 days and then transferred to an iron-deficient environment for another 5 days. Under iron-deficient conditions, although the leaves of all plants remained somewhat green, the chlorosis of the leaves of the WT plants was more obvious than that of the transgenic PbeARF2 lines (e.g. Figure 5 In addition, the present invention also measured the chlorophyll content, and the results showed that under iron-deficient conditions, the chlorophyll content of the transgenic PbeARF2 strain was still higher than that of the WT (as shown in FIG. Figure 6 shown).

[0065] Iron deficiency physiological index determination: The treated plants were transferred to a medium supplemented with the pH indicator bromocresol purple. The results showed that under iron deficiency, the acidification of the rhizosphere of the transgenic PbeARF2 strain was more significant than that of the WT, which can be directly reflected by the color of the culture medium around the rhizosphere turning yellow (e.g. Figure 7 The relative FCR activity of transgenic PbeARF2-positive plants and WT was tested. The results showed that under iron deficiency conditions, the relative FCR activity of transgenic PbeARF2-positive plants was significantly higher than that of WT (as shown in Figure 2A). Figure 8 shown).

[0066] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of the Pyrus betulata ARF transcription factor PbeARF2 gene or related biological materials in any of the following: 1) Improve the resistance of plants to iron deficiency stress; 2) the extent to which it promotes acidification of plant roots; 3) Improve the activity of ferric reductase in plants under iron deficiency stress; 4) Cultivate plant varieties with high resistance to iron deficiency stress; 5) Increase the chlorophyll content in leaves of plants under iron deficiency stress; The nucleotide sequence of the PbeARF2 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The related biological materials include the protein encoded by the PbeARF2 gene, a recombinant plasmid containing the PbeARF2 gene and a recombinant microorganism containing the recombinant plasmid.

3. The use according to claim 2, characterized in that: The amino acid sequence of the protein encoded by the PbeARF2 gene is shown in SEQ ID NO.

2.

4. The use according to claim 1, characterized in that: The plants include Arabidopsis thaliana and Pyrus betulaeformis.

5. A method for improving plant resistance to iron deficiency stress, characterized in that: The method comprises the steps of stably over-expressing the PbeARF2 gene in claim 1 in the plant by using genetic transformation technology to improve the resistance of the plant to iron deficiency stress.

6. The method according to claim 5, characterized in that The plants include Pyrus betula and Arabidopsis thaliana.

7. A method for cultivating plants with high resistance to iron deficiency stress, characterized in that: The method comprises the steps of stably over-expressing the PbeARF2 gene in claim 1 in the plant by using genetic transformation technology to obtain a transgenic plant with high resistance to iron deficiency stress.

8. The method according to claim 7, characterized in that The plants include Pyrus betula and Arabidopsis thaliana.

Images