Anti-chicken IFN-gamma protein detection antibody, antibody pair, application and kit

Abstract

The invention belongs to the field of biology, and discloses an anti-chicken IFN-gamma protein detection antibody, which contains a heavy chain variable region and a light chain variable region, the amino acid sequence of a heavy chain variable region of the monoclonal antibody is shown as SEQ ID No.3; the amino acid sequence of the light chain variable region of the monoclonal antibody is as shown in SEQ ID No.4. The detection antibody has relatively strong binding capacity to chicken IFN-gamma with different concentrations under the same antibody capturing condition, and particularly has excellent suitability when being matched with a specific coated antibody for use. Meanwhile, the invention also provides a group of antibody pairs for detecting chicken interferon or duck interferon and application of the antibody and the antibody pair for detecting the IFN-gamma.

Description

Technical Field

[0001] The invention relates to the biological field, and in particular to a detection antibody, an antibody pair, an application and a kit for chicken IFN-γ protein. Background Art

[0002] In the field of avian infectious diseases, such as persistent infection and immunosuppression, humoral immunity is often insufficient to provide complete protection, and CD8+ cytotoxic T cells are required to participate in clearing the infection. Chicken interferon-gamma (chIFN-γ), as a key cytokine in the chicken immune system, is produced by activated T cells and NK cells. It can activate macrophages, enhance the cytotoxicity of natural killer cells, and promote the proliferation and differentiation of T cells and B cells. It plays an indispensable role in immune regulation, antiviral infection and tumor surveillance. Its abnormal expression is closely related to multiple infectious diseases caused by intracellular bacteria or viruses in chickens. Therefore, in-depth research on chIFN-γ will help clarify the action characteristics and internal mechanisms of the chicken immune system, which is of great significance in the prevention and control of poultry diseases. At the same time, the detection of IFN-γ levels can reflect the body's cellular immune status and the activation of antigen-specific T cells, which is important for the study of immune mechanisms, analysis of immune functions and evaluation of cellular immune levels after vaccine immunization.

[0003] Through modern immunological technology, a variety of detection methods such as ELISA, enzyme-linked immunospot test (ELISPOT), and immunohistochemistry can be established for accurate detection of ChIFN-γ. These immunological detections of IFN-γ rely on highly specific and high-affinity monoclonal antibodies (mAbs) or antibody pairs. Although there are many reports on chIFN-γ monoclonal antibodies, there are limited examples of their application in immunological detection, and there is a lack of high-quality detection methods and products. Compared with mouse monoclonal antibodies, rabbit sources are easier to screen for high-affinity antibodies. The affinity of rabbit monoclonal antibodies for target antigens is 100 to 1,000 times that of mouse therapeutic antibodies, and they can bind to target proteins with high specificity. At the same time, based on the specificity of B lymphocyte surface antigens, single B lymphocytes that produce antigen specificity can be accurately obtained through multi-channel fluorescence sorting using flow sorting technology. This single B lymphocyte obtained by sorting has the advantage of natural light and heavy chain pairing, which is superior to the traditional mAb preparation method.

[0004] In order to determine the monoclonal antibody or antibody pair in the immunological detection method, it is necessary to clarify the affinity between the antibody and the antigen and the difference in the binding site, which plays a key role in improving the sensitivity and accuracy of immunological detection and developing new immunotherapy methods. Biolayer interferometry (BLI) is a label-free analytical detection technology based on optical interference signals to achieve rapid detection of biological molecules. When biological molecules form a biofilm at the end of the sensor and bind to the object to be detected, the thickness of the biofilm will change, which in turn affects the optical interference signal, thereby analyzing the molecules to be detected. This technology can analyze affinity in real time and without labeling, with accurate results and high sensitivity. It is widely used in life sciences and drug development, and can be used for drug target screening, protein interaction research and antigen epitope analysis.

[0005] In this field, it is very challenging to develop detection antibodies and coating antibodies with high adaptability and good detection effect, among which the development of detection antibodies is particularly difficult.

[0006] Related antibody development technologies can be found at: Reference 1: "Preparation of chicken IFN-γ monoclonal antibody and identification of its recognition region", Liu Yanan et al., Chinese Journal of Veterinary Science, 2017, 47(06): 721-726; Reference 2: "Prokaryotic expression of chicken interferon-γ and preparation and identification of its monoclonal antibody", written by Cui Jinqiang et al., Chinese Journal of Animal Husbandry and Veterinary Medicine, 2024, 51(7): 3008-3019; Both of the above documents mentioned the development of antibodies that are compatible with chicken interferon-γ. Among them, document 1 developed multiple monoclonal antibodies with different recognition sites, and the highest affinity (dissociation constant) determined by the indirect ELISA method was 7.35×10 -10 ; Reference 2 developed an antibody pair, among which 5A10 (capture antibody) and HRP-5A10 (labeled antibody) had the largest P / N value, and their affinity (dissociation constant) was as high as 1.04 nmol / L, which is equivalent to 1.04×10-9 mol / L after conversion.

[0007] For those skilled in the art, it is quite difficult to screen out the capture antibody and the labeling antibody at one time, and it is even more difficult to screen out the antibody pair with the best detection effect; this is mainly reflected in the following aspects: 1. The detection effect is closely related to affinity. The better the affinity, the better the detection sensitivity. 2. It is best for the capture antibody and the labeled antibody to have different recognition epitopes to improve the antigen capture ability; 3. Antibody pairs with different recognition epitopes are not necessarily able to show good results. They are related to the location of the antigen recognition epitope, the high-level spatial structure of the antibody and antigen binding, etc. This difference in matching was confirmed in subsequent experiments of the present invention; From the above-mentioned literature 1 and literature 2, it can be seen that literature 1 only developed antibodies for different sites, and did not verify the antibody pair; literature 2 developed an antibody pair, and from the perspective of P / N value, the same antibody pair had the best effect, and literature 2 did not verify the epitope; Therefore, it is difficult to develop an antibody pair with good detection effect according to the records in References 1 and 2. At the same time, according to the research progress of this project, the development of detection antibodies is of utmost importance. Summary of the invention

[0008] The purpose of the present invention is to provide a detection antibody against chicken IFN-γ (chIFN-γ) protein, which has a strong binding ability to different concentrations of chIFN-γ under the same capture antibody conditions, and has excellent adaptability when used in combination with a specific coating antibody.

[0009] Meanwhile, the present invention also provides a group of antibody pairs for detecting chicken interferon or duck interferon and the application of the above detection antibodies and antibody pairs.

[0010] The antibody pair of the present invention is screened based on the same method, has no competitive relationship, and particularly performs much better than foreign antibodies when detecting duck interferon.

[0011] To achieve the above object, the present invention provides the following technical solutions: A detection antibody against chIFN-γ protein, the detection antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID No.3; the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID No.4.

[0012] At the same time, the present invention also discloses a group of antibody pairs for detecting chicken interferon or duck interferon, the antibody pair consists of a coating antibody and a detection antibody; the detection antibody is as shown above; the coating antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is as shown in SEQ ID No.1; the amino acid sequence of the light chain variable region of the monoclonal antibody is as shown in SEQ ID No.2.

[0013] The technical advantages of the present invention are: 1. The antibody titer is high, and the lowest titer of the three antibodies is higher than 1:819200; 2. The antibody has strong affinity, and the minimum affinity has reached the order of 10 -12 , especially Ab-56 antibody has higher affinity, with a KD value of less than 10 -12 ; 3. Ab-56 of the present invention recognizes different epitopes from Ab-38 and Ab-68; Fig.10 It was proved that although the epitopes were different (Ab-56 and Ab-38), they could not achieve high-precision detection, indicating that the difference in epitopes was an important factor in improving the detection effect, but it was not the only determining factor; The above three factors are the reasons why the antibody pair of the present invention shows significant advantages over other similar antibodies or antibody pairs in the prior art; 4. Compared with foreign antibodies, the antibody pair of the present invention shows obvious advantages in the detection of duck PBMC, which further illustrates the advantages of the detection antibody Ab-68 of the present invention.

[0014] In addition, the present invention also discloses the use of the above-mentioned detection antibody or the above-mentioned antibody pair in preparing a kit for detecting chicken interferon or duck interferon.

[0015] Finally, the present invention also discloses a kit for detecting chicken interferon or duck interferon, which contains the detection antibody or the antibody pair as described above.

[0016] Compared with the prior art, the present invention has the following beneficial effects: 1. The detection antibody of the present invention has a strong binding ability to chicken IFN-γ of different concentrations under the same capture antibody conditions, and has excellent adaptability when used in combination with a specific coating antibody; 2. The detection antibody prepared by the present invention also has a strong binding ability with duck interferon.

[0017] 3. The antibody pair of the present invention is screened based on the same method, and the antibody pair has no competitive relationship. In particular, when detecting duck interferon, the performance is far superior to foreign antibodies. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the plasmid map of the prokaryotic expression vector pET21b-chIFN-γ of Example 1 of the present invention; Figure 2 This is the SDS-PAGE gel electrophoresis diagram of the prokaryotic expression recombinant chIFN-γ protein of Example 1 of the present invention; Figure 3 This is the plasmid map of the eukaryotic expression vector pRK5-chIFN-γ of Example 2 of the present invention; Figure 4AThe plasmid map of the rabbit anti-chIFN-γ monoclonal antibody expression vector carrying the antibody heavy chain constructed in Example 3 of the present invention; Figure 4B The plasmid map of the rabbit anti-chIFN-γ monoclonal antibody expression vector carrying the antibody light chain constructed in Example 3 of the present invention; Figure 5 This is a graph showing the results of detecting anti-chIFN-γ rabbit monoclonal antibodies using ELISA in Example 3 of the present invention; Figure 6 This is the SDS-PAGE gel electrophoresis diagram of the anti-chIFN-γ rabbit monoclonal antibody expressed in Example 3 of the present invention; Fig. 7A The results of the potency tests of three monoclonal antibodies and foreign antibodies; Figure 7B The results of the affinity test of 3 monoclonal antibodies and foreign antibodies were determined by ELISA method; Figure 8 The affinity of the monoclonal antibody to chIFN-γ was determined by BLI method in Example 5 of the present invention; Fig. 9 This is a result diagram of the determination of steric hindrance between different monoclonal antibodies by BLI method in Example 5 of the present invention; Fig.10 This is a diagram showing the results of the monoclonal antibody combination screening of Example 7 of the present invention; Fig.11 This is a diagram showing the screening results of the optimal coating antibody concentration and the color developing solution in Example 7 of the present invention; Fig.12 This is a diagram showing the screening results of the optimal biotin-labeled detection antibody concentration in Example 7 of the present invention; Fig.13 This is a diagram showing the screening results of the optimal HRP-labeled streptavidin concentration in Example 7 of the present invention; Fig.14 This is a graph showing the results of duck interferon detection using ELISPOT in Example 8 of the present invention. DETAILED DESCRIPTION

[0019] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0020] Example 1 A method for prokaryotic expression of recombinant chIFN-γ protein, comprising the following steps: Take the spleen of 6-8 week old chickens, use Magen RNA extraction kit (Cat. No. R411102) to extract RNA from chicken spleen cells, and then use Solebo Reverse Transcription Kit (M-MLV, Cat. No. 2641Q) to reverse transcribe using oligo-dT primer to generate cDNA for PCR amplification of chIFN-γ gene. The PCR amplification primer sequence is: chIFN-γ-F(GCGCCATTGCTAAATCTTGTTC, SEQ ID NO.14); chIFN-γ-R(GGCCTCGAGGCAATTGCATCTCCTCTG, SEQ ID NO.15); The PCR reaction system contained 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 6.5 μL ddHO 2 O, 12.5 μL 2 × Phanta Max Master Mix (Dye Plus) (Novozyme, catalog number P525). The PCR program was 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 60 s, 30 cycles, 72℃ extension for 5 min and then 4℃ maintenance. The amplified band size was 450 bp, which was the chIFN-γ protein sequence without the signal peptide. The sequencing results were consistent with the chIFN-γ gene registered in GenBank (X99774.1).

[0021] purchased from NEB N I (Cat. No. R0111V) and XOt The chIFN-γ gene amplified by PCR and the pET21b (+) vector stored in the laboratory were double-digested with I (Cat. No. R0146V), and connected with NEB's T4 ligase (Cat. No. M0202V) to construct the pET21b-chIFN-γ prokaryotic expression plasmid. The plasmid has a 6×His tag at the C-terminus of the chIFN-γ gene for protein purification (see Figure 1 for the plasmid map).

[0022] Add the pET21b-chIFN-γ plasmid to an EP tube containing BL21DE3 competent cells (Biyuntian, Cat. No. C1400), mix gently, place on ice for 30 min, heat shock at 42°C in a water bath for 45 s, and place on ice for 2 min. Add 500 μL LB solution without antibodies, culture at 37°C, 220 rpm on a shaker for 45 min, take 150 μL of the bacterial solution and apply it to ampicillin LB solid medium, and culture it upside down at 37°C overnight. Pick 5 single colonies in 1 mL ampicillin LB culture medium, culture at 37°C on a shaker for 4-6 h, use the bacterial solution as a template, and use the chIFN-γ gene amplification primers to perform bacterial solution PCR, and send the positive bacterial solution for sequencing.

[0023] The correct bacterial suspension was inoculated with 10 mL of ampicillin LB culture medium at a ratio of 1:100 for overnight activation. The next day, it was transferred to 200 mL of ampicillin LB culture medium at a ratio of 1:50 and cultured at 37°C and 200 rpm until OD 600 nm About 0.6-0.8, add IPTG to a final concentration of 0.5mM, and induce at 37℃, 200 rpm for 8 hours. Collect the bacterial solution and centrifuge, resuspend in PBS, ultrasonically break to release the protein, centrifuge to obtain the supernatant, and purify according to the instructions of GenScript NI affinity chromatography column (Cat. No. L00250), remove impurities with 100mM imidazole, and elute with 200mM imidazole. A total of 10 mg of prokaryotic expressed soluble chIFN-γ protein was obtained (SDS-PAGE gel electrophoresis diagram is shown in Figure 2 ).

[0024] Example 2 A eukaryotic expression method for preparing recombinant chIFN-γ protein, the operation is as follows: The chIFN-γ gene amplified in the specific example 1 was inserted into the commercial vector pRK5 stored in the laboratory, and the eukaryotic expression plasmid pRK5-chIFN-γ was constructed according to the method of Example 1 (see Figure 3). The constructed plasmid was transformed into Trans5α Escherichia coli competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and the positive and sequence-corrected monoclonal clones were identified by colony PCR and sequencing. The positive monoclonal clones were inoculated into a test tube containing 20 mL of ampicillin LB culture medium at a ratio of 1:100 and cultured overnight at 37°C and 200 rpm. The bacterial solution was collected and the plasmid was extracted using an endotoxin-free plasmid extraction kit (OMEGA, item number D694302).

[0025] 2-3 hours before transfection, culture 200 mL of HEK293F cells at 2×10 6 / mL density was inoculated in a sterile shake flask. 300 μg of plasmid DNA was added to 20 mL of fresh culture medium, mixed well, and then 900 μL of PEI transfection reagent (Qihang Liye, Cat. No. BYPS-24765) was added. Mix well and let stand for 10-20 minutes to form a DNA-PEI complex, which was then evenly added to the transfection shake flask. Protein expression was detected 60-72 hours after transfection.

[0026] Since chIFN-γ protein was well expressed in the cell supernatant, it was purified according to the instructions of NI affinity chromatography column (GenScript, Cat. No. L00250) to obtain 2 mg of protein. The purified chIFN-γ was then labeled with FITC labeling kit (Beyotime, Cat. No. P0639M) and used as an antigen for sorting chIFN-γ-specific single B cells.

[0027] Example 3 Preparation of chIFN-γ specific monoclonal antibody using flow cytometry sorting technology, the specific operation is as follows: Healthy adult New Zealand white rabbits weighing more than 2 kg were selected, and 1 mL of recombinant chIFN-γ protein containing 500 μg of prokaryotic expression was mixed with an equal volume of Freund's complete adjuvant (Sigma) for subcutaneous immunization on both sides of the rabbit's spine. The second immunization was performed two weeks later, and incomplete Freund's adjuvant (Sigma) was used in the subsequent method and dosage. On the 8th day after each immunization, 1 mL of blood was collected from the ear vein to separate the serum, and the antibody titer was tested by ELISA. When the antibody titer was greater than 10 6 End of immunity.

[0028] To perform flow cytometry sorting of rabbit splenic B lymphocytes and screen out chIFN-γ-specific single B cells, rabbit splenic lymphocytes were isolated using a PBMC isolation kit (Solerbo, Cat. No. P8760), resuspended in ice-cold FACS buffer and adjusted to a cell concentration of 10 6 10 µg of phycoerythrin (PE)-labeled goat anti-rabbit secondary antibody (abcom, catalog number ab72465) and 20 µg of BV421-labeled eukaryotic expressed recombinant chIFN-γ protein prepared in Example 2 were added in sequence and incubated on ice for 30 minutes to allow the marker to fully bind to the cell surface antigen receptor.

[0029] After labeling, centrifuge at 400 g for 10 minutes, resuspend the cells in ice-cold FACS buffer and wash three times, adjust the volume to 500 µL FACS buffer, transfer to a sterile flow cytometer and place on ice. Optimize the conditions on the flow cytometer, set the sorting gate and flow rate, and use the sorting system to separate the PE + BV421 +The cells were sorted into a 96-well PCR plate containing reverse transcriptase and lysis buffer. These cells were chIFN-γ specific single B lymphocytes.

[0030] Single specific single B cells in a 96-well PCR plate were lysed at room temperature, and the heavy chain and light chain variable region mRNAs were reverse transcribed into cDNA templates using oligo-dT primers. Two rounds of nested PCR were performed using primers provided by Yantai Teco Biotechnology Co., Ltd. to obtain the antibody heavy chain and light chain variable region DNA genes. The amplified products were sequenced to obtain the VH and VL amino acid sequences, and the selected VH and VL genes were cloned into plasmid expression vectors (pTT5CH, pTT5CL) with light and heavy chain constant regions, respectively, and inserted upstream of the CH and CL genes to obtain light chain and heavy chain gene expression vectors. The vector contains IL-2 secretion signal peptide (SEQ ID No.7: MYRMQLLSCIALSLALVTNS), leader sequence, promoter sequence, poly (A) sequence, rabbit monoclonal antibody heavy chain constant region (CH) and light chain constant region (CL) genes and other elements. See the vector map for details. Figure 4A and Figure 4B The constructed vector was transformed into Trans5α E. coli competent cells to prepare sufficient plasmid for subsequent transfection and expression.

[0031] 1 μg of plasmid containing heavy chain and light chain genes was transferred into HEK293T cells in a 24-well plate at a ratio of 1:1. The cells expressed heavy and light chains and assembled into a complete antibody structure and released into the culture medium. After 60-72 hours of culture, the supernatant contained recombinant rabbit monoclonal antibodies that could recognize chIFN-γ. Figure 5 It can be seen that 27 of the 96 cell supernatants were chIFN-γ positive. After removing non-specific reactive B lymphocytes, 8 strains of chIFN-γ specific single B lymphocytes were obtained, and the antibodies produced by them were named Ab-6, Ab-24, Ab-38, Ab-48, Ab-56, Ab-66, Ab-68, and Ab-75. The three strains with the highest affinity (Ab-38, Ab-56, and Ab-68 antibodies) were selected for subsequent experiments, and their variable region amino acid sequences are as follows: Ab-56 antibody, the amino acids in the heavy chain variable region are shown in SEQ ID No. 1, the amino acids in the light chain variable region are shown in SEQ ID No. 2, the full-length amino acid sequence of the heavy chain is shown in SEQ ID No. 8, and the full-length amino acid sequence of the light chain is shown in SEQ ID No. 9; Ab-68 antibody, the heavy chain variable region is shown in SEQ ID No.3, the light chain variable region is shown in SEQ ID No.4, the full-length amino acid sequence of the heavy chain is shown in SEQ ID No.10, and the full-length amino acid sequence of the light chain is shown in SEQ ID No.11; The Ab-38 antibody has a heavy chain variable region as shown in SEQ ID No.5, a light chain variable region as shown in SEQ ID No.6, a full-length amino acid sequence of its heavy chain as shown in SEQ ID No.12, and a full-length amino acid sequence of its light chain as shown in SEQ ID No.13.

[0032] Referring to the method in Example 2, HEK293F cells were used to express the above three monoclonal antibodies in large quantities. Protein A affinity gel resin was used to purify the monoclonal antibodies from the supernatant, and the antibody expression was identified by SDS-PAGE gel electrophoresis. The results are shown in FIG. Figure 6 As shown, all antibodies have obvious bands at 55KDa and 25KDa, indicating that the antibodies are successfully expressed. The antibodies are concentrated to 1 mg / mL using a 30kDa concentrator tube and stored in a -20℃ refrigerator for later use.

[0033] Example 4 The binding ability of the prepared monoclonal antibody to chIFN-γ was determined by ELISA, and the operation was as follows: The prokaryotic expressed chIFN-γ protein was diluted to 1 μg / ml with PBS and coated on a 96-well ELISA plate at 100 μL / well at 4°C overnight. The plate was washed 3 times with 200 μL PBST for 3 minutes each time, and 200 μL PBS containing 5% skim milk was added to each well and blocked at 37°C for 2 h. The plate was washed again with 200 μL PBST for 3 minutes each time. The antibody to be tested was added at 100 μL / well in a 2-fold gradient (starting from 1:400) and allowed to stand at 37°C for 1 h. The plate was washed 3 times with 200 μL PBST for 3 minutes each time. HRP-labeled goat anti-rabbit IgG antibody was diluted 1:5000 with PBS containing 2.5 wt% skim milk powder, and 100 μL was added to each well and allowed to stand at 37°C for 1 h. The plate was washed again with 200 μL PBST for 3 minutes each time. Add 100 μL of commercial TMB colorimetric solution to each well, react at room temperature in the dark for 15 min, then add 50 μL of 2M H 2 SO 4 Stop the reaction and read the OD with a microplate reader 450nm Absorbance value.

[0034] The foreign antibody (MT7C10) was used as a positive control according to the same procedure, but the secondary antibody was HRP-labeled goat anti-mouse IgG antibody.

[0035] 2.1 times the negative control OD 450nm The value is the CUT OFF value, and the result is shown in Fig. 7A As shown, the titers of Ab-38, Ab-56, and Ab-68 antibodies were all greater than 1:819200, which were higher than the titer of foreign antibodies (MT7C10).

[0036] The affinity dissociation constant (KD value) of an antibody is an important indicator for measuring the binding affinity between an antibody and an antigen. Its value varies with different antibody-antigen pairs and is generally around 10 -6 - 10 -12 mol / L, the smaller the KD value, the higher the affinity. 450nm The absorbance value is used as the ordinate and the antibody concentration is used as the abscissa to draw a scatter plot, and a logarithmic trend line and corresponding formula are generated. Substitute half of the maximum absorbance value (this value is regarded as the absorbance when the antigen-antibody binding rate is 50%) into the above formula to calculate the antibody concentration, which is the antibody affinity dissociation constant (KD).

[0037] The results are as follows Figure 7B As shown. After calculation, the KD of the four monoclonal antibodies are as follows: Ab-38 strain: 8.08×10 −11 mol / L; Ab-56 strain: 6.49×10 −11 mol / L; Ab-68 strain: 7.16×10 −11 mol / L; Foreign antibody (MT7C10): 2.05×10 −10 mol / L.

[0038] The KD values ​​of the above 4 monoclonal antibodies are all within the high affinity range, so they are all high affinity antibodies.

[0039] Among them, the KD values ​​of Ab-38, Ab-56 and Ab-68 are relatively close, and their affinity levels are comparable; the KD value of foreign antibodies is relatively large, and although it is within the category of high-affinity antibodies, its affinity is slightly lower than that of the three antibodies provided by the present invention.

[0040] Example 5 Considering that the KD value of the foreign antibody (MT7C10) in the ELISA results is larger, it may be caused by the use of different secondary antibodies (the antibody provided by the present invention uses HRP-labeled goat anti-rabbit antibody, and the foreign antibody (MT7C10) uses HRP-labeled goat anti-mouse antibody), in order to eliminate the interference of the secondary antibody on the experimental results, the biomembrane interferometry (BLI) technology was used to directly measure the KD value of Ab-38, Ab-56 and Ab-68 antibodies with recombinant chIFN-γ protein. The specific operation is as follows: The His1K biosensor was immersed in a solution containing purified chIFN-γ (5 μg / mL) for antigen fixation, and then a 10 nM two-fold gradient dilution of the antibody solution was combined with the antigen-fixed sensor for a binding time of 180 s, followed by a dissociation reaction with a dissociation time of 180 s. The results showed that all three antibodies bound to chIFN-γ and the binding was tight ( Figure 8 ).

[0041] The affinity of Ab-38 antibody is 2.615×10 -12 The KD value of Ab-56 antibody was <1.0×10 -12 The KD value of Ab-68 antibody was 1.659×10 -12 The KD value of the foreign antibody (MT7C10) is 4.926×10 -12 (Table 1) shows that the three antibodies have extremely high affinity with recombinant chIFN-γ protein, and are superior to foreign antibodies. Ab-56 has the strongest affinity with recombinant chIFN-γ protein.

[0042] Table 1: Binding kinetic parameters of Ab-38, Ab-56, Ab-68 and chIFN-γ Sample ID KD(M) ka(1 / Ms) kdis(1 / s) <![CDATA[R 2 ]]> Ab-38 2.615E-12 1.601E05 4.186E-07 0.9995 Ab-68 1.659E-12 1.768E05 2.934E-07 0.9994 Ab-56 <1.0E-12 6.985E05 4.550E-07 0.9995 Foreign Antibodies 4.926E-12 7.034E04 3.465E-07 0.9967

[0043] In the competitive binding experiment, after the His1K biosensor was fixed with recombinant chIFN-γ protein (200 nM), it was first subjected to a binding reaction with one antibody (200 nM) for 180 s, and then another antibody (200 nM) was added for another 180 s, and a single binding control group was set up. Fig. 9 As shown, when Ab-38 was used as the first binding antibody, Ab-56 had a positive signal, while Ab-38 and Ab-68 had no positive signal, indicating that Ab-38 and Ab-68 were bound to the same epitope, and Ab-56 recognized a different epitope. This result was further confirmed when Ab-68 was used as the first binding antibody, at which time Ab-56 also had a positive signal, while Ab-68 and Ab-38 had no positive signal. When Ab-56 was used as the first binding antibody, Ab-38 and Ab-68 had positive signals, but Ab-56 itself did not detect a positive signal, further proving that Ab-56 had no steric hindrance with Ab-38 and Ab-68.

[0044] The signal changes of different antibody combinations during the competitive binding process were recorded and the inhibition rate was calculated. An inhibition rate greater than 0.7 indicated no competition, 0.3-0.7 indicated moderate competition, and less than 0.3 indicated strong competition. The inhibition rate between Ab-38 and Ab 68 was 0.1 or 0.17, less than 0.3, indicating a strong competitive relationship; the inhibition rate between Ab-56 and Ab-38 was 0.83 or 0.72, and the inhibition rate between Ab-56 and Ab-68 antibodies was 0.72 or 0.74, both greater than 0.7, indicating no competitive relationship (Table 2). These data indicate that the antigenic epitopes recognized by Ab-38 and Ab-68 may be the same or similar, resulting in steric hindrance, while there is no steric hindrance between Ab-56 and Ab-38 and Ab-68.

[0045] Table 2: Competition relationship between Ab-38, Ab-56, and Ab-68 antibodies in BLA assay

[0046] From the perspective of antibody competition and binding site differences, there is no or weak competition between Ab-56 and Ab-38 and Ab-68, indicating that the antigenic epitopes it recognizes are quite different from those of the other two antibodies. Antibody recognition of antigenic epitopes mainly depends on the amino acid sequence and spatial conformation of the complementary determining region (CDR). Comparison revealed that there are differences in the amino acid sequences of the CDR region structures of Ab-38 and Ab-68, but the two show a strong competition relationship. It is speculated that this may be due to the fact that their binding sites are close in spatial position, resulting in a mutual blocking effect.

[0047] When developing immunological detection methods such as double antibody sandwich ELISA or ELISPOT, Ab-56 antibody is combined with Ab-38 or Ab-68 antibody into an antibody pair. By utilizing their characteristics of recognizing different antigenic epitopes, "dual-site" recognition of chIFN-γ can be achieved, effectively improving the specificity and sensitivity of the detection, reducing the interference caused by nonspecific binding, and providing a better antibody combination solution for accurately detecting the chIFN-γ content in chickens.

[0048] It is worth mentioning that as a dimeric protein, chIFN-γ has a unique structure that has a special impact on the detection method. When using double antibody sandwich ELISA, ELISPOT and other methods for detection, even if a pair of antibodies with a strong competitive relationship is selected, such as the combination of Ab-38 and Ab-68 antibodies, or even the same antibody is used as the capture antibody and the detection antibody, chIFN-γ still has a high probability of being successfully detected. This is because when the antigen epitope of a monomer in the chIFN-γ dimer complex is bound by an antibody, the antigen epitope at the same position of the other monomer can still provide an opportunity for the antibody to bind, thereby ensuring the effective detection of chIFN-γ by the same antibody. But obviously, when using paired antibodies without steric hindrance, the antibody pairs have two binding sites on the chIFN-γ dimer complex, and do not interfere with each other. The detection signal will be stronger and there will be fewer non-specific bindings.

[0049] Example 6 The suitability and sensitivity of Ab-38, Ab-56, and Ab-68 as detection antibodies were evaluated by ELISA method as follows: The Ab-38, Ab-56, and Ab-68 antibodies expressed in Example 4 were labeled with HRP to obtain HRP-Ab-38, HRP-Ab-56, and HRP-Ab-68.

[0050] 1000 ng / mL purified chIFN-γ was diluted 3 times with PBS, added to 96-well ELISA plate at 100 μL / well, and incubated at 4°C overnight. Wash 3 times with 200 μL PBST, add 200 μL PBST containing 5 wt% skim milk to each well, and block at 37°C for 1 h. Wash again 3 times with 200 μL PBST, add 100 μL HRP-Ab-38, HRP-Ab-56, and HRP-Ab-68 diluted 1:2000 to each well, and incubate at 37°C for 1 h. Wash 3 times with 200 μL PBST, add 100 μL TMB colorimetric solution to each well, develop at room temperature in the dark for 15 min, add 50 μL 2M H 2 SO 4 Stop the reaction and read the OD with a microplate reader 450nm reading.

[0051] The results are shown in Table 3. All three antibodies have strong binding ability to interferon at different coating concentrations. However, when there is no chIFN-γ coating, the background value of HRP-Ab-38 antibody is high and it is not recommended for detection; Ab-56 and Ab-68 can be used as detection antibodies.

[0052] Table 3 chIFN-γ binding ability test results of different antibodies Antigen concentration ng / mL HRP-Ab-38 HRP-Ab-56 HRP-Ab-68 0.00 0.2341 0.0542 0.0681 1.37 0.3899 0.3958 0.2158 4.12 0.6129 0.6744 0.4555 12.35 1.0928 1.0406 0.9684 37.04 1.7857 1.8456 1.7416 111.11 2.2614 2.2647 2.1620 333.33 2.3880 2.3554 2.3115 1000 2.6134 2.6843 2.4130

[0053] Example 7 To find the best antibody pair and determine the relevant conditions for the ELISPOT detection method, the operation is as follows: 1. Screening of the best antibody pairs Ab-38, Ab-56, and Ab-68 were selected as coating antibodies and coated on ELISPOT filter plates at a concentration of 5 μg / mL, with 100 μL per well. After washing with sterile PBS three times, 200 μL each time, 10 μL of phytohemagglutinin (PHA) stimulator was added to the positive wells, and 10 μL of PBS was added to the control wells. Subsequently, 1×10 6 Chicken peripheral blood mononuclear cells (PBMCs) were cultured at 37°C and 5% CO 2 Incubate in the environment for 48 hours.

[0054] Wash again with PBS 3 times, 200 μL each time, use bio-Ab-56 (biotin-labeled Ab-56 detection antibody) and bio-Ab-68 (biotin-labeled Ab-68 detection antibody) at a concentration of 1 μg / mL as detection antibodies, add 100 μL to each well, and incubate at 37°C for 1 hour. Then, wash 3 times with PBS, 200 μL each time, add 100 μL of HRP-labeled streptavidin diluted 1:2000 to each well, and incubate at 37°C for 1 hour. Wash again with PBS 3 times, 200 μL each time, use TMB color development solution at room temperature for 15 minutes, and then rinse four times with deionized water. After discarding the liquid, place it in a ventilated place away from light to dry, and take pictures of the corresponding wells using a plate reader.

[0055] The results are as follows Fig.10 As shown, when Ab-56 was used as the coating antibody and bio-Ab-68 was used as the detection antibody, the number of spots was the largest and clear, the staining background color was light, and there were no obvious spots in the control group. This combination was the best antibody pair.

[0056] 2. Determination of the optimal coating antibody concentration and color development solution The Ab-56 antibody protein was diluted to six concentrations of 10 µg / mL, 5 µg / mL, 2.5 µg / mL, 1.25 µg / mL, 0.625 µg / mL, and 0.3125 µg / mL with PBS buffer, and 100 μL per well was coated on the ELISPOT plate. Then, the ELISPOT related steps were continued, and finally different color developing solutions were used for color development.

[0057] Depend on Fig.11It can be seen that the number of spots at a dilution of 5 µg / mL (500 ng / well) is appropriate and clear, the staining background color is light, and there are no obvious spots in the control group. At different concentrations, the number of spots of AEC colorimetric solution (solarbio, product number A2010) is less than that of TMB colorimetric solution (Mabtech, product number 3651-10), indicating that TMB colorimetric solution has higher sensitivity, so TMB colorimetric solution was selected as the final colorimetric solution.

[0058] 3. Determination of the Optimal Biotinylated Antibody Concentration Bio-Ab-68 was diluted to five working concentrations of 1 µg / mL, 0.5 µg / mL, 0.25 µg / mL, 0.125 µg / mL, and 0.0625 µg / mL with PBS containing 0.5% fetal bovine serum (FBS), and the ELISPOT related steps were continued. The criteria for judgment were the appropriate number of spots in the experimental group, light staining background color, and no obvious spots in the control group. Fig.12 As a result, the optimal concentration of bio-Ab-68 was determined to be 0.5 µg / mL.

[0059] 4. Determination of the Optimal Streptavidin-HRP Concentration Perform ELISPOT operations according to the conditions explored above. After incubating with bio-Ab-68 for 1 hour, wash with PBS 3 times, 200 μL each time. Dilute HRP-labeled streptavidin (Mabtech, catalog number 3310-9-1000) with PBS containing 0.5% FBS at a ratio of 1:1000, 1:2000, 1:4000, 1:8000, and 1:16000, respectively. Add 100 μL to each well and incubate at 37°C for 1 hour. Then continue the ELISPOT color development and termination operations, with the appropriate number of spots in the experimental group, light staining background color, and no obvious spots in the control group as the judgment criteria. Reference Fig.13 As a result, the optimal HRP-labeled streptavidin dilution ratio was finally determined to be 1:1000.

[0060] Example 8 ELISPOT was used to detect the secretion of interferon by duck PBMC. The operation was as follows: ELISPOT related operations were performed according to the conditions explored in Example 7 above. In this example, the antibody pair of Ab-56 and bio-Ab-68 and the antibody pair of Ab-56 and foreign antibody (MT7C10) were used to detect duck PBMC. The test results are shown in Fig.14As shown in the figure, when using the antibody pair of Ab-56 and bio-Ab-68, more spots were detected. When using Ab-56 and foreign antibodies, only a few spots were detected, and a more obvious background color appeared. Therefore, these results fully prove that the antibody pair we screened not only has the ability to bind to chicken PBMC interferon, but also has a strong binding ability to DuIFN-γ secreted by duck PBMC, and can be used as a universal IFN-γ ELISPOT detection kit for chickens and ducks.

[0061] Summarize: The above embodiments can lead to the following conclusions: 1. It can be proved by Example 4 that the antibody of the present invention has a high titer, and its titer is greater than 1:819200; 2. Example 4 shows that the antibody of the present invention has strong affinity, and the KD value has reached the order of magnitude of 10 -12 , especially Ab-56 antibody, with a KD value of less than 10 -12 ; 3. Example 5 shows that Ab-56 of the present invention does not have steric hindrance with Ab-38 and Ab-68; Fig.10 It was proved that although the epitopes were different (Ab-56, Ab-38), they could not achieve high-precision detection, indicating that the difference in epitopes was an important factor in improving the detection effect, but it was not the only determining factor; The above three factors are the reasons why the antibody pair of the present invention exhibits significant advantages over other similar antibodies or antibody pairs in the prior art.

[0062] 4. Example 8 proves that the antibody pair of the present invention has obvious advantages over foreign antibodies in the detection of duck PBMC, which further illustrates the advantages of the detection antibody Ab-68 of the present invention.

[0063] In summary, the detection antibody of the present invention has excellent properties in all aspects; the present invention also develops a coating antibody that is compatible with the detection antibody, and several experiments have proved that the two have different recognition epitopes, excellent affinity and titer, achieving the best detection effect.

[0064] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. A detection antibody against chicken IFN-γ protein, characterized in that: The detection antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID No.3; the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID No.

4.

2. A group of antibody pairs for detecting chicken interferon or duck interferon, characterized in that: The antibody pair consists of a coating antibody and a detection antibody; the detection antibody is as shown in claim 1; the coating antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the coating antibody is as shown in SEQ ID No.1; the amino acid sequence of the light chain variable region of the coating antibody is as shown in SEQ ID No.

2.

3. Use of the detection antibody according to claim 1 or the antibody pair according to claim 2 in preparing a kit for detecting chicken interferon or duck interferon.

4. A kit for detecting chicken interferon or duck interferon, characterized in that: Contains the detection antibody according to claim 1 or the antibody pair according to claim 2.

Images