A Penicillium oxalicum strain JM-C14-2 and its applications
By providing Penicillium oxalate JM-C14-2, the shortcomings in the agricultural field of Penicillium oxalate mechanism have been solved, and the effects of promoting tomato growth, improving soil nutrients and inhibiting pathogens have been achieved, which has improved the application efficiency of modern agriculture.
Patent Information
- Application Number
- CN202510421672.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2045-04-07
AI Technical Summary
In the prior art, there is little research on the systematic exploration of Penicillium oxalate in the agricultural field and its mechanism of action, especially in the decomposition of organic and inorganic substances in soil, salt resistance, soil-borne diseases and the promotion of plants, which has affected its application efficiency in modern agriculture.
A Penicillium oxalate strain JM-C14-2 has obvious cellulase, protease and neutral phosphatase ability, can prepare biological agents that promote tomato growth and inhibit pathogenic bacteria, and has strong saline-alkali resistance, can improve soil nutrients and prevent pathogenic bacteria from spreading.
It significantly improves the growth of tomato roots and leaves of chlorophyll content, enhances the content of hydrolyzable nitrogen, effective phosphorus, fast-acting potassium and organic matter in the soil, effectively inhibits pathogenic bacteria, and improves the recovery and reconstruction ability of soil microbial communities.
Smart Images

Figure CN119913049B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microbial technology, and particularly relates to a Penicillium oxalicum strain JM-C14-2 and its application. Background Art
[0002] Penicillium oxalicum is a fungus widely present in nature and has attracted much attention for its unique metabolic characteristics and biological activities. This strain mainly comes from soil, plant residues, air, and some agricultural and sideline products. It is widely distributed and highly adaptable, capable of surviving and reproducing in a variety of natural environments.
[0003] In recent years, with the increasing emphasis on environmental protection and sustainable development, the development of green and efficient production technologies using microbial resources has become a research hotspot. Penicillium oxalicum has received extensive attention due to its unique physiological characteristics. Penicillium oxalicum can not only efficiently produce organic acids such as oxalic acid but also has the ability to degrade a variety of refractory substances, such as polyethylene in plastic waste, showing its unique value in solving environmental pollution problems. In addition, this type of fungus can also synthesize a variety of secondary metabolites, including antibiotics, antioxidants, etc., which is also of great significance for the development of the pharmaceutical and health industries.
[0004] Currently, there have been many basic studies on Penicillium oxalicum at home and abroad, but the systematic exploration of its application in the agricultural field and the research on its action mechanism are still relatively few. This includes the decomposition of organic and inorganic substances in the soil, salt tolerance, soil-borne diseases, and the growth-promoting effect on plants. It is still necessary to further study the specific action mechanism and performance of Penicillium oxalicum to provide new ideas for improving its application efficiency in agricultural production practices and the sustainable development of modern agriculture. Summary of the Invention
[0005] The purpose of the present invention is to provide a Penicillium oxalicum strain JM-C14-2 and its application. The Penicillium oxalicum strain JM-C14-2 has obvious abilities to produce cellulase, protease, and neutral phosphatase, and can be used to prepare a biological agent for promoting the growth of tomatoes and inhibiting pathogenic bacteria.
[0006] To achieve the above invention purpose, the present invention is implemented by adopting the following technical solutions:
[0007] The present invention provides a Penicillium oxalicum strain JM-C14-2, whose taxonomic name is Penicillium oxalicum strain JM-C14-2, which is deposited in the China Center for Type Culture Collection, and the deposit number is CCTCC NO: M 20232615.
[0008] Furthermore, the front colony of Penicillium oxalicum JM-C14-2 presents dark green color, with neat edges, and the surface is covered with a dense villous structure. The center of the colony deepens in color due to the accumulation of mature conidia, forming concentric ring-like textures. The conidiophores are usually solitary or branched, with typical penicillate structures at the top. The conidial chains are arranged radially, with a diameter of about 2.5–3.5 μm and a smooth surface.
[0009] The present invention also provides the use of the Penicillium oxalicum JM-C14-2 as described above in the preparation of a biological agent for promoting the growth of tomatoes.
[0010] Furthermore, the growth of the tomatoes includes the accumulation of nutrients in tomato leaves and the growth of tomato roots.
[0011] Furthermore, the Penicillium oxalicum JM-C14-2 can increase the length, surface area, and volume of the roots, and improve the structure and function of tomato roots.
[0012] Furthermore, the Penicillium oxalicum JM-C14-2 can increase the chlorophyll content, nitrogen accumulation, and leaf surface temperature of tomato leaves.
[0013] The present invention also provides the use of the Penicillium oxalicum JM-C14-2 as described above in the preparation of a biological agent for inhibiting pathogenic bacteria.
[0014] Furthermore, the pathogenic bacteria is Fusarium oxysporum f. sp. niveum.
[0015] The present invention also provides the use of the Penicillium oxalicum JM-C14-2 as described above in improving soil nutrients.
[0016] Furthermore, the Penicillium oxalicum JM-C14-2 has the ability of high protease production, the ability to dissolve inorganic phosphorus and organic phosphorus, and the ability to produce cellulase.
[0017] Furthermore, the Penicillium oxalicum JM-C14-2 has the ability to secrete oxalic acid, has strong salt and alkali tolerance characteristics, and improves the contents of hydrolyzable nitrogen, available phosphorus, available potassium, and organic matter in the soil.
[0018] Compared with the prior art, the present invention has the following advantages and technical effects:
[0019] 1. The Penicillium oxalicum JM-C14-2 provided by the present invention has a relatively obvious ability to produce cellulase and a high ability to produce protease. At the same time, it has been experimentally verified that Penicillium oxalicum has a strong ability to produce neutral phosphatase, and the production of neutral phosphatase by Penicillium oxalicum is 2-3 times that of the ordinary control group. The Penicillium oxalicum described in the present invention secretes various enzymes and can be used for biodegradation of petroleum hydrocarbons, pectin, lignocellulose, and phosphorus-containing pesticides, etc., converting some refractory organic pollutants into nutrients that can be utilized by microorganisms, thereby realizing the restoration and reconstruction of soil microbial communities.
[0020] 2. The Penicillium oxalicum JM-C14-2 provided by the present invention has strong salt and alkali resistance, and certain substances secreted by Penicillium oxalicum can prevent the spread and growth of pathogenic bacteria, and further explore its wide application potential in various polluted sites.
[0021] 3. The Penicillium oxalicum JM-C14-2 provided by the present invention can promote root growth, increase the chlorophyll content, nitrogen accumulation and leaf surface temperature of tomato leaves; at the same time, it can improve soil nutrient content, including a significant increase in soil hydrolyzable nitrogen, available phosphorus, available potassium, and organic matter content, further providing new ideas for how to improve application efficiency in modern agricultural production practice. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 It is a morphological characteristic diagram of the Penicillium oxalicum JM-C14-2 on the Rose Bengal medium; among them, a is the front view of the plate, and b is the back view of the plate;
[0023] Figure 2 It is a morphological diagram of the Penicillium oxalicum JM-C14-2 inoculated into the protease identification medium; among them, a is the front view of the plate, and b is the back view of the plate;
[0024] Figure 3 It is a data diagram of protease production by the Penicillium oxalicum JM-C14-2;
[0025] Figure 4 It is a morphological diagram of the Penicillium oxalicum JM-C14-2 inoculated into the inorganic phosphorus medium; among them, a is the front view of the plate, and b is the back view of the plate;
[0026] Figure 5 It is a morphological diagram of the Penicillium oxalicum JM-C14-2 inoculated into the organic phosphorus medium; among them, a is the front view of the plate, and b is the back view of the plate;
[0027] Figure 6 It is a data diagram of neutral phosphatase production by the Penicillium oxalicum JM-C14-2 strain;
[0028] Figure 7Morphological characteristics diagram of Penicillium oxalicum JM-C14-2 on the cellulase medium; among them, a is the front view of the plate, and b is the back view of the plate;
[0029] Figure 8 Data diagram of cellulase production by the strain Penicillium oxalicum JM-C14-2;
[0030] Fig. 9 Morphological diagram of Penicillium oxalicum JM-C14-2 inoculated into the saline-alkali medium; among them, a is the front view of the plate, and b is the back view of the plate;
[0031] Fig.10 Antagonistic morphological diagram of Penicillium oxalicum JM-C14-2 and Fusarium oxysporum; among them, a is the treatment group, and b is the control group;
[0032] Fig.11 Diagram of the growth of tomato roots after treatment with the bacterial suspension of Penicillium oxalicum JM-C14-2 and the control CK;
[0033] Fig.12 Diagram of the scanning data of tomato roots after the application of the bacterial suspension of Penicillium oxalicum JM-C14-2;
[0034] Fig.13 Data diagram of the change in chlorophyll in the leaves of potted tomatoes after applying Penicillium oxalicum JM-C14-2;
[0035] Fig.14 Data diagram of the change in nitrogen content in the leaves of potted tomatoes after applying Penicillium oxalicum JM-C14-2. Detailed implementation manners
[0036] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in combination with the content in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.
[0037] Example 1: Source and screening of the strain
[0038] 1. Strain source
[0039] The sample was collected in May 2023 from the soil under the crop residues pile in a greenhouse in Qingtianhu Village, Daotian Town, Shouguang City, Weifang City, Shandong Province. During sampling, the five-point sampling method was used for operation, and the sample was mixed evenly and refined to obtain the original sample. After returning to the laboratory, part of the sample was stored at -80°C for the isolation and screening of the strain. Part of the sample was air-dried for the determination of soil physical and chemical properties, and the soil physical and chemical properties are shown in Table 1.
[0040] Table 1: Physicochemical properties of the sampled soil
[0041]
[0042] 2. Strain screening
[0043] Weigh 1 g of the fresh soil sample stored at -80°C, add 9 mL of phosphate buffer, shake well, and make a 10 - ¹ dilution. Then perform 10-fold serial dilutions (10 - ², 10 - ³, 10 -4 ), and finally separate the diluted solution at a concentration suitable for separation of 10 -4 .
[0044] (1) Rose Bengal medium
[0045] Dissolve 10 g of glucose, 5 g of peptone, 1.0 g of potassium dihydrogen phosphate, 0.5 g of magnesium sulfate (anhydrous), 3.3 mL of Rose Bengal (concentration 10 g / L), and 15 g / L of agar in 1000 mL of distilled water. Before use, add 3.3 mL of streptomycin at 0.1 g / L to each liter of the medium.
[0046] (2) Fungal screening
[0047] Primary screening: Select the Rose Bengal medium suitable for the growth of Penicillium oxalicum. Take an appropriate amount of the diluted solution (concentration 10 -4 ) and spread it on the plate medium, with 3 replicates for each dilution. Incubate the plates in an incubator at 28°C for 3 - 5 days, observe the colony growth, and observe the conidial chains and hyphal structures under a microscope. Screen out the strains with typical morphological characteristics of Penicillium oxalicum, record the colony numbers, and purify them.
[0048] Re-screening: Obtain pure cultures by single spore isolation to ensure the purity of the strains. Inoculate the purified strains onto the Rose Bengal slant medium and store them at 4°C for later use.
[0049] (3) Purification culture of fungi
[0050] Purify and culture the suspected Penicillium oxalicum colonies obtained from the screening to obtain pure Penicillium oxalicum strains. To ensure the purity of the strains, multiple purification cultures may be required. After each purification, identify the strains under a microscope to confirm whether they are single Penicillium oxalicum strains. Finally, screen out a suspected Penicillium oxalicum and name it Penicillium oxalicum JM-C14-2.
[0051] Example 2: Strain identification
[0052] 1. Morphological identification
[0053] Inoculate Penicillium oxalicum JM-C14-2 on Rose Bengal Medium and culture it. As Figure 1 shown, the front colony of Penicillium oxalicum JM-C14-2 presents dark green color, with a neat edge and a dense villous structure covering the surface, which is the densely growing area of conidiophores. The center of the colony has a darker color due to the accumulation of mature conidia, forming concentric ring-like textures. Conidiophores are usually solitary or branched, and a typical penicillus structure can be seen at the top. The conidial chains are arranged radially, with a diameter of about 2.5–3.5 μm and a smooth surface. The reverse side of the strain is accompanied by the diffusion of transparent or light red water-soluble pigments, which are secondary metabolites. The mycelium is colorless or light brown in the medium, the hyphal diameter is about 3–5 μm, with obvious septa, and the branching angle is mostly acute, conforming to the typical microscopic characteristics of the genus Penicillium.
[0054] 2. Identify the strain by ITS method
[0055] (1) The primer ITS rDNA sequences used for PCR amplification are as follows (synthesized by TSINGKE, 5’→3’):
[0056] ITS1: TCCGTAGGTGAACCTGCGG (SEQ ID No.1);
[0057] ITS4: TCCTCCGCTTATTGATATGC (SEQ ID No.2).
[0058] (2) Method for extracting genomic DNA from fungi using a kit: Since the outer layer of fungal cells has a relatively thick cell wall, the method of thermal lysis has poor effects. Therefore, a special silica gel binding column method is generally used to extract genomic DNA. In this experiment, the Solarbio Fungal Genomic DNA Extraction Kit (D2300) was used.
[0059] (3) PCR reaction system (50ul)
[0060] Table 2: PCR reaction system
[0061]
[0062] (4) PCR reaction conditions
[0063] 95℃, 5min; (95℃, 15s; 58℃, 30s; 72℃, 10s) 30 cycles; 72℃, 10min; 4℃, ∞.
[0064] 3. Single-strain sequencing analysis
[0065] The purified PCR product was subjected to base sequence determination (the product sequence is shown in SEQ ID No. 3). The forward and reverse sequences of the successfully sequenced peak map were spliced to obtain the 16s rDNA sequence of the strain. The obtained sequence was Blast aligned on NCBI (https: / / www.ncbi.nlm.nih.gov / ), and here Nucleotide BLAST was selected for nucleic acid sequence alignment; the sequence was directly pasted into the "Enter Query Sequence" box and clicked "Blast" for alignment. After sequence alignment, it was confirmed that the Penicillium oxalicum JM-C14-2 belongs to the genus Penicillium.
[0066] The screened Penicillium oxalicum JM-C14-2 strain was preserved. Preservation unit: China Center for Type Culture Collection; Address: Wuhan University, Wuhan, China; Preservation date: December 21, 2023; Penicillium Oxalicum strain The preservation number of JM-C14-2 is CCTCC NO: M 20232615.
[0067] Example 3: Analysis of the decomposition characteristics of Penicillium oxalicum on soil organic nitrogen
[0068] 1. Protease screening medium:
[0069] A: 5 g of skim milk powder was dissolved in 500 ml of distilled water and autoclaved at 115 °C for 10 min;
[0070] B: 15 g of agar powder was dissolved in 500 ml of distilled water and autoclaved at 121 °C for 20 min.
[0071] The sterilized A and B were mixed and poured into plates for standby.
[0072] After inoculation, it was cultured in an incubator at 30 °C for 3 d to observe the presence of clear zones and record their sizes.
[0073] 2. Protein decomposition characteristics
[0074] In the ultra-clean workbench, the Penicillium oxalicum strain was inoculated into the protein medium to ensure that the operation area was in a sterile state. After inoculation, the plate was inverted and placed in a constant temperature incubator and cultured at 28 °C, the suitable growth temperature of Penicillium oxalicum, for 3 - 5 days. The colony growth and the formation of clear zones were observed daily.
[0075] As Figure 2 shown, the colony growth was relatively dense and distributed over a large area on the surface of the medium, indicating that the bacterium had good adaptability and growth vitality on the protein medium and was able to utilize the nutrients in the medium for proliferation; it was shown that Penicillium oxalicum had a certain ability to decompose organic nitrogen.
[0076] 3. Protease production
[0077] Using commercially available Bacillus subtilis as the CK, the purified Penicillium oxalicum JM-C14-2 and CK were respectively inoculated into Rose Bengal liquid medium, and cultured with shaking at 28°C and 150 rpm for 3 - 5 days. The fermentation broth was collected and centrifuged (4000 rpm, 10 min), and the supernatant was taken for enzyme activity determination. The total protease was determined using a plant neutral phosphatase (NLP) enzyme-linked immunosorbent assay kit.
[0078] The results are shown as Figure 3 follows. Compared with the protease concentration of 13.81 ug / L in the control group, the protease concentration produced by Penicillium oxalicum JM-C14-2 was 48.28 ug / L, indicating that Penicillium oxalicum has the ability to produce high protease and can also decompose soil organic nitrogen.
[0079] Example 4: Analysis of the characteristics of Penicillium oxalicum in decomposing soil inorganic phosphorus and organic phosphorus
[0080] 1. Effect of Penicillium oxalicum on decomposing soil inorganic phosphorus
[0081] Prepare inorganic phosphorus medium: 10 g of glucose, 0.5 g of ammonium sulfate, 0.3 g of sodium chloride, 0.3 g of potassium chloride, 0.3 g of magnesium sulfate heptahydrate, 0.03 g of ferrous sulfate heptahydrate, 0.03 g of manganese sulfate tetrahydrate, 5.0 g of calcium phosphate, 20 g of agar, dissolved in 1000 mL of distilled water, pH value 7.0, autoclaved at 121°C for 20 min.
[0082] Perform aseptic operation in a laminar flow hood, and inoculate Penicillium oxalicum JM-C14-2 onto the inorganic phosphorus medium plate. After inoculation, invert the plate and place it in an incubator, and culture it at 28°C according to the suitable growth temperature of Penicillium oxalicum for 3 - 5 days. Observe the colony growth and the formation of phosphorus-dissolving circles every day.
[0083] As Figure 4 shown, after Penicillium oxalicum JM-C14-2 was inoculated into the inorganic phosphorus medium, it showed good adaptability, and the hyphae quickly expanded and formed a dense network structure. The growth rate of the hyphae was relatively fast, and obvious colony formation could usually be observed within 48 hours after inoculation; it was significantly observed that a phosphorus-dissolving circle was formed after the Penicillium oxalicum strain was inoculated into the inorganic phosphorus medium.
[0084] Combined with Figure 4 it can be known that the formation of the phosphorus-dissolving circle indicates that the Penicillium oxalicum strain releases soluble phosphorus by secreting organic acids or phosphatase substances to dissolve Ca3(PO4)2, thus preliminarily determining that Penicillium oxalicum has the ability and mechanism to dissolve inorganic phosphorus.
[0085] 2. Decomposition mechanism of Penicillium oxalicum on soil organic phosphorus
[0086] Organic phosphorus medium: 10 g of glucose, 0.5 g of ammonium sulfate, 0.3 g of sodium chloride, 0.3 g of potassium chloride, 0.3 g of magnesium sulfate heptahydrate, 0.03 g of ferrous sulfate heptahydrate, 0.03 g of manganese sulfate tetrahydrate, 5.0 g of calcium phytate, 20 g of agar, dissolved in 1000 mL of distilled water, adjust the pH value to 7.0, and autoclave at 121 °C for 20 minutes.
[0087] The ability of Penicillium oxalicum to activate and dissolve organic phosphorus can be systematically evaluated through the formation of a phosphorus-dissolving circle and the analysis of neutral phosphatase activity. In a laminar flow hood, inoculate the Penicillium oxalicum strain onto the organic phosphorus medium plate. After inoculation, invert the plate and place it in a constant temperature incubator, and culture it at 28 °C, the suitable growth temperature of Penicillium oxalicum, for 3 - 5 days, and observe the colony growth and the formation of the phosphorus-dissolving circle every day.
[0088] Figure 5 Plate inoculated with Penicillium oxalicum JM-C14-2 on the organic phosphorus medium. As Figure 5 shown, its colonies grow dispersedly, with different sizes, and are approximately circular; a phosphorus-dissolving circle can be clearly observed.
[0089] Combined with Figure 5 it can be known that the formation of the phosphorus-dissolving circle indicates that Penicillium oxalicum JM-C14-2 decomposes organic phosphorus, and the enzymes secreted by it can promote the hydrolysis reaction of organic phosphorus, releasing phosphate ions for plant absorption and utilization, thus preliminarily determining that Penicillium oxalicum has the ability and mechanism to dissolve organic phosphorus.
[0090] 3. Analysis of the characteristics of neutral phosphatase production by Penicillium oxalicum strains
[0091] Using commercially available Bacillus subtilis as the CK, inoculate the purified Penicillium oxalicum JM-C14-2 and CK into Rose Bengal liquid medium respectively, culture them at 28 °C and 150 rpm for 3 - 5 days, collect the fermentation broth and centrifuge (8000 rpm, 10 min), and take the supernatant for enzyme activity determination. Use a plant neutral phosphatase (NLP) enzyme-linked immunosorbent assay kit to determine the neutral phosphatase activity.
[0092] As Figure 6 shows the neutral phosphatase production of the Penicillium oxalicum strain and CK. The neutral phosphatase production of Penicillium oxalicum JM-C14-2 is significantly higher than that of the control group. The neutral phosphatase production of Penicillium oxalicum JM-C14-2 is 91.51 ng / L, while that of the control group is 38.41 ng / L, indicating that the Penicillium oxalicum strain has a strong ability to produce neutral phosphatase, which is an indication of the phosphorus-solubilizing ability of Penicillium oxalicum.
[0093] Example 5: Analysis of the Characteristics of Penicillium oxalicum in Decomposing Soil Organic Matter
[0094] 1. Identification of the Cellulose-Degrading Ability of Penicillium oxalicum
[0095] Prepare carboxymethyl cellulose sodium medium: 10 g of peptone, 10 g of yeast powder, 10 g of carboxymethyl cellulose sodium, 5 g of sodium chloride, 1 g of potassium dihydrogen phosphate, 15 g of agar powder, dissolve in 1000 ml of distilled water, and sterilize at 121 °C under high pressure for 20 min.
[0096] In a laminar flow hood, inoculate the purified Penicillium oxalicum JM-C14-2 into the cellulase medium and culture it at 28 °C for 3 - 5 days. Regularly observe and record the colony diameter, color, edge characteristics, and surface structure. If a clear hydrolysis zone forms around the colony, it indicates that the cellulase secreted by the strain has the ability to degrade the cellulose substrate.
[0097] As Figure 7 shown, it can be clearly seen the hydrolysis zone in the petri dish, and the colonies grow well, so it can be determined that the Penicillium oxalicum JM-C14-2 has the ability to produce cellulase.
[0098] 2. Analysis of the Cellulase Secreted by Penicillium oxalicum
[0099] Using commercially available Bacillus subtilis as the CK, inoculate the purified Penicillium oxalicum and CK into Rose Bengal liquid medium respectively, culture them at 28 °C with shaking at 150 rpm for 3 - 5 days, collect the fermentation broth and centrifuge (4000 rpm, 10 min), take the supernatant for enzyme activity determination. Use a plant cellulase (CE) enzyme-linked immunosorbent assay kit to measure the total amount of cellulase.
[0100] As Figure 8 shows the cellulase production of Penicillium oxalicum JM-C14-2 and CK. The cellulase production of the control group is 26.95 ng / L, and the cellulase production of Penicillium oxalicum JM-C14-2 can reach 83.89 ng / L, which is significantly higher than that of CK. It shows that Penicillium oxalicum JM-C14-2 has an obvious ability to produce cellulase and plays an important role in decomposing and transforming soil organic matter.
[0101] Example 6: Characteristics of Organic Acid Secretion by Penicillium oxalicum
[0102] Prepare Czapek liquid medium: 5 g of peptone, 10 g of glucose, 1.0 g of potassium dihydrogen phosphate, 0.5 g of magnesium sulfate (anhydrous), 3.3 ml of Rose Bengal (concentration 10 g / L), dissolve in 11 distilled water, and add 0.1 g / streptomycin and 3.3 ml to each liter of medium before use.
[0103] 2. Strain Cultivation:
[0104] Dispense the above-prepared liquid medium into 250 mL conical flasks, 100 mL per flask, and autoclave at 121 °C for 20 minutes. Cool to room temperature. Under aseptic conditions, dip a small amount of Penicillium oxalicum mycelium with an inoculation loop and inoculate it into the liquid medium. Place the inoculated conical flask in a constant temperature shaker, set the temperature to 28 °C, the rotation speed to 150 rpm, and culture for 3 - 5 days.
[0105] 3. Determination of Oxalic Acid Produced by the Strain
[0106] After the cultivation is completed, take 10 mL of the culture solution, centrifuge (3000 rpm, 10 minutes) to remove the bacteria, take 5 mL of the supernatant and place it in a 100 mL conical flask, add 10 mL of 1:1 sulfuric acid solution, heat the conical flask on an electric furnace to 70 - 80 °C to promote the reaction between oxalic acid and potassium permanganate. Titrate with 0.02 mol / L potassium permanganate standard solution while it is hot. Initially, add the solution drop by drop slowly. After the purple-red color fades, continue titrating until the solution turns slightly red and does not fade within 30 seconds. Record the volume of potassium permanganate consumed (V1). At the same time, set a blank control, replace the supernatant with distilled water, repeat the above steps, and record the volume of potassium permanganate consumed (V0).
[0107] The calculation formula for oxalic acid content is:
[0108]
[0109] Parameter Description:
[0110] V1: Volume of potassium permanganate standard solution consumed in the sample titration (mL)
[0111] V0: Volume of potassium permanganate standard solution consumed in the blank test (mL)
[0112] C: Concentration of potassium permanganate standard solution (mol / L)
[0113] 90.03: Molar mass of oxalic acid (g / mol)
[0114] V: Sample volume (mL)
[0115] 4. Analysis of Oxalic Acid Production and pH Value
[0116] Table 3: Oxalic Acid Production and pH Value
[0117]
[0118] From the data in Table 3, it can be seen that there are significant differences in oxalic acid content and pH value between Penicillium oxalicum JM-C14-2 and the CK treatment group. The oxalic acid content of Penicillium oxalicum is as high as 13.5 g / L, much higher than 6.07 g / L in the CK treatment group, indicating that Penicillium oxalicum JM-C14-2 has a strong ability to synthesize oxalic acid. The pH value of the Penicillium oxalicum strain treatment is 4.41, significantly lower than 7.05 in the CK treatment group, which is related to the synthesis and secretion of a large amount of oxalic acid by Penicillium oxalicum. The oxalic acid secreted by Penicillium oxalicum plays an important role in the dissolution of soil nutrients and the decomposition of organic matter.
[0119] Example 7: Analysis of the salt tolerance characteristics of Penicillium oxalicum
[0120] 7.5% sodium chloride medium: 3.0 g of beef extract, 5.0 g of peptone, 75.0 g of sodium chloride, 15.0 g of agar, 1000 mL of distilled water, pH 7.0, sterilized at 121 °C for 20 min.
[0121] Take the activated Penicillium oxalicum strain and inoculate it onto the saline-alkali plate by the spot inoculation method, and incubate it at 28 °C for 3-5 days to observe the colony growth status. As Fig. 9 shown, Penicillium oxalicum shows a dispersed growth state on the saline-alkali medium, with multiple colonies distributed on the surface of the medium and a large number of colonies, indicating that it has a certain adaptability and growth vitality on the saline-alkali medium. It shows that this Penicillium oxalicum can be used to improve the soil fertility of saline-alkali land.
[0122] Example 8: Antibacterial characteristics of Penicillium oxalicum
[0123] In the ultra-clean workbench, aseptically operate to spot-inoculate the pathogenic bacteria onto the PDA solid medium, and then use a pipette gun to inoculate 3 ml of the 10-fold diluted supernatant of Penicillium oxalicum. Each treatment is set with 3 replicates. Under aseptic conditions, the pathogenic bacteria Fusarium oxysporum is spot-inoculated as the treatment group, and 3 replicates are also set. Incubate in a constant temperature incubator at 28 °C for 3-5 days. Regularly observe and record the growth of colonies in the two treatments.
[0124] As Fig.10 shown, in the treatment group (the left plate), around the inoculation point of Penicillium oxalicum and on the whole plate, the colonies of Penicillium oxalicum can be seen to grow vigorously; the growth of Fusarium oxysporum pathogenic bacteria is significantly inhibited; in the control group (the right plate), the growth of the pathogenic bacteria is not interfered by other strains, and the colonies show a uniform growth state, with a darker color, and the colony diameter is significantly larger than that of the pathogenic bacteria in the treatment group, and the overall coverage area is larger. From Fig.10 it can be seen that Penicillium oxalicum has a significant inhibitory effect on Fusarium oxysporum pathogenic bacteria.
[0125] Example 9: The effect of Penicillium oxalicum on soil fertility
[0126] Take 500 g of soil samples and evenly load them into 1 L plastic cups, ensuring consistent soil compactness. Randomly divide the plastic cups into an experimental group and a control group, with 5 replicates in each group. Add 30 mL of Penicillium oxalicum bacterial liquid (OD 600 = 0.3) to the plastic cups in the experimental group, and then add 180 mL of sterile water; add 210 mL of sterile water of the same amount to the control group to make the soil reach the saturated water holding capacity and ensure that the soil is in a suitable humidity condition. Cover the plastic cups with a layer of film and seal them, and place them in a constant temperature incubator for culturing for 30 days at 25°C and 60%. During the culturing period, regularly weigh and supplement sterile water to maintain a constant soil humidity. After the culturing is completed, use the standard soil agrochemical analysis method to measure the available nitrogen, phosphorus, and potassium contents in the soil.
[0127] Table 4: Soil fertility under different treatments
[0128]
[0129] It can be observed from Table 4 that when Penicillium oxalicum is applied to the soil, compared with CK, it can significantly increase the contents of hydrolyzable nitrogen, available phosphorus, available potassium, and organic matter in the soil. There is no significant difference in pH between the Penicillium oxalicum JM-C14-2 treatment and CK, indicating that Penicillium oxalicum JM-C14-2 can significantly increase the contents of hydrolyzable nitrogen, available phosphorus, available potassium, and organic matter in the soil, promote the decomposition and transformation of nutrients, and has a positive effect on improving soil fertility.
[0130] Example 10: Growth promotion effect of Penicillium oxalicum on tomatoes indoors
[0131] Material preparation: Wash the sand with clear water multiple times and air-dry it, then load it into 500 mL plastic cups. Load 200 g of sand into each cup. Wash all the matrix on the roots of 4-leaf tomato seedlings with consistent growth, and plant them in the sand for a sand culture experiment. The nutrient solution used is Hoagland nutrient solution.
[0132] Inoculation treatment: First, pour 30 mL of nutrient solution into each pot to fully moisten the sand. Then, take 30 mL of the activated strain in each group, dilute it 10 times for standby, and pour 30 mL of the diluted bacterial liquid into each treatment. One of the groups is the control group, which only pours 30 mL of nutrient solution and 30 mL of sterile water. There are 5 replicates in each treatment.
[0133] Growth index determination: After the tomato plants grow for 15 days, use a plant nutrient rapid detector to measure the chlorophyll content and nitrogen content of the leaves. Use a root scanner to measure the root growth status.
[0134] Study the effect of Penicillium oxalicum strains on the growth of tomato seedlings:
[0135] 1. Effects on the growth of tomato roots
[0136] By setting a control group (CK, without adding bacterial solution) and a treatment group (adding bacterial suspension), the research was carried out from two aspects: the comparison of root morphology and the analysis of the scanned data.
[0137] Analysis of root morphology comparison, from Fig.11 and Fig.12 It can be intuitively seen that compared with the control (CK), there are obvious differences in the root morphology of tomato plants treated with the suspension of Penicillium oxalicum JM-C14-2. The tomato roots in the treatment group are more developed, the main root may be longer, and the number of lateral roots is also relatively large, showing a more vigorous growth trend; while the roots in the control group are relatively thin and weak, and the number of lateral roots is small. The morphological differences indicate that Penicillium oxalicum plays a promoting role in the growth and development of tomato roots.
[0138] According to the analysis of the scanned root data, for multiple root indexes, the root index values of the treatment group and the control group (CK) are shown in Table 5.
[0139] Table 5 Scanned data of the roots of potted tomatoes
[0140]
[0141] (1) Total root length: The total root length of the treatment group is 224.14 cm, which is significantly higher than 98.85 cm of the control group, indicating that the application of the Penicillium oxalicum bacterial suspension significantly increases the total length of tomato roots and promotes potted tomatoes to absorb more water and nutrients.
[0142] (2) Total root surface area: The total root surface area of the treatment group is 55.773 cm², which is higher than 28.31 cm² of the control group. A larger root surface area can enhance the contact area between the roots and the soil environment and increase the absorption area of potted tomatoes for nutrients and water.
[0143] (3) Total root projected area: The total root projected area of the treatment group is 17.75 cm², which is higher than 9.01 cm² of the control group, echoing the result of the root surface area and further indicating the advantages of the roots in the treatment group in terms of spatial expansion and absorption function.
[0144] (4) Total volume: The total volume of the treatment group is 1.10 cm³, which is higher than 0.64 cm³ of the control group, indicating that the roots in the treatment group are more sufficient in terms of material accumulation and structural development.
[0145] (5) Average root diameter: The average root diameter of the treatment group is 0.79 mm, slightly lower than 0.91 mm of the control group. This may be because the roots in the treatment group grow more vigorously and a large number of lateral roots grow, resulting in a relatively smaller average diameter, which does not affect its overall absorption function.
[0146] (6) Total number of root tips: The total number of root tips of Penicillium oxalicum is 446, and that of the CK group is 317. The total number of root tips of Penicillium oxalicum is 129 more than that of the CK group. This indicates that compared with the CK group, Penicillium oxalicum may promote the growth of root tips, resulting in an increase in the total number of root tips.
[0147] According to the results of the comparison of tomato root morphology and the analysis of scanning data, the application of Penicillium oxalicum bacterial suspension has a significant promoting effect on the root growth of potted tomatoes, which can increase the root length, surface area, volume, etc., and overall improve the structure and function of tomato roots, helping to enhance the absorption capacity of tomato plants for nutrients and water, and thus having a positive impact on the growth, development, yield and quality of tomatoes.
[0148] 2. Effects of the strain on the nutrients of tomato leaves
[0149] The nutrient content of tomato seedling leaves was measured using a leaf nutrient rapid tester, as Fig.13 and Fig.14 shown.
[0150] As Fig.13 shown, in terms of the chlorophyll SPAD value, the average value of the treatment group (Penicillium oxalicum) is 40.26, which is higher than that of the control (37.30), indicating that the application of the bacterial suspension can increase the chlorophyll content of tomato leaves or enhance photosynthesis; according to Fig.14 The results show that in terms of nitrogen content, the average value of the treatment group is 2.76 mg / kg, which is greater than that of the control (2.56 mg / kg), indicating that Penicillium oxalicum helps tomato leaves accumulate nitrogen, which is beneficial to the growth and metabolism of plants. Penicillium oxalicum has a positive impact on the chlorophyll content and nitrogen accumulation of potted tomato leaves, and can promote plant growth.
[0151] The above embodiments only illustrate the technical solutions of the present invention, rather than limiting it; although the present invention has been described in detail with reference to the foregoing embodiments, for those of ordinary skill in the art, it is still possible to modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions required to be protected by the present invention.
Claims
1. A strain of Penicillium oxalicum JM-C14-2, characterized in that, Its classification name is Penicillium oxalicum , which is preserved in the China Center for Type Culture Collection with the preservation number of CCTCC NO: M 20232615.
2. Use of Penicillium oxalicum JM-C14-2 as claimed in claim 1 in the preparation of a biological agent for promoting the growth of tomatoes.
3. The application according to claim 2, wherein The tomato growth as described above includes nutrient accumulation in tomato leaves and tomato root growth.
4. Use of Penicillium oxalicum JM-C14-2 as claimed in claim 1 in the preparation of a biological agent for inhibiting pathogenic bacteria, characterized in that, The pathogenic bacterium is Fusarium oxysporum f. sp. niveum.
5. Use of Penicillium oxalicum JM-C14-2 according to claim 1 for improving soil nutrients, characterized in that, The nutrients as described above are soil hydrolyzable nitrogen, available phosphorus, available potassium and organic matter.
Citation Information
Patent Citations
Paenibacillus polymyxa NSY50 with capabilities of promoting growth and preventing diseases
CN105734000A
Penicillium oxalicum and application thereof
CN114854600A