Schizochytrium limacinum genetic engineering strain for remodeling FAS pathway, construction method and application

Abstract

The invention discloses a schizochytrium limacinum genetic engineering strain capable of remodeling an FAS (Fibroblast Activated Sequence) pathway as well as a construction method and application thereof. The schizochytrium limacinum gene engineering strain is obtained by heterologous expression of a C16 elongase gene E16, a C18 elongase gene E18, a delta 9 desaturase gene D9, a delta 5 desaturase gene D5, a delta 6 desaturase gene D6 and a delta 15 desaturase gene D15 in a schizochytrium limacinum wild type. The recombinant schizochytrium limacinum described herein is capable of producing EPA comprising 2.08% by total fatty acids while also producing DHA comprising at least more than 41% by total fatty acids. In addition, the invention discloses a method for producing unsaturated fatty acid through a double-path channel of PKS and FAS, which is beneficial to promotion and application of a technology for producing EPA and DHA by schizochytrium limacinum.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and more specifically to a Schizochytrium genetic engineering strain for remodeling the FAS pathway, a construction method and an application thereof. Background Art

[0002] Microbial oils are also called single cell oils (SCOs). Their biosynthetic pathway refers to the process by which microorganisms synthesize oils through metabolic pathways and enzyme-catalyzed reactions. Although the biosynthetic pathways of different microorganisms may vary to some extent, they generally involve four key steps: (1) Substrate supply. The biosynthesis of SCOs usually depends on substrate supply, such as carbon sources such as glucose, glycerol, and cellulose; (2) Fatty acid synthesis. Carbon sources are used to participate in metabolic conversion to Acetyl-CoA, and fatty acid chains are gradually synthesized through the catalytic action of a series of enzymes; (3) Triglyceride synthesis. After synthesis, fatty acid chains are combined with glycerol molecules through enzyme-catalyzed reactions to form triacylglycerol (TAG); (4) Oil accumulation. Microorganisms accumulate large amounts of oils to store energy and adapt to environmental changes. It is worth noting that because different organisms have different metabolic pathways and regulatory mechanisms, the biosynthetic pathways of oils may vary to some extent. For example, yeast synthesizes lipids through the fatty acid synthase (FAS) pathway of yeast cells; at the same time, some marine microorganisms such as microalgae, deep-sea bacteria and marine fungi synthesize lipids through the polyketide synthase (PKS) pathway (Jia et al., 2023).

[0003] Eicosapentaenoic acid (EPA), known as the "blood vessel scavenger", is an ω-3 polyunsaturated fatty acid that is essential to human health. It has physiological functions such as preventing cardiovascular diseases, regulating blood lipids, preventing Alzheimer's disease, anti-inflammatory, and anti-cancer, and is widely used in food, medicine, feed and other industries. The traditional source of EPA is deep-sea fish oil, but due to factors such as overfishing and environmental pollution, the production of fish oil has been declining year by year and cannot meet the market demand for EPA. Seeking green and sustainable production methods is a key issue that needs to be solved urgently. The production of EPA by microbial (fungi, microalgae, bacteria) fermentation has become the main alternative source for EPA production. However, the common microbial fermentation cycle of EPA is long and requires specific culture conditions such as low temperature, high pressure, and light to accumulate a large amount of EPA, which greatly limits the industrial production of EPA.

[0004] Schizochytrium is a marine heterotrophic microorganism with the advantages of fast growth rate, high production of polyunsaturated fatty acids (PUFAs), and few by-products, making it a candidate strain for EPA production. At present, research on the production of EPA by Schizochytrium mainly focuses on the engineering modification of the PKS pathway and the optimization of fermentation engineering. For example, patent CN119120230A replaces the key catalytic domain in the PKS pathway of Schizochytrium with the corresponding functional domain in the heterologous EPA-type PKS pathway to obtain a genetically engineered strain that can improve the proportion of EPA; patent CN119081889A effectively increases the production of EPA in Schizochytrium by adding exogenous factors-gingerol; patent CN116179584A significantly increases EPA accumulation by overexpressing genes AT, KS or AT-KS in the MetE-like domain in the wild type of Schizochytrium. However, it is worth noting that compared with other oil-producing microorganisms, Schizochytrium has abundant precursor supply (NADPH and acetyl-CoA) and substrate support (the proportion of palmitic acid can reach more than 20% of the total fatty acids). However, due to the incompleteness of the endogenous FAS pathway, it is difficult to achieve the synthesis of unsaturated fatty acids based on the FAS pathway. Summary of the invention

[0005] One object of the present invention is to provide a genetically engineered Schizochytrium strain that reshapes the FAS pathway, so that the genetically engineered Schizochytrium strain can biosynthesize EPA using the FAS pathway.

[0006] In order to achieve these objects and other advantages according to the present invention, there is provided a Schizochytrium genetically engineered strain for remodeling the FAS pathway, wherein the Schizochytrium genetically engineered strain is obtained by heterologously expressing C16 elongase gene E16, C18 elongase gene E18, Δ9 desaturase gene D9, Δ5 desaturase gene D5, Δ6 desaturase gene D6, and Δ15 desaturase gene D15 in a wild type of Schizochytrium; The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 1; The nucleotide sequence of the C18 elongase gene E18 is SEQ ID NO: 2; The nucleotide sequence of the Δ9 desaturase gene D9 is SEQ ID NO: 3; The nucleotide sequence of the Δ5 desaturase gene D5 is SEQ ID NO: 4; The nucleotide sequence of the Δ6 desaturase gene D6 is SEQ ID NO: 5; The nucleotide sequence of the Δ15 desaturase gene D15 is SEQ ID NO:6.

[0007] Preferably, the wild type of Schizochytrium is Aurantiochytrium limacinum SR21.

[0008] Preferably, the C16 elongase gene E16 is from Mortierella alpina , C18 elongase gene E18 from Euglena gracilis , Δ9 desaturase gene D9 from Parietichytrium sp. , Δ5 desaturase gene D5 from Thraustochytrium sp. , Δ6 desaturase gene D6 from Pythium aphanidermatum , Δ15 desaturase gene D15 from Pythium aphanidermatum .

[0009] The present invention also provides the use of the Schizochytrium genetic engineering strain in producing EPA.

[0010] The present invention also provides a method for constructing the above-mentioned Schizochytrium engineering strain, comprising the following steps: S1, using plasmid pC322-GFP as a backbone, inserting C16 elongase gene E16 into the backbone to obtain recombinant plasmid pCA322-E16; S2, using the recombinant plasmid pCA322-E16 as a backbone, inserting the Δ9 desaturase gene D9 into the backbone to obtain the recombinant plasmid pCA322-E16-D9; S3, using the recombinant plasmid pCA322-E16-D9 as a skeleton, inserting the C18 elongase gene E18 into the skeleton to obtain the recombinant plasmid pCA322-E16-E18-D9; S4, removing the Δ9 desaturase gene D9 on the recombinant plasmid pCA322-E16-E18-D9 to obtain the recombinant plasmid pCA322-E16-E18, and then fusing the Δ9 desaturase gene D9, the Δ5 desaturase gene D5, the Δ6 desaturase gene D6 and the Δ15 desaturase gene D15 to obtain fragment 1, and inserting the fragment 1 into the recombinant plasmid pCA322-E16-E18 to obtain the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15; S5. The recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 was transformed into Agrobacterium AGL-1 to obtain positive transformants, which were then used to infect the wild type of Schizochytrium to obtain a genetically engineered strain of Schizochytrium.

[0011] Preferably, the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 further comprises an endogenous promoter PA, an endogenous terminator CYC, and a connecting peptide E2A connecting the C16 elongase gene E16 and the C18 elongase gene E18.

[0012] Preferably, the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 further comprises an endogenous promoter PATP, an endogenous terminator TA, and a connecting peptide P2A connecting the Δ9 desaturase gene D9, the Δ5 desaturase gene D5, the Δ6 desaturase gene D6, and the Δ15 desaturase gene D15.

[0013] The present invention also provides a method for producing EPA by fermentation using the above-mentioned Schizochytrium genetically engineered strain, comprising the following steps: A. Spread the engineered strain of Schizochytrium on a solid plate medium and culture it at a temperature of 20-30°C for 12-96 hours; B. Select a single colony and inoculate it into the secondary seed liquid culture medium. Incubate it at 20-30°C and 160-220 rpm in a shaking incubator for 12-96 hours to obtain a liquid seed solution. C. Inoculate the liquid seed solution into the fermentation medium at a ratio of 1% to 10%, culture at a temperature of 20 to 30°C and at a shaking table at 160 to 220 rpm for 12 to 120 hours, and collect the bacteria after the culture is completed; The composition of the solid plate medium is as follows: 30 g / L glucose, 8 g / L yeast powder, 20 g / L sea crystal, 20 g / L agar powder, and the pH is adjusted to 6.5; The composition of the secondary seed liquid medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, pH adjusted to 6.5; The composition of the fermentation broth medium is: glucose 80 g / L, yeast powder 5 g / L, NaCl 0.3 g / L, K2SO4 1 g / L, KH2PO4 0.1 g / L, MgSO4·7H2O 4 g / L, CaCl2 0.05 g / L, and the pH is adjusted to 6.5.

[0014] The present invention includes at least the following beneficial effects: the present invention completes the metabolic remodeling of the FAS pathway in Schizochytrium for the first time, and realizes the de novo biosynthesis of FAS-derived EPA. The heterologously assembled FAS pathway is conducive to promoting the joint production of EPA and DHA in Schizochytrium, and increases the production of PUFA through the bifunctional pathway of PKS and FAS. The recombinant Schizochytrium described in the present invention can produce EPA containing 2.08% of total fatty acids through the FAS pathway, and can also produce docosahexaenoic acid (DHA) containing at least more than 41% of total fatty acids.

[0015] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1A is the gas chromatogram of the wild type of Schizochytrium; Figure 1B is the gas chromatogram of Schizochytrium pC322-E16 transformant; Figure 2 is a gas chromatogram of the Schizochytrium pC322-E16-D9 transformant; Figure 3 This is a comparison chart of the fermentation results of related transformants during the metabolic remodeling of the FAS pathway of Schizochytrium. DETAILED DESCRIPTION

[0017] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0018] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0019] Example 1: Verification of overexpression of C16 elongase gene for initial activation of FAS pathway The specific method is as follows: 1. Primers 2. Fragment amplification and homologous recombination procedures 3. Experimental methods To obtain transformants, we first digested the existing expression plasmid pC322-GFP in the laboratory with restriction endonuclease ApaI to obtain the basic skeleton. Then, we used primer pairs PA-F / R and CYC-F11 / R11 to extract wild-type Schizochytrium ( Aurantiochytrium limacinum SR21, the sequences of the endogenous promoter PA and terminator CYC were amplified from the DNA genome of Schizochytrium (which has been disclosed in patent CN119307499A), and the codon-optimized C16 elongase gene was obtained by amplification with primer pair E16-F / R. Subsequently, it was connected to the pC322-GFP expression vector containing G418 resistance and enzyme digestion by homologous recombinase. Next, it was transformed with Escherichia coli DH5α and single colonies were selected for PCR verification to verify the positive transformants, thus successfully constructing pCA322-E16. Finally, pCA322-E16 was first transformed into Agrobacterium AGL-1, and the obtained positive transformants were then used for Schizochytrium infection. The specific method of infection was referred to the previous patent CN119307499A of this laboratory.

[0020] Fermentation verification of transformants. First, the Schizochytrium pCA322-E16 transformants were spread on seed solid plate medium (temperature 28°C, culture time 48h). Then, single colonies were selected and inoculated into secondary seed liquid medium for culture (temperature 28°C, 200rpm, culture time 48h) to obtain liquid seed liquid. Then, the liquid seed liquid was inoculated into fermentation liquid medium at an inoculation rate of 1% to 10% for culture (temperature 28°C, 220rpm, culture time 120h). Finally, the cells after the culture was collected, and the fatty acid composition of lipids was determined by gas chromatography (GC-2010, Shimadzu, Japan), which was equipped with sp-2560 column (100 m×0.25 mm×0.20 μm, Supelco, USA) and flame ionization detector, and then converted into fatty acid methyl esters by improved standard method. The relative content of each component was calculated by chromatographic peak area normalization method.

[0021] Among them, the composition of the solid plate culture medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, agar powder 20 g / L, and the pH is adjusted to 6.5; the composition of the secondary seed liquid culture medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, and the pH is adjusted to 6.5; the composition of the fermentation liquid culture medium is: glucose 80g / L, yeast powder 5g / L, NaCl 0.3g / L, K2SO41g / L, KH2PO40.1g / L, MgSO4·7H2O 4g / L, CaCl20.05g / L, and the pH is adjusted to 6.5.

[0022] The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 1: ATGGAGGTCTGGTCCTATGCCTGCTGGTATCCCTTTCCCTGAGTACTACGACTTCTTCATGGACTGGAAGACCCCTCTCGCTATTGCTGCTACCTACACCGTCGCTGTCGGTCTTCAACCTAAGGTCGGTAAGGTCTCTCGCGTCGTCGCTAAGTCTGCTAACGCTAAGCCTGCTGAGCGCACTCAGTCTGGTGCTGCTATGACC GCTTTCGTCTTCGTCCACAACCTCATCCTCTGCGTCTACTCTGGTATCACCTTCTACCACATGTTCCCTGCTATGGTCAAGAACTTCCGCACCCACACCCTCCACGAGGCTTACTGCGACACCGATCAGTCTCTCTGGAACAACGCTCTCGGTTACTGGGGTTATCTCTTTTACCTCTCTAAGTTCTACGAGGTCATCGACACCATC ATTATCATCCTCAAGGGTCGCCGCTCTTCTCCTTCAGACCTACCACCACGCTGGTGCTATGATCACCATGTGGTCTGGTATCAACTACCAAGCTACCCCTATCTGGATCTTCGTCGTCTTCAACTCTTTCATCCACACCATGTACTGCTACTACGCTTTCACCTCTATCGGTTTCCACCCTCCTGGTAAGAAGTACCTCACC TCTATGCAGATCACTCAGTTCCTCGTCGGTATCACCATCGCTGTCTCTTACCTCTTCGTCCCTGGTTGCATCCGCACCCCTGGTGCTCAGATGGCTGTCTGGATCAACGTCGGTTACCTCTTCCCTCTTACCTAACCTCTCGTTGATTTTGCTAAGCGCACCTACTCTAAGCGCACCGCTATCGCTGCTCAAAAAAAGGCTCAGTAG 4. Results In order to verify that the FAS pathway of Schizochytrium was initially activated, this example used the wild type of Schizochytrium ( Aurantiochytrium limacinum SR21) for control test, the test results are as follows Figure 1A~1B As shown, Figure 1A is the gas chromatogram of the wild type of Schizochytrium; Figure 1BThis is the gas chromatogram of the Schizochytrium pCA322-E16 transformant.

[0023] according to Figure 1A~1B The results showed that the wild type of Schizochytrium can synthesize 43.71% palmitic acid (C16:0) without the appearance of stearic acid (C18:0) and its derivatives. This provides a good metabolic precursor for the heterologous recombination of the FAS pathway. After overexpressing the C16 elongase gene (which converts palmitic acid into stearic acid), the palmitic acid content of the transformant pCA322-E16 decreased, and 7.33% stearic acid appeared. This shows that in Schizochytrium, after the introduction of the C16 elongase, palmitic acid was converted into stearic acid. The FAS pathway was initially activated.

[0024] Example 2: Validation of the Co-expression of C16 Elongase Gene and D9 Desaturase Gene to Stimulate the Derivatives of FAS Pathway The specific method is as follows: 1. Primers 2. Fragment amplification and homologous recombination procedures 3. Experimental methods To obtain transformants, we first digested the existing expression plasmid pCA322-E16 in the laboratory with restriction endonuclease SgsI to obtain the basic skeleton. Then, we used primer pairs PATP-F / R and TA-F / R to extract wild-type Schizochytrium ( Aurantiochytrium limacinum The sequences of the endogenous promoter PATP and terminator TA were amplified from the DNA genome of SR21, and the codon-optimized Δ9 desaturase gene D9 was obtained by amplification with primer pair D9-F / R. Subsequently, it was connected to the pCA322-E16 expression vector containing G418 resistance and restriction digestion by homologous recombinase. Next, it was transformed with Escherichia coli DH5α and single colonies were selected for PCR verification to verify the positive transformants, thus successfully constructing pCA322-E16-D9. Finally, pCA322-E16-D9 was first transformed into Agrobacterium AGL-1, and the obtained positive transformants were then used for Schizochytrium infection. The specific method is shown in Example 1.

[0025] For the fermentation verification of the transformants, the method is as in Example 1.

[0026] The nucleotide sequence of the Δ9 desaturase gene D9 is SEQ ID NO: 3: The nucleotide sequence of PATP is SEQ ID NO: 7: 4. Results The experimental results are as follows Figure 2 As shown. By co-expressing the C16 elongase gene E16 and the Δ9 desaturase gene D9, it is expected that stearic acid will be converted to oleic acid. However, unexpectedly, both a very small amount of oleic acid (C18:1) and 3.40% linoleic acid (C18:2) appeared in the fatty acid profile. Therefore, we speculate that the wild type of Schizochytrium ( Aurantiochytrium limacinum SR21), there is an endogenous Δ12 desaturase that can catalyze the further conversion of oleic acid that should have been produced into linoleic acid.

[0027] Example 3: Validation of dual-module co-expression of complete heterologous FAS pathway genes for FAS pathway metabolic remodeling The specific method is as follows: 1. Primers 2. Fragment amplification and homologous recombination procedures 3. Experimental methods Transformants for FAS pathway remodeling were obtained, which were mainly divided into two expression cassette modules for the complete expression of FAS pathway. First, the existing expression plasmid pCA322-E16-D9 in the laboratory was digested with restriction endonuclease SgsI to obtain the basic skeleton. Secondly, for the elongase gene, A) primer pair PA-F / R, CYC-F11 / R11 was used to extract the elongase gene from Schizochytrium ( A. limacinum SR21) to amplify the sequences of the endogenous promoter PA and terminator CYC; B) to amplify the codon-optimized C18 elongase gene E18 using primer pair E18-F / R; C) to connect the C18 elongase gene E18 with the C16 elongase gene E16 using E2A through a fragment fusion strategy, thereby obtaining the recombinant plasmid pCA322-E16-E18-D9.

[0028] Subsequently, for the desaturase gene, the recombinant plasmid pCA322-E16-E18-D9 was first digested with restriction endonuclease Kpn2I to remove the D9 fragment and obtain the recombinant backbone. Then A) the primer pair PATP-F / R and TA-F / R were used to isolate the desaturase gene from Schizochytrium ( A. limacinumSR21) to amplify the sequences of the endogenous promoter PATP and terminator TA. B) The codon-optimized Δ5 desaturase gene (D5) was amplified using primer pair D5-F / R; the codon-optimized Δ6 desaturase gene (D6) was amplified using primer pair D6-F / R; the codon-optimized Δ15 desaturase gene (D15) was amplified using primer pair D15-F / R. C) Through the fragment fusion strategy, D5, D6, D15 and D9 were connected using P2A, thus becoming fragment 1. Finally, the promoter PATP, fragment 1 and terminator TA were connected to the G418-resistant and enzyme-digested plasmid pCA322-E16-E18 using homologous recombinase. Next, it was transformed with E. coli DH5α and single colonies were selected for PCR verification to verify the positive transformants. Thus, pCA322-E16-E18-D9-D5-D6-D15 was successfully constructed. Finally, pCA322-E16-E18-D9-D5-D6-D15 was first transformed into Agrobacterium AGL-1, and the obtained positive transformants were then used for Schizochytrium infection. The specific method is shown in Example 1.

[0029] Fermentation verification of transformants: The method is as in Example 1.

[0030] The nucleotide sequence of the C18 elongase gene E18 is SEQ ID NO: 2: ATGGAGGTCGTCAACGAGATCGTCTCTATCGGTCAAGAGGTCCTCCCTAAGGTCGACTACGCTCAGCTCTGGTCTGACGCTTCTCACTGCGAGGTCCTCTACGGTTCTATCGCTTTCGTCATCCTCAAGTTCACCCTCGGTCCTCTCGGTCCTAAGGGTCAGTCTCGCATGAAGTTCGTCTTCACCAACTACAATCTCCTCATGTCTATCTACTCTCTCGGTTCTTTCCTCTCTATGGCTTACGCTATGTACACCATCGGTGTCATGTCTGACAACTGCGAGAAGGCTTTCGACAACAACGTCTTCCGCATCACCACTCAGCTCTTCTACCTCTCTAAGTTCCTCGAGTACATCGACTCTTTCTACCTCCCTCTCATGGGTAAGCCTCTCACCTGGCTTCAGTTCTTCCACCACCTCGGTGCTCCTATGGACATGTGGCTCTTCTACAACTACCGCAACGAGGCTGTCTGGATCTTCGTCCTCCTCAACGGTTTCATCCACTGGATCATGTACGGTTACTACTGGACCCGCCTCATCAAGCTCAAGTTCCCTATGCCTAAGTCTCTCATCACCTCTATGCAGATCATTCAGTTCAACGTCGGTTTCTACATCGTCTGGAAGTACCGCAACATCCCTTGCTACCGCCAAGACGGTATGCGCATGTTCGGTTGGTTCTTCAACTACTTCTACGTCGGTACCGTCCTCTGCCTCTTCCTCAACTTCTACGTTCAGACCTACATCGTCCGCAAGCACAAGGGTGCTAAGAAGATTCAGTAG The nucleotide sequence of the Δ5 desaturase gene D5 is SEQ ID NO: 4: The nucleotide sequence of the Δ6 desaturase gene D6 is SEQ ID NO: 5: The nucleotide sequence of the Δ15 desaturase gene D15 is SEQ ID NO: 6: The amino acid sequence of E2A is SEQ ID NO: 8 GSGQTCNYALLKLAGDVESNPGP The amino acid sequence of P2A is SEQ ID NO: 9 GSGATNFSLLKQAGDVEENPGP 4. Results The present invention simultaneously overexpresses C16 elongase and C18 elongase, Δ9 desaturase, Δ5 desaturase, Δ6 desaturase and Δ15 desaturase through two strong promoter expression boxes (one connected by E2A is responsible for the extension of the fatty acid chain, and the other connected by P2A is responsible for the desaturation of the fatty acid chain). The results show that the proportion of palmitic acid and stearic acid and their fatty acid derivatives in the fatty acid profile has decreased significantly, and 2.08% EPA has appeared. It can be seen that the present invention has completed the metabolic remodeling of the FAS pathway in Schizochytrium for the first time, and achieved the de novo biosynthesis of FAS-derived EPA.

[0031] The results of Example 1, Example 2 and Example 3 are comprehensively counted. Figure 3 It can be seen that the heterologously assembled FAS pathway is beneficial to promote the joint production of EPA and DHA in Schizochytrium, and increases the production of PUFA through the bifunctional pathway of PKS and FAS. The recombinant Schizochytrium described in the present invention can produce EPA containing 2.08% of total fatty acids through the FAS pathway, and can also produce docosahexaenoic acid (DHA) containing at least more than 41% of total fatty acids.

[0032] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A genetically engineered strain of Schizochytrium for remodeling the FAS pathway, characterized in that: The Schizochytrium genetically engineered strain is obtained by heterologously expressing C16 elongase gene E16, C18 elongase gene E18, Δ9 desaturase gene D9, Δ5 desaturase gene D5, Δ6 desaturase gene D6, and Δ15 desaturase gene D15 in a wild type of Schizochytrium; The nucleotide sequence of the C16 elongase gene E16 is SEQ ID NO: 1; The nucleotide sequence of the C18 elongase gene E18 is SEQ ID NO: 2; The nucleotide sequence of the Δ9 desaturase gene D9 is SEQ ID NO: 3; The nucleotide sequence of the Δ5 desaturase gene D5 is SEQ ID NO: 4; The nucleotide sequence of the Δ6 desaturase gene D6 is SEQ ID NO: 5; The nucleotide sequence of the Δ15 desaturase gene D15 is SEQ ID NO:

6.

2. The genetically engineered strain of Schizochytrium according to claim 1, characterized in that The wild type of Schizochytrium Aurantiochytrium limacinum SR21.

3. The genetically engineered strain of Schizochytrium according to claim 1, characterized in that C16 elongase gene E16 from Mortierella alpina , C18 elongase gene E18 from Euglena gracilis , Δ9 desaturase gene D9 from Parietichytrium sp. , Δ5 desaturase gene D5 from Thraustochytrium sp. , Δ6 desaturase gene D6 from Pythium aphanidermatum , Δ15 desaturase gene D15 from Pythium aphanidermatum .

4. Use of the genetically engineered Schizochytrium strain according to any one of claims 1 to 3 in the production of EPA.

5. A method for constructing an engineered strain of Schizochytrium, characterized in that: The steps include: S1, using plasmid pC322-GFP as a backbone, inserting C16 elongase gene E16 into the backbone to obtain recombinant plasmid pCA322-E16; S2, using the recombinant plasmid pCA322-E16 as a backbone, inserting the Δ9 desaturase gene D9 into the backbone to obtain the recombinant plasmid pCA322-E16-D9; S3, using the recombinant plasmid pCA322-E16-D9 as a skeleton, inserting the C18 elongase gene E18 into the skeleton to obtain the recombinant plasmid pCA322-E16-E18-D9; S4, removing the Δ9 desaturase gene D9 on the recombinant plasmid pCA322-E16-E18-D9 to obtain the recombinant plasmid pCA322-E16-E18, and then fusing the Δ9 desaturase gene D9, the Δ5 desaturase gene D5, the Δ6 desaturase gene D6 and the Δ15 desaturase gene D15 to obtain fragment 1, and inserting the fragment 1 into the recombinant plasmid pCA322-E16-E18 to obtain the recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15; S5. The recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 was transformed into Agrobacterium AGL-1 to obtain positive transformants, which were then used to infect the wild type of Schizochytrium to obtain a genetically engineered strain of Schizochytrium.

6. The method for constructing an engineered strain of Schizochytrium according to claim 5, characterized in that: The recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 also contains a connecting peptide E2A connecting the C16 elongase gene E16 and the C18 elongase gene E18.

7. The method for constructing an engineered strain of Schizochytrium according to claim 5, characterized in that: The recombinant plasmid pCA322-E16-E18-D9-D5-D6-D15 also contains the endogenous promoter PATP, the endogenous terminator TA, and the connecting peptide P2A connecting the Δ9 desaturase gene D9, the Δ5 desaturase gene D5, the Δ6 desaturase gene D6, and the Δ15 desaturase gene D15.

8. The method for producing EPA by fermentation using a genetically engineered strain of Schizochytrium according to any one of claims 1 to 3, characterized in that: The following steps are involved: A. Spread the engineered strain of Schizochytrium on a solid plate medium and culture it at 20-30°C for 12-96 h. B. Select a single colony and inoculate it into the secondary seed liquid culture medium. Incubate it at 20-30°C and 160-220 rpm in a shaking incubator for 12-96 hours to obtain a liquid seed solution. C. Inoculate the liquid seed solution into the fermentation medium at a ratio of 1% to 10%, culture at a temperature of 20 to 30°C and at a shaking table at 160 to 220 rpm for 12 to 120 hours, and collect the bacteria after the culture is completed; The composition of the solid plate medium is as follows: 30 g / L glucose, 8 g / L yeast powder, 20 g / L sea crystal, 20 g / L agar powder, and the pH is adjusted to 6.5; The composition of the secondary seed liquid medium is: glucose 30 g / L, yeast powder 8 g / L, sea crystal 20 g / L, pH adjusted to 6.5; The composition of the fermentation medium was: glucose 80 g / L, yeast powder 5 g / L, NaCl 0.3 g / L, K2SO4 1 g / L, KH2PO4 0.1 g / L, MgSO4·7H2O 4 g / L, CaCl2 0.05 g / L, and the pH was adjusted to 6.5.

Images