Microbial composition and application thereof in sugar-free milk beer

Abstract

The invention provides a microbial composition and application thereof in sugar-free milk beer, and relates to the technical field of microorganisms. The microbial composition comprises leuconostoc mesenteroides, leuconostoc mesenteroides subsp. Mesenteroides, kluyveromyces marxianus and saccharomyces cerevisiae, the bacteria are preserved in the China General Microbiological Culture Collection Center, and 16SrRNA (Ribonucleic Acid) sequences of the bacteria respectively comprise SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. The invention further discloses a preparation method of the microbial composition. According to the method, multi-strain coupling one-step fermentation is adopted, the fermentation process is simple and convenient, the efficiency is high, the fermentation effect is good (a food additive CO2 does not need to be blended and added when the sugar-free milk beer product is prepared), and the method has wide application prospects in sugar-free food.

Description

Technical Field

[0001] The invention belongs to the field of microbial technology application, and particularly relates to a microbial composition and application of the microbial composition in sugar-free milk beer. Background Art

[0002] As people's living standards improve and their health awareness increases, the health problems caused by high-sugar foods have gradually attracted attention, and the development of low-sugar (sugar-free) foods has become a trend. China's "Food Nutrition Label Management Standards" stipulates that products with a total sugar content of ≤ 0.5% can be advertised as sugar-free. Sugar-free products are the most ideal for diabetics and people who strictly control their sugar content.

[0003] Milk beer is a fermented milk beverage made from raw milk and / or dairy products (milk powder, whey powder) as the main raw materials, supplemented with water, white sugar, food additives and other auxiliary materials, and fermented by lactic acid bacteria and yeast. In addition to organic acids, peptides, amino acids and other nutrients, it also contains carbon dioxide and trace alcohol (less than 0.5%). Milk beer has a moderate sweet and sour taste, is crisp and refreshing, has a delicate texture, is full of flavor, and has a slight taste. It is a healthy and nutritious new fermented dairy product. The main function of white sugar in milk beer ingredients is to meet the flavor of milk beer and the growth and metabolism requirements of yeast that cannot utilize lactose. It is not an irreplaceable nutrient. With the continuous improvement of milk beer production technology and the research and screening of fermentation strains, it is found that the combination of yeast that ferments high lactose and lactic acid bacteria that produce carbon dioxide does not need to add white sugar. The raw camel milk and patented strains are coupled to realize camel milk beer products. The carbon dioxide produced by the fermentation of lactose in milk meets the total sugar content of the product below 0.5% and the alcohol content below 0.5%, meeting the quality standards and flavor requirements of sugar-free and alcohol-free milk beverages. For example, a method for brewing milk beer is disclosed in a Chinese patent application with publication number CN1450157A, which uses special yeast to brew milk beer through secondary fermentation. However, the technical process is complicated and cumbersome, and sugar needs to be added for fermentation, so there is room for further optimization.

[0004] Camel milk is a high-quality milk with high nutritional value and good for health. Studies have shown that it contains a variety of nutrients, which can assist in the treatment of hypertension, diabetes, immunity, and delay kidney and liver damage. It occupies an important position in animal dairy products. At present, the main forms of related products are solid camel milk powder such as whole camel milk powder, formula camel milk powder and pure white dairy products. There is currently a blank in the domestic and foreign markets for industrial fermented camel milk and its beverages. The main reason is the lack of fermentation bacteria and the unclear production process needs to be explored. A Chinese patent application with publication number CN 118389315A discloses a microbial composition that can improve the flavor of camel milk products, but it has not been applied in industrial production. The process of industrial fermentation of camel milk needs to be further developed. Summary of the invention

[0005] The present invention uses a combination of high-fermentation lactose strains for the first time to break through the technical bottleneck in the development and production of sugar-free dairy beverages, aiming to develop a sugar-free camel milk beer beverage that can meet the needs of more consumers who like camel milk products, and is of great significance for expanding the microbial resources and utilization methods in Xinjiang and developing new specialty fermented dairy products.

[0006] In order to overcome the deficiencies in the prior art, the present invention provides a microbial composition and its application in sugar-free milk beer. The present invention develops a microbial composition based on camel milk fermentation, and finds that it can also be used in the preparation of other milk-derived sugar-free foods, which not only develops new technologies, but also expands the scope of application of new technologies.

[0007] The technical solutions to achieve the above objectives include the following:

[0008] One of the purposes of the present invention is to provide a microbial composition, which includes any two of four microorganisms, the four microorganisms are Leuconostoc mesenteroides, Leuconostoc mesenteroides subsp. mesenteroides, Kluyveromyces marxianus and Saccharomyces cerevisiae, and the Saccharomyces cerevisiae is a newly screened strain of the present invention.

[0009] Optionally, the microbial composition is a lactic acid bacteria composition, and the lactic acid bacteria composition includes Leuconostoc mesenteroides and Leuconostoc mesenteroides subsp. mesenteroides.

[0010] Optionally, the microbial composition is a yeast composition, and the yeast composition includes Kluyveromyces marxianus and Saccharomyces cerevisiae.

[0011] Optionally, the microbial composition comprises the aforementioned lactic acid bacteria composition and yeast composition, that is, the microbial composition comprises Leuconostoc mesenteroides, Leuconostoc mesenteroides subsp. mesenteroides, Kluyveromyces marxianus and Saccharomyces cerevisiae.

[0012] In one embodiment, the mixing ratio of the yeast composition and the lactic acid bacteria composition is 1:1 or 1.5:1.

[0013] Specifically, the nucleotide sequence of the 16S rRNA of the Enterobacter mesenteroides is shown as SEQ ID NO.1; the nucleotide sequence of the 16S rRNA of the Enterobacter mesenteroides subspecies is shown as SEQ ID NO.2; the nucleotide sequence of the 16S rRNA of the Kluyveromyces marxianus is shown as SEQ ID NO.3; and the nucleotide sequence of the 16S rRNA of the Saccharomyces cerevisiae is shown as SEQ ID NO.4.

[0014] SEQ ID NO.1:

[0015]

[0016] SEQ ID NO.2:

[0017]

[0018] SEQ ID NO.3:

[0019] CTGTATTCCCACGGGCTATAACACTCTACCGAAGCAGAGCCACATTCCCGAGGATTTATCCAACCGCTAAAACTGATGCTGGCCCAGCGAAAGCCGAAGCAAACGCCATGTCTGATCAAATGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAAGCACTTTACAAATAACTGGGATCCTCGCCACACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAGACAAGGACCAGCTACAAAGTCGCCTTCTTCAAATTACAACTCGGACGTCGAAGACGCCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTACTCCTACCTGATTTGAGGTCAAACTTTGAGAGTTTTGGTTAAAGCCGTATGCCTCAAGGAGACAAACACCAGCGAGTCTTTATAACACCTATGAGTCTCTATGACCCAAGCTTACCACGAATTGGCGCAAACCTAAGACGTAGATGTGCAAGAGTCGAGTCCATAGACTTGACACGCAGCCCTGCTCACGCAGATGGCAACGGCTAGCCACTTTCAAGTTAACCCGAGACGAGTATCACTCACTACCAAACCCAAAGGTTTGAGAGAG。

[0020] SEQ ID NO.4:

[0021] .

[0022] The Leuconostoc mesenteroides is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC), and its deposit number is CGMCC No.20805;

[0023] The cell morphology and physicochemical test results of the intestinal leuconostoc are as follows:

[0024] Table 1 Cell morphology and physicochemical test results of Leuconostoc mesenteroides

[0025]

[0026]

[0027] Blank fields in the table indicate no results.

[0028] The Leuconostoc mesenteroides subspecies mesenteroides is deposited in the China General Microbiological Culture Collection Center (CGMCC), and its deposit number is CGMCC No.20802.

[0029] The cell morphology and physicochemical test results of the Leuconostoc mesenteroides subspecies are as follows:

[0030] Table 2 Cell morphology and physicochemical test results of Leuconostoc mesenteroides subsp. mesenteroides

[0031]

[0032]

[0033] The Kluyveromyces marxianus is deposited in the General Microbiological Center of China Microorganism Culture Collection Administration (CGMCC), and its deposit number is CGMCC No.19778.

[0034] The cell size of the Kluyveromyces marxianus is (3.5-5.5)×(4.5-6.8) μm, and the cell shape is elliptical, oval and nearly spherical. The colony is cheese-like, milky yellow, raised, smooth, shiny and has neat edges. The results of the physical and chemical experiments are as follows:

[0035] Table 3 Physical and chemical test results of Kluyveromyces marxianus

[0036]

[0037] Blank fields in the table indicate no results.

[0038] The saccharomyces cerevisiae is deposited in the China General Microbiological Culture Collection Center (CGMCC), and its deposit number is CGMCC No.19773.

[0039] The cell size of the brewer's yeast is (3.5-6.0)×(5.0-7.0) μm, and the cell shape is oval and oblong. The colony is cheese-like, creamy yellow, raised, smooth, shiny, and has neat edges. The physical and chemical test results are as follows:

[0040] Table 4 Physical and chemical test results of Saccharomyces cerevisiae

[0041]

[0042] In another aspect, the present invention provides a culture medium for culturing any one or more microorganisms in the aforementioned microbial composition, wherein the culture medium comprises raw milk powder, sugar and citric acid.

[0043] Specifically, the culture medium preparation method comprises: preparing raw camel milk, galactose and 5% citric acid solution at a ratio of 90:1:9, adjusting the pH to 4.3-4.6, and sterilizing at (115°C, 15min) or (90-95°C, 30min) before use.

[0044] In another aspect, the present invention provides a microbial agent, which comprises any one or more microorganisms in the aforementioned microbial composition.

[0045] Specifically, the bacterial agent preparation method comprises the following steps:

[0046] (1) Cultivate the yeast composition and the lactic acid bacteria composition until the number of viable bacteria reaches 5.0×10 8 -1.0×10 9 CFU / mL, expand the culture according to 3-5% inoculum;

[0047] (2) The cultured bacterial solution is centrifuged at 0-4°C, concentrated, and washed with sterile distilled water, then embedded with a 1:1 ratio of bacterial solution to protective agent, kept at -45°C to -40°C for 1 hour, and sublimated to 32-35°C for freezing to obtain dry powdered bacterial strains;

[0048] (3) The dry powder of yeast and the dry powder of lactic acid bacteria are mixed in a ratio of 1:1 or 1.5:1 to prepare a mixed bacterial agent.

[0049] Preferably, the protective agent in step (2) comprises 14.5% milk powder, 2% galactose, and 83.5% distilled water.

[0050] Further preferably, the milk powder includes but is not limited to camel milk powder, cow milk powder, goat milk powder or horse milk powder; the milk powder can be whole milk powder or skim milk powder, preferably skim milk powder.

[0051] Preferably, the live bacterial count of the dry powdered bacteria may be 4.0×10 8 -9×10 8 CFU / g.

[0052] In another aspect, the present invention provides use of any one or more microorganisms in the aforementioned microbial composition in sugar-free food.

[0053] In another aspect, the present invention provides a method for preparing a sugar-free food, the preparation method comprising fermenting with any one or more microorganisms in the aforementioned microbial composition.

[0054] Preferably, the sugar-free food is a fermented dairy product.

[0055] In some embodiments, the sugar-free food may be sugar-free milk beer, and the preparation method of the sugar-free milk beer may include the following steps:

[0056] The mixed bacterial agent is added to the culture medium at a volume ratio of 3%-5%. After a period of time, the acidity and lactose content are tested. When the requirements are met, the fermentation is stopped, and the product is cooled and filled. After high-temperature sterilization, a product that meets commercial standards is obtained.

[0057] Preferably, the mixed bacterial agent can be added to the culture medium at a volume ratio of 4%.

[0058] Preferably, the culture temperature is 35-37°C.

[0059] Preferably, the fermentation time is 10-20 hours.

[0060] Preferably, the high temperature sterilization is 85°C-90°C for 10 minutes.

[0061] In some embodiments, the culture temperature is 36° C. and the fermentation time is 16 h.

[0062] Specifically, the sugar-free milk beer includes, but is not limited to, camel milk beer, cow milk beer, goat milk beer and horse milk beer.

[0063] Compared with the prior art, the beneficial effects of the present invention include:

[0064] The present invention adopts multi-strain coupled strains for one-step fermentation to meet the technical requirements of carbon dioxide naturally produced by milk beer. The production process is simple, and milk beer production is achieved in one step without the need to fill food additive carbon dioxide. A trace amount of artificial synthetic sweetener sucralose can be added to meet the requirements of sugar-free milk beer, overcoming the defects of existing production technology and presenting the unique taste and aroma of naturally fermented camel milk. The microbial composition provided by the present invention has high acidification efficiency, protein hydrolysis ability and lactose decomposition ability, and can improve the flavor of industrially fermented camel milk, and has broad application prospects in industrial fermentation.

[0065] Collection Instructions

[0066] Bacteria species name: Leuconostoc mesenteroides;

[0067] Latin name: Leuconostocmesenteroides;

[0068] Strain number: FW.Chen.GL-15;

[0069] Deposit number: CGMCC No.20805;

[0070] Deposit date: September 22, 2020;

[0071] Depository: General Microbiology Center, China Culture Collection Administration; Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0072] Species name: Leuconostoc mesenteroides subsp.

[0073] Latin name: Leuconostocmesenteroides subsp.mesenteroides;

[0074] Strain number: FW.Chen.GL-12;

[0075] Deposit number: CGMCC No.20802;

[0076] Deposit date: September 22, 2020;

[0077] Depository: General Microbiology Center, China Culture Collection Administration; Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0078] Species name: Kluyveromyces marxianus;

[0079] Latin name: Kluyveromyces maxianus;

[0080] Strain number: FY.Chen.GL-8;

[0081] Deposit number: CGMCC No.19778;

[0082] Deposit date: May 6, 2020;

[0083] Depository: General Microbiology Center, China Culture Collection Administration; Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0084] Strain name: Saccharomyces cerevisiae;

[0085] Latin name: Saccharomyces cerevisiae;

[0086] Strain number: FY.Chen.GL-3;

[0087] Deposit number: CGMCC No.19773;

[0088] Deposit date: May 6, 2020;

[0089] Depository: General Microbiology Center, China Culture Collection Administration; Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. DETAILED DESCRIPTION

[0090] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0091] Unless the context clearly dictates otherwise, the expressions "a", "an" and "an" as used herein include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0092] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0093] The sources of some raw material information involved in the specific implementation are as follows:

[0094] Table 5 Source of raw material information

[0095] Bacteria Accession number or purchase source Streptococcus salivarius subsp. thermophilus French production Tianjin Technology Company agent Lactobacillus delbrueckii subsp.bulgaricus French production Tianjin Technology Company agent Lactobacillus paracasei Owned by our company, number CGMCC No.20803 Lactobacillus rhamnosus Owned by our company, number CGMCC No.26601 Leuconostoc pseudomesenteroides Owned by our company, number CGMCC No.197793 Angel brewing dry yeast Angel Yeast Co., Ltd. Wangyuan Brewer's Yeast Owned by our company, number CGMCC No.1977

[0096] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with embodiment.Unspecified conditions in the embodiment are carried out according to normal conditions or conditions recommended by the manufacturer.All reagents or instruments are conventional products that can be purchased commercially without specifying the manufacturer.The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation of the present invention.In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present invention.

[0097] Basic Example 1 Processing of Raw Camel Milk

[0098] 1. Raw camel milk acceptance: Raw camel milk is inspected and purchased in accordance with the Xinjiang Uygur Autonomous Region local standard "Raw Camel Milk-DBS65010-2023" raw milk purchase standard. The raw milk indicators meet the following requirements:

[0099] (1) Acidity (°T): The raw camel milk used to prepare fermented camel milk products must be fresh, with a natural acidity of 16-24;

[0100] (2) Relative density (20℃ / 4℃): ≥1.028;

[0101] (3) Protein content (g / 100g): ≥3.5%;

[0102] (4) Fat content (g / 100g): ≥4.0;

[0103] (5) Non-fat milk solids content (g / 100g): ≥8.5;

[0104] (6) The limits of contaminants and mycotoxins meet the national requirements for dairy products;

[0105] (7) Lactose content (g / 100g): 5.3-5.4%;

[0106] 2. Milk purification: Use appropriate milk purification equipment to remove spore bacteria, macromolecular fungi and impurities in milk;

[0107] 3. Ingredients: Sweeteners and other auxiliary materials can be added according to product needs, and hydration and ingredients can be carried out in a certain proportion;

[0108] 4. Homogenization: Heat the prepared liquid to 70-75℃ and homogenize at a pressure of 20±2Mpa;

[0109] 5. Sterilization: Heat the homogenized liquid to 95°C and keep it warm for 5 minutes for sterilization;

[0110] 6. Cooling: After sterilization, the liquid is cooled to 30±2℃.

[0111] The standard protein and lactose contents of raw camel milk, raw horse milk and raw cow milk in the embodiment are shown in the following table:

[0112]

[0113] Table 6 Standard protein and lactose content

[0114] Method for detecting alcohol content, acidity, protein and lactose content in the embodiment:

[0115] Determination of alcohol content: adopt the distillation method in "GB / T4928-2001 Beer Analysis Method";

[0116] Acidity determination: Phenolphthalein indicator method in GB5009.239-2016 National Food Safety Standard Determination of Food Acidity;

[0117] Determination of protein: The Kjeldahl nitrogen determination method in GB5009.5-2016 National Food Safety Standard Determination of Protein in Food was used;

[0118] Determination of reducing sugar: adopt the reducing sugar determination method specified in GB009.7-2016;

[0119] Determination of carbon dioxide: using weight loss method or pressure measuring instrument.

[0120] Example 1 Cultivation of bacterial strains and preparation of bacterial agents

[0121] The lactic acid bacteria (Leuconostoc mesenteroides and Leuconostoc mesenteroides subsp. mesenteroides) and yeasts (Saccharomyces cerevisiae and Kluyveromyces marxianus) in the microbial composition of the present invention are cultured separately and then mixed in a ratio of 1:1.

[0122] (1) Preparation of liquid culture medium: 90% fresh camel milk, 1% galactose, 5% purified water to dilute citric acid, adjust pH to 4.3-4.6, and sterilize at 115°C for 15 min or 90-95°C for 30 min before use;

[0123] (2) Take out the pure strain stored in the refrigerator, select an appropriate amount and add it to the test tube or triangular flask containing the sterilized liquid to activate it according to the requirements of the strain, and the number of live bacteria reaches 5.0×10 8 -1.0×10 9 CFU / mL, expanded culture according to 4% inoculum;

[0124] (3) The cultured liquid bacterial solution was centrifuged at 4°C, concentrated, and washed with sterile distilled water. A protective agent was prepared using 14.5% skim camel milk powder, 2% galactose, and 83.5% distilled water. It was sterilized at 115°C for 15 minutes before use. The protective agent and bacterial solution were embedded in a ratio of 1:1, and the solution was kept at -45°C to -40°C for 1 hour and sublimated to 32-35°C. The number of viable bacteria reached 4.0×10 8 -9×10 8 CFU / g dry powder bacteria.

[0125] (4) Lactic acid bacteria and yeast are mixed in a ratio of 1:1 to prepare a mixed bacterial agent.

[0126] Example 2 Preparation method of sugar-free camel milk beer

[0127] (1) Preparation of camel milk beer base

[0128] According to the raw camel milk standard requirements, 250 ml of raw camel milk, 30 grams of erythritol, 20 grams of xylitol, 10 grams of crystalline fructose, 0.5 grams of sucralose, 5 grams of composite stabilizer (sodium carboxymethyl cellulose, sodium citrate, pectin), and 1 gram of citric acid are added to 1 liter with purified water to make the camel milk beer base.

[0129] (2) Preparation method of camel milk beer

[0130] The mixed bacterial agent obtained in Example 1 was added to the camel milk beer base obtained in step (1) at a volume ratio of 4% for fermentation. One-stage fermentation was adopted and the culture temperature was maintained at 36°C. The acidity and lactose content were detected after 16 hours of fermentation. When the acidity reached 45°T and the lactose content was less than 0.5%, the fermentation was stopped, the mixture was cooled to 4°C and filled.

[0131] The fermented camel milk beer can be sterilized at 90°C for 10 minutes according to the product requirements. The texture is uniform, the foam is fine, and there is no protein precipitation and stratification, which means that the commercial sterility requirements are met.

[0132] Example 3 Preparation of Sugar-free Mare's Milk Beer

[0133] Acceptance is carried out according to the standard indicators of raw mare's milk in the Xinjiang Uygur Autonomous Region local standard "Raw Mare's Milk-DBS65015-2023"; take 500 ml of raw mare's milk; 30 grams of erythritol, 20 grams of xylitol, 10 grams of crystalline fructose, 0.5 grams of sucralose; 5 grams of composite stabilizer (sodium carboxymethyl cellulose, sodium citrate, pectin); 1 gram of citric acid, and add 433.5 ml of purified water to 1 liter.

[0134] The required amount for production is prepared according to this ratio, the sweetener and stabilizer are mixed and dissolved and added into the mare's milk, citric acid is dissolved in pure water and then slowly added into the mare's milk mixture to prepare the mare's milk beer base.

[0135] The mixed bacterial agent obtained in Example 1 was added to the prepared mare's milk beer base at a volume ratio of 4% for fermentation. One-stage fermentation was adopted and the culture temperature was maintained at 36°C. The acidity and lactose content were detected after 16 hours of fermentation. When the acidity reached 45°T and the lactose content was less than 0.5%, the fermentation was stopped, the mixture was cooled to 4°C and filled.

[0136] The fermented mare's milk beer can be sterilized at 90°C for 10 minutes according to the product requirements to meet commercial sterility requirements.

[0137] Example 4 Preparation of Sugar-free Milk Beer

[0138] Acceptance is based on the standard indicators of raw milk in GB19301-2010; take 300 ml of raw milk; 30 g of erythritol, 20 g of xylitol, 10 g of crystalline fructose, 0.5 g of sucralose; 5 g of composite stabilizer (sodium carboxymethyl cellulose, sodium citrate, pectin); 1 gram of citric acid, and add 633.5 ml of purified water to 1 liter.

[0139] The required amount for production is prepared according to this ratio, the sweetener and stabilizer are mixed and dissolved and added into the milk, the citric acid is dissolved in pure water and then slowly added into the milk mixture to obtain the sucrose-free milk beer base.

[0140] The mixed bacterial agent obtained in Example 1 was added to the prepared milk beer base at a volume ratio of 4% for fermentation. One-stage fermentation was adopted and the culture temperature was maintained at 36°C. The acidity and lactose content were detected after 16 hours of fermentation. When the acidity reached 45°T and the lactose content was less than 0.5%, the fermentation was stopped, the mixture was cooled to 4°C and filled.

[0141] The fermented milk beer can be sterilized at 90°C for 10 minutes according to the product requirements to meet commercial sterility requirements.

[0142] The following table shows the measurement results of the acidity, protein content, alcohol content and reducing sugar content of the milk beer prepared in Examples 2-4.

[0143] Table 7 Determination results of milk beer acidity, protein content, alcohol content and reducing sugar content

[0144]

[0145] The existing "Food Nutrition Label Management Standards" and the quality standards of milk beer itself summarize the standards for sugar-free milk beer as follows: carbon dioxide content (calculated by weight loss method) ≥ 0.15%, alcohol content ≤ 0.5%, total sugar content (calculated as reducing sugar) ≤ 0.5%, protein content ≥ 0.7%, acidity 40-60 0 T.

[0146] It can be seen from Table 7 that the milk beer prepared by the microbial composition of the present invention meets the standard of sugar-free milk beer.

[0147] Example 5

[0148] The difference from Example 2 is that the fermentation was carried out for 10 hours, and the other steps were the same as those in Example 2, and the relevant contents of milk beer were determined.

[0149] Example 6

[0150] The difference from Example 2 is that the fermentation was carried out for 20 hours, and the other steps were the same as those in Example 2, and the relevant contents of milk beer were determined.

[0151] The following table shows the measurement results of the acidity, protein content, alcohol content and reducing sugar content of the camel milk beer prepared in Examples 5 and 6.

[0152] Table 8 Camel milk beer acidity, protein content, alcohol content and reducing sugar content determination results

[0153]

[0154] It can be seen from Table 8 that the camel milk beer prepared by fermenting the microbial composition for 10 h and 20 h does not meet the standard of sugar-free milk beer.

[0155] Comparative Example 1

[0156] A mixed bacterial agent (lactic acid bacteria composition: thermophilic Streptococcus salivarius subsp. thermophilus and Lactobacillus delbrueckii subsp. bulgaricus; yeast composition: Angel brewing dry yeast and Wangyuan brewing yeast) was added to the camel milk beer base obtained in Example 2 at a volume ratio of 4% for fermentation. One-stage fermentation was adopted, and the culture temperature was maintained at 36°C. The acidity, sugar content, protein content and alcohol content were detected after 16 hours of fermentation. The results are shown in Table 9.

[0157] Table 9 Determination results of milk beer acidity, protein content, alcohol content and reducing sugar content

[0158]

[0159] The average reducing sugar content (calculated as reducing sugar) measured in 5 tests was 0.75%, the average protein content was 0.73%; the average acidity was 49.0 0 T; average alcohol content 0.25%; average carbon dioxide (measured by pressure meter) 0.12Mpa. The total sugar content and carbon dioxide content do not meet the standard of sugar-free milk beer and are not suitable for preparing sugar-free milk beer.

[0160] Comparative Example 2

[0161] A mixed bacterial agent (lactic acid bacteria composition: Lactobacillus paracasei and Lactobacillus rhamnosus; yeast composition: Angel brewing dry yeast and Wangyuan brewing yeast) was added to the camel milk beer base obtained in Example 2 at a volume ratio of 4% for fermentation. One-stage fermentation was adopted, and the culture temperature was maintained at 36°C. The acidity, sugar content, protein content and alcohol content were detected after 16 hours of fermentation. The results are shown in Table 10.

[0162] Table 10 Determination results of milk beer acidity, protein content, alcohol content and reducing sugar content

[0163]

[0164] The total sugar content (calculated as reducing sugar) measured in 5 tests averaged 0.75%, the protein averaged 0.71%, and the acidity averaged 50.0 0 T; average alcohol content 0.21%; average carbon dioxide (measured by pressure meter) 0.10Mpa. The total sugar content and carbon dioxide content do not meet the standard of sugar-free milk beer and are not suitable for preparing sugar-free milk beer.

[0165] Comparative Example 3

[0166] A mixed bacterial agent (lactic acid bacteria composition: Lactobacillus rhamnosus and Leuconostoc pseudomesenteroides; yeast composition: Angel brewing dry yeast and Wangyuan brewing yeast) was added to the camel milk beer base obtained in Example 2 at a volume ratio of 4% for fermentation. One-stage fermentation was adopted, and the culture temperature was maintained at 36°C. The acidity, sugar content, protein content and alcohol content were detected after 16 hours of fermentation. The results are shown in Table 11.

[0167] Table 11 Determination results of acidity, protein content, alcohol content and reducing sugar content of milk beer

[0168]

[0169] The total sugar content (calculated as reducing sugar) measured in 5 tests averaged 0.67%, the protein content averaged 0.72%, and the acidity averaged 51.5 0 T; average alcohol content 0.35%; average carbon dioxide (measured by pressure meter) 0.15Mpa. The total sugar content is higher than the standard of sugar-free milk beer, and is not suitable for preparing sugar-free milk beer.

[0170] Comparative Example 4

[0171] A mixed bacterial agent (lactic acid bacteria composition: Lactobacillus paracasei and Leuconostoc pseudomesenteroides; yeast composition: Angel brewing dry yeast and Wangyuan brewing yeast) was added to the camel milk beer base obtained in Example 2 at a volume ratio of 4% for fermentation. One-stage fermentation was adopted, and the culture temperature was maintained at 36°C. The acidity, sugar content, protein content and alcohol content were detected after 16 hours of fermentation. The results are shown in Table 12.

[0172] Table 12 Determination results of acidity, protein content, alcohol content and reducing sugar content of milk beer

[0173]

Claims

1. A microbial composition, characterized in that The microbial composition is any two lactic acid bacteria and yeast selected from Leuconostoc mesenterides, Leuconostoc mesenteroides subsp. mesenteroides, Kluyveromyces maxianus and Saccharomyces cerevisiaes.

2. The microbial composition according to claim 1, characterized in that The 16S rRNA sequence of the microbial composition comprises the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 respectively.

3. The microbial composition according to claim 1, characterized in that The microbial composition comprises a lactic acid bacteria composition consisting of Leuconostoc mesenteroides and Leuconostoc mesenteroides subspecies, and a yeast composition consisting of Kluyveromyces marxianus and Saccharomyces cerevisiae.

4. The microbial composition according to claim 3, characterized in that The lactic acid bacteria composition and the yeast composition are mixed in a ratio of 1:1 or 1.5:

1.

5. A culture medium, characterized in that The culture medium is used for culturing the microbial composition described in claim 1 or 3, and the culture medium comprises raw camel milk, galactose and 5% citric acid solution.

6. The culture medium according to claim 5, characterized in that The culture medium can also be raw cow's milk, raw horse's milk and raw goat's milk.

7. A microbial agent, characterized in that: The microbial agent comprises the microbial composition according to claim 1 or claim 3.

8. Use of the microbial composition according to claim 1 or 3 in preparing sugar-free food.

9. The use according to claim 8, characterized in that: The sugar-free food can be selected from sugar-free milk beer.

10. A method for preparing sugar-free milk beer, characterized in that: include: The mixed bacterial agent is added to the culture medium at a volume ratio of 3%-5%, and the culture is carried out for 10-20 hours. The acidity and lactose content are tested, and the fermentation is stopped when the requirements are met. After cooling, filling and sterilization, milk beer that meets commercial standards is obtained.

11. The preparation method according to claim 10, characterized in that: The volume ratio is 4%.

12. The preparation method according to claim 10, characterized in that: The culture temperature is 35-37°C.

13. The preparation method according to claim 10, characterized in that: The high temperature sterilization is 85°C-90°C, and the sterilization time is 10 minutes.

Images