Coix lacryma-jobi salt stress resistance related gene ClWRI1-20 and application thereof

Abstract

The invention discloses a salt stress resistance related gene ClWRI1-20 of coix lacryma-jobi and application thereof, and belongs to the technical field of molecular biology. On one hand, the invention provides the salt stress resistance related gene ClWRI1-20 of coix lacryma-jobi and the encoding protein of the salt stress resistance related gene ClWRI1-20, and on the other hand, the invention provides the application of the salt stress resistance related gene ClWRI1-20 of coix lacryma-jobi. The invention provides an important gene resource capable of regulating and controlling salt stress resistance of coix lacryma-jobi and possibly having universality, and an excellent candidate gene is provided for cultivating stress-resistant plant varieties.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to a coix seed salt stress resistance related gene ClWRI1-20 and an application thereof. Background Art

[0002] Job's tears (Coixlacryma-jobi L.) is a traditional cereal crop in my country that can be used as both medicine and food. Its seed kernel oil has also been proven to have analgesic, anti-tumor, antioxidant, osteoporosis prevention, and immunity enhancement effects in modern medical clinical studies, and has broad development prospects. With the development of industrialization, the production of Job's tears is being subjected to various abiotic stresses, and salt stress has become one of the most important factors affecting the yield and quality of Job's tears. Growing in high-concentration saline-alkali land can also lead to significant yield losses in Job's tears. In recent years, with the development of molecular biology, a series of stress-resistant genes have been identified in Job's tears, but the data on the functional research of Job's tears salt stress resistance-related genes is still very scarce, and it is worth further exploration. The identification of Job's tears salt stress resistance genes will help Job's tears tolerance breeding and maintain the sustainable production of Job's tears.

[0003] AP2 / EREBP is a class of transcription factors widely present in plants, playing an important role in plant growth, development and response to environmental stress. WRI1 is a plant-specific transcription factor, belonging to the AP2 subfamily of the AP2 / EREBP transcription factor superfamily, and contains two highly conserved AP2 domains. According to previous studies, different transcription factors in plants have different tolerances to the environment, and the WRI1 transcription factor in plants responds to different environmental stresses.

[0004] In summary, the study of WRI1-related genes involved in the stress resistance of coix is ​​helpful to understand the stress resistance of coix, lay a good foundation for the subsequent genetic breeding to construct coix with excellent traits, and further increase the biomass of coix, and promote the economic prosperity and development of the coix industry, which has important practical significance and application prospects. Summary of the invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to design and provide a technical solution for a coix seed salt stress resistance-related gene ClWRI1-20 and its application.

[0006] The present invention is achieved through the following technical solutions:

[0007] In a first aspect, the present invention provides a coix seed salt stress resistance-related gene ClWRI1-20, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The second aspect of the present invention provides a protein encoded by the above gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] The third aspect of the present invention provides the use of the above-mentioned coix seed salt stress resistance related gene ClWRI1-20 in regulating yeast salt stress resistance.

[0010] The fourth aspect of the present invention provides an expression vector containing coix seed salt stress resistance related genes ClWRI1-20.

[0011] The fifth aspect of the present invention provides yeast containing coix seed salt stress resistance related genes ClWRI1-20.

[0012] Furthermore, the application is: making yeast contain gene ClWRI1-20 or making yeast overexpress gene ClWRI1-20.

[0013] Furthermore, the application is: constructing a yeast overexpression vector containing the gene ClWRI1-20, heterologously transforming it into the INVSc1 yeast, and screening to obtain positive yeast, that is, a yeast strain with salt stress resistance.

[0014] Further, the application specifically includes the following steps:

[0015] 1) Collect coix seeds, extract RNA, reverse transcribe into cDNA, clone the CDS sequence of ClWRI1-20, connect it to pYES2.0 vector for sequencing, construct an overexpression vector after correct identification, and heterologously transform it into yeast;

[0016] 2) The ClWRI1-20 gene heterologous transformed yeast was positively screened using Ura-deficient yeast culture plates and PCR technology to obtain positive yeast, and its activity and growth curve statistics were performed to verify that its yeast resistance to salt stress was increased, and yeast with improved salt stress resistance was obtained.

[0017] The present invention has the following beneficial effects:

[0018] 1. The present invention obtains ClWRI1-20 gene and encoded protein from Coix lachryma-jobi for the first time, and verifies its biological function of regulating yeast stress.

[0019] 2. The present invention is the first to overexpress the Coix lachryma-jobi gene ClWRI1-20 in yeast, and uses the PCR method to prove that the gene has been successfully integrated into the yeast genome, i.e., positive yeast.

[0020] 3. The present invention conducted phenotypic observation and bacterial activity statistics on transgenic yeast and blank yeast. The results showed that the survival rate of transgenic yeast under adversity was higher than that of the blank yeast, indicating that overexpression of the ClWRI1-20 gene improved the resistance of transgenic yeast to adversity. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 ClWRI1-20 transgenic yeast line positive yeast detection;

[0022] Figure 2 Activity of transgenic yeast on day 3 after overexpression;

[0023] Figure 3 Live images of transgenic yeast 3, 6, 9, 12, and 24 h after overexpression;

[0024] Figure 4 Survival curves of colonies at different salt concentrations under salt stress. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with specific examples, which are intended to explain the present invention rather than to limit it.

[0026] Example 1: Cloning of Coix lachryma-jobi ClWRI1-20 gene

[0027] 1. Material preparation: Coix seeds were collected from the experimental field of the School of Life Sciences and Medicine, Zhejiang Sci-Tech University, Hangzhou, Zhejiang Province, and stored at -80°C for subsequent experiments.

[0028] 2. RNA Extraction

[0029] Refer to the instructions for RNAiso plus reagent from Takara Company. The specific steps are as follows:

[0030] (1) The mortar, tweezers and other instruments used in the experiment were sterilized at high temperature and then pre-cooled with liquid nitrogen. A coix sample stored at -80°C was placed in the mortar, liquid nitrogen was added, and the sample was quickly ground into powder.

[0031] (2) Take about 100 mg of sample powder and place it in a 2 ml RNA-free centrifuge tube. Add 1 ml of RNAiso plus reagent, shake thoroughly to mix, let stand for 5 min, and then centrifuge the sample at 12,000 g for 5 min at 4°C.

[0032] (3) Take 800 μl of the supernatant from step 2 and transfer it to a 1.5 ml RNA-free centrifuge tube. Add 200 μl of chloroform and shake vigorously for 15 seconds. Let stand for 5 minutes and then centrifuge at 12,000 g for 15 minutes at 4°C.

[0033] (4) Take 400 μl of the supernatant from step 3 and transfer it to a new 1.5 ml RNA-free centrifuge tube. Add 400 μl of -20°C precooled isopropanol, mix by inversion, let stand for 10 min, and then centrifuge at 4°C, 12,000 g for 10 min.

[0034] (5) Discard the supernatant, add 1 ml of anhydrous ethanol to resuspend and wash the precipitate, and centrifuge at 7500 g for 5 min at 4°C.

[0035] (6) Discard the supernatant, centrifuge at 7500 g for 5 min at 4°C, aspirate the remaining alcohol in the centrifuge tube, air-dry in a clean bench for 5 min, and then add 40 μl of RNA-free water to dissolve the precipitate.

[0036] 3. RNA Reverse Transcription

[0037] Refer to the PrimerScript RT reagent Kit with gDNA Eraser (Takara) kit. All experimental consumables are RNA-free and the reactions are performed on ice.

[0038] (1) Remove genomic DNA. Prepare the following reagents on ice, centrifuge and mix thoroughly, then incubate at 42°C for 2 min.

[0039]

[0040] (2) Reverse transcription of RNA into cDNA: Add the following reaction mixture to the PCR tube in step 1, mix thoroughly, centrifuge, react at 37°C for 15 min, react at 85°C for 5 s, and then cool on ice.

[0041]

[0042] (3) The reverse transcribed cDNA can be diluted 10 times and then used in gene cloning, fluorescence quantitative PCR and other related experiments.

[0043] 4. Gene cloning

[0044] (1) The cDNA sequence of ClWRI1-20 gene was extracted from the Coix lachryma-jobi database and primers were designed. The sequence is as follows:

[0045] ClWRI1-20-cds-F: GGGAATATTAAGCTTGGTACCATGTGGGACCTGAAC GATTCAC (as shown in SEQ IDNO.3)

[0046] ClWRI1-20-cds-R: GCGGCCGTTACTAGTGGATCCCTAGGTTGGCCGGGC CAG (as shown in SEQ IDNO.4)

[0047] (2) PCR amplification

[0048] Using coix cDNA as template, PCR amplification was performed with corresponding primers. The reaction procedure was: 95℃5min; 95℃5s, 62℃30s, 72℃60s, 30cycles; 72℃10min. The amplification instrument was CFX96 TM

[0049] Real-time PCR instrument, amplification system is as follows:

[0050]

[0051] (3) Use 1% agarose gel electrophoresis to check whether the band size is consistent with expectations and proceed to the next step of rubber tapping recovery verification.

[0052] (4) Gel recovery and purification: Use the Gel Extraction Kit column DNA gel recovery kit of Guangzhou Omega Company to purify the gel recovery product.

[0053] (5) Ligation reaction

[0054] Reference Hangzhou Qingke Biotechnology Co., Ltd. Instructions for the Seamless Cloning Kit, the connection system is as follows:

[0055]

[0056] (6) Transformation of ligation product into competent E. coli DH5α

[0057] Refer to the instructions for transformation of E. coli competent DH5α from Shanghai Weidi Biotechnology Co., Ltd. The specific steps are as follows:

[0058] ① Freeze-thaw the purchased E. coli competent DH5α on ice, add 10 μl of the ligation product, flick the bottom of the tube to mix, and let it stand on ice for 30 minutes.

[0059] ②After 90s at 42℃, place on ice for 2min.

[0060] ③ Add 300 μl of antibiotic-free LB medium and culture with shaking at 220 rpm and 37°C for 1 h.

[0061] ④ Take about 100 μl of the culture solution and spread it evenly on Luria-Bertani (LB) medium (containing ampicillin) and culture at 37°C for 12 hours.

[0062] ⑤ Select monoclonal colonies and place them in a 1 ml centrifuge tube containing liquid culture medium containing corresponding antibiotics. Incubate at 37°C and 220 rpm for 4-5 hours until the bacterial solution becomes turbid. Send the colonies to Shanghai Sangon Biotech Co., Ltd. for sequencing. Select more than 3 monoclonal colonies for each sequence to reduce the impact of mismatches on gene sequence confirmation during PCR.

[0063] The nucleotide sequence of the coix-lacryma-jobi salt stress resistance-related gene ClWRI1-20 finally cloned is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by the coix-lacryma-jobi salt stress resistance-related gene ClWRI1-20 is shown as SEQ ID NO.2.

[0064] Example 2: Application of ClWRI1-20 gene heterologous transformation of yeast to improve its salt resistance

[0065] 1. Screening and cultivation of transgenic yeast

[0066] (1) Plasmid extraction: The plasmid was extracted using the FastPure Plasmid Mini Kit from Nanjing Novazonics.

[0067] (2) Plasmid transformation into yeast competent INVSc1

[0068] ① Insert the carrier DNA into a 95℃ metal bath for 5 minutes or into a 95℃ water bath in a float for 3 minutes. After heating, quickly insert it into ice.

[0069] ②Take 100 μl of INVSc1 competent cells melted on ice, add 2-5 μg of pre-cooled target plasmid, 10 μl of pre-treated Carrier DNA, and 500 μl of PEG / LiAc in sequence, pipette and hit several times to mix, and place in a 30°C water bath for 30 min (invert 6-8 times every 15 min to mix).

[0070] ③ Place the tube in a 42°C water bath for 15 min (invert 6-8 times every 5 min to mix).

[0071] ④ Centrifuge at 5000rpm for 40s, discard the supernatant, resuspend in 400μl ddH2O, centrifuge for 30s, discard the supernatant, resuspend in 50μl ddH2O, spread all over the plate (screening plate: SD-Ura solid plate), invert the plate, and culture at 27-30℃ for 48-96h.

[0072] ⑤Pick a monoclonal colony and place it in a 1 ml centrifuge tube containing a liquid culture medium containing the corresponding antibiotics. Cultivate it at 30°C and 220 rpm for 24 hours until the bacterial solution becomes turbid. Perform PCR identification on the bacterial solution and select positive colonies (such as Figure 1 ).

[0073] (3) Transgenic yeast culture

[0074] ① Pipette 5 μl of yeast culture solution and spot it on the solid culture medium. Incubate the culture medium upside down for 3 days. Observe its growth status and take photos to record.

[0075] ② For further quantitative analysis, 1 ml of the above treatment OD 600The cells were resuspended in 1 ml of culture medium at a final concentration of 0 mM, 0.5 M, and 1 M NaCl were added to the SD-U liquid medium, and the cells were shaken for 3, 6, 9, 12, and 24 h, respectively, and the OD was measured. 600 , which was used to characterize the colony survival rate.

[0076] 2. Functional Verification

[0077] (1) Phenotypic statistics: Each transgenic yeast was diluted more than 3 times and plated, and a blank yeast was set as a control. The yeast was incubated in an incubator at 30°C for 3 days, and its growth was observed and photographed. The results showed that the control yeast and the recombinant yeast showed similar growth in the absence of stress. Under abiotic stress of different concentrations of NaCl (0.5M, 1M), pYES2-ClWRI1-20 showed stronger resistance than the control. It is worth noting that the number of colonies of the recombinant yeast was higher than that of the control group (such as Figure 2 ).

[0078] (2) Colony survival curve measurement: In order to more intuitively demonstrate the overexpression function of the ClWRI1 gene in yeast, the OD under different stress durations was further measured. 600 In the absence of stress, the control group and the recombinant yeast showed similar OD 600 Value (such as Figure 3 ), which is consistent with the spot plate results under different stress conditions. Under salt stress, as the salt concentration increased, the colony survival rate decreased, and pYES2-ClWRI1-20 performed better than the control group (such as Figure 4 ).

[0079] The above results show that the stress resistance of transgenic yeast is significantly higher than that of blank yeast.

Claims

1. A coix lachryma-jobi salt stress resistance-related gene ClWRI1-20, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The encoded protein of the gene according to claim 1, characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. Use of the coix seed salt stress resistance related gene ClWRI1-20 as claimed in claim 1 in regulating yeast salt stress resistance.

4. An expression vector containing the gene as claimed in claim 1.

5. A yeast containing the gene according to claim 1.

6. The use according to claim 3, characterized in that The yeast is made to contain the genes ClWRI1-20 or the yeast is made to overexpress the genes ClWRI1-20.

7. The use according to claim 3, characterized in that A yeast overexpression vector containing the ClWRI1-20 gene was constructed, and the vector was heterologously transformed into the INVSc1 yeast, and positive yeast was screened to obtain the yeast strain with salt stress resistance.

8. The use according to claim 3, characterized in that The specific steps include: 1) Collect coix seeds, extract RNA, reverse transcribe into cDNA, clone the CDS sequence of ClWRI1-20, connect it to pYES2.0 vector for sequencing, construct an overexpression vector after correct identification, and heterologously transform it into yeast; 2) The ClWRI1-20 gene heterologous transformed yeast was positively screened using Ura-deficient yeast culture plates and PCR technology to obtain positive yeast, and its activity and growth curve statistics were performed to verify that its yeast resistance to salt stress was increased, and yeast with improved salt stress resistance was obtained.

Images