Hippophae rhamnoides linn doff gene and application thereof

By constructing a sea buckthorn HrDof gene overexpression vector and transforming it into tomato, the lack of research on the mechanism of oil synthesis and accumulation in the pulp of woody plants was addressed, and a significant increase in the oil content of tomato fruit was achieved, providing technical basis and methods.

CN119913168BActive Publication Date: 2025-11-18DALIAN NATIONALITIES UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510203529.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-24
Publication Date
2025-11-18
Estimated Expiration
2045-02-24

AI Technical Summary

Technical Problem

There is limited research on the mechanism of lipid synthesis and accumulation in the fruit pulp of the woody plant Hippophae rhamnoides, and existing technologies have failed to effectively increase lipid yield, especially the mechanism of lipid synthesis and accumulation in non-seed tissues has not been reported.

Method used

A seabuckthorn HrDof gene overexpression vector was constructed and transformed into tomato using Agrobacterium-mediated transformation. Improved culture medium and transformation process were used to enhance transformation efficiency, achieve high expression of the HrDof gene in tomato fruit, and enhance oil synthesis.

Benefits of technology

The study successfully increased the oil content of tomato fruit by 2.34%, providing technical basis for the study of the oil synthesis and accumulation mechanism of sea buckthorn pulp and other plant non-seed tissues, and improved the conversion efficiency through improved culture medium and conversion method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005283864040000041
    Figure BDA0005283864040000041
  • Figure BDA0005283864040000051
    Figure BDA0005283864040000051
  • Figure BDA0005283864040000052
    Figure BDA0005283864040000052
Patent Text Reader

Abstract

The application belongs to the technical field of bioengineering, and discloses a Hippophae rhamnoides L. HrDof gene and application thereof. The application provides a Hippophae rhamnoides L. HrDof gene, a construction method of the Hippophae rhamnoides L. HrDof gene, and application of the Hippophae rhamnoides L. HrDof gene in improving oil content of tomato fruits. The HrDof gene is isolated from fruit pulp of Hippophae rhamnoides L. for the first time, and the tomato is successfully transformed by constructing an overexpression vector and a method of Agrobacterium mediation, so that the oil content of the tomato fruits is improved by 2.34%. The application provides a technical basis for studying the mechanism of oil synthesis and accumulation of the fruit pulp of Hippophae rhamnoides L. and non-seed tissues of plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and relates to a sea buckthorn HrDof gene and its application. Background Technology

[0002] Woody oilseeds are an important source of high-quality, healthy plant oils. In-depth research into the mechanisms of lipid synthesis and accumulation is crucial for improving plant oil yield and quality. Sea buckthorn is an important economic tree species for sand control and soil and water conservation. Its pulp oil is rich in bioactive substances beneficial to human health with high nutritional and medicinal value (such as 25-48% omega-7 fatty acids), and is widely used in daily chemicals, food, and medicine. However, the relatively low oil content of the pulp (approximately 20%) has always been a challenge restricting its oil yield. Most plant oils exist in the form of triacylglycerol (TAG). Their biosynthesis mainly involves de novo fatty acid synthesis within plastids and TAG assembly on the endoplasmic reticulum. The entire process involves multiple subcellular organelles (plastids, endoplasmic reticulum, etc.) and enzymatic reactions. Therefore, the lipid synthesis metabolic network is one of the most complex networks in nature. Studies have found that transcription factors such as Dof in plants can regulate plant oil biosynthesis. For example, soybean transcription factors GmDof4 and GmDof11 can increase the oil content of Arabidopsis seeds by 4.7% to 9.1% by activating the expression of the ACC gene. Currently, functional studies of Dof genes are mostly based on experimental materials such as soybeans, rapeseed, algae, and other herbaceous plants, while studies on woody plants, especially sea buckthorn, are rare. For example, there are no reports on the HrDof gene sequence, vector construction, genetic transformation, and functional analysis of sea buckthorn. Moreover, many unknowns remain regarding the mechanism of oil synthesis and accumulation in sea buckthorn pulp (non-seed). Summary of the Invention

[0003] To overcome the shortcomings of existing technologies, this invention provides a sea buckthorn HrDof gene and its application. Through the construction of an overexpression vector and Agrobacterium-mediated transformation, tomatoes were successfully transformed, resulting in a 2.34% increase in tomato fruit oil content. This provides a technical basis for research on the mechanism of oil synthesis and accumulation in sea buckthorn pulp and non-seed tissues of plants.

[0004] The above-mentioned objective of this invention is achieved through the following technical solution:

[0005] A sea buckthorn HrDof gene has a nucleotide sequence as shown in SEQ ID NO.1.

[0006] This invention also provides a method for constructing the above-mentioned HrDof gene from sea buckthorn, the specific steps of which are as follows:

[0007] (1) RNA was extracted from sea buckthorn pulp, and HrDof gene cDNA was obtained;

[0008] (2) Construct a vector for overexpressing the HrDof gene from sea buckthorn;

[0009] (3) Agrobacterium was transformed using the HrDof gene overexpression vector of Hippophae rhamnoides.

[0010] Furthermore, in step (3): the culture medium for Agrobacterium rhizogenes (YEB) contains 25 mg / L rifampicin, 25 mg / L gentamicin and 50 mg / L kanamycin.

[0011] This invention also provides an application of the above-mentioned sea buckthorn HrDof gene in increasing the oil content of tomato fruit.

[0012] The specific steps for application are as follows:

[0013] S1. Micro Tom tomatoes were transformed using the pCambia1301-HrDof recombinant expression vector;

[0014] S2. Molecular detection of Micro Tom tomatoes;

[0015] S3. Determine the oil content of Micro Tom tomatoes.

[0016] Furthermore, in step S1, the MS pre-culture solid medium used in the tomato conversion process has the following formulation: 4.74 g / L MS medium powder, 30 g / L sucrose, 7 g / L agar powder, 0.5 mg / L 6-benzylaminopurine (6-BA), 0.1 mg / L α-naphthaleneacetic acid (NAA), pH 6.0.

[0017] Furthermore, in step S1, the rooting medium used in the tomato conversion process is: 1 / 2 MS + 150 mg / L termethin + 5 mg / L hygromycin.

[0018] The advantages of this invention compared to the prior art are:

[0019] (1) Sea buckthorn is a rare plant that accumulates high levels of oil in its pulp (non-seed) tissue, with oil accounting for more than 30% of its dry weight. This invention is the first to discover that a single HrDof gene is significantly highly expressed during pulp development in high-oil sea buckthorn varieties.

[0020] (2) This invention is the first to isolate the HrDof gene from sea buckthorn pulp and successfully transform tomatoes by constructing an overexpression vector and using Agrobacterium-mediated transformation, which increased the oil content of tomato fruits by 2.34%. This provides a technical basis for the study of the mechanism of oil synthesis and accumulation in sea buckthorn pulp and non-seed tissues of plants.

[0021] (2) During the transformation of Agrobacterium tumefaciens by the overexpression vector, the Agrobacterium rhizogenes culture medium (YEB) used contained 25 mg / L rifampicin (Rif), 25 mg / L gentamicin (Gen) and 50 mg / L kanamycin (Kan), which effectively inhibited other bacteria, reduced contamination and improved transformation efficiency.

[0022] (3) During the tomato transformation process, the improved MS medium used in leaf pre-culture, co-culture, screening differentiation culture and subculture rooting culture improved the differentiation and rooting efficiency of the transformed tomatoes. Attached Figure Description

[0023] Figure 1 The pCambia1301-JC plasmid map;

[0024] Figure 2 This invention presents a regeneration system for transforming tomatoes with the HrDof gene from sea buckthorn. In the figure: A shows co-culture of infected leaves, B shows screening and differentiation of resistant seedlings, C shows budding of resistant seedlings, and D shows positively transformed plants. Detailed Implementation

[0025] The present invention is described in detail below through specific embodiments, but this does not limit the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the present invention are all conventional methods, and the experimental equipment, materials, reagents, etc. used can all be obtained commercially.

[0026] Example 1

[0027] RNA was extracted from sea buckthorn pulp, and cDNA of the HrDof gene was obtained.

[0028] Mature fruits of the sea buckthorn variety "Gaoyou No. 1" were collected in Suihua City, Heilongjiang Province. After harvesting, the fruits were flash-frozen in liquid nitrogen. The seeds were removed from the intact fruits, and the fruits were then ground in liquid nitrogen. Total RNA was extracted and purified from the sea buckthorn pulp according to the recommended method of the column-based plant total RNA extraction and purification kit from Shanghai Sangon Biotech Co., Ltd. cDNA was synthesized by reverse transcription using Oligo(dT) primers, following the method described in the Vazyme HiScript 1st Strand cDNA Synthesis Kit.

[0029] Using the above cDNA as a template, PCR amplification was performed using the upstream primer (with the nucleotide sequence ATGTTCAATAACCCTTTTGA as shown in SEQ ID NO.2) and the downstream primer (with the nucleotide sequence TCAAGATCTAGAGAACACCTGAA as shown in SEQ ID NO.3) as upstream and downstream primers, respectively.

[0030] The PCR reaction system is as follows:

[0031]

[0032] The reaction procedure was as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, 35 cycles; extension at 72℃ for 10 min; storage at 4℃.

[0033] PCR products were detected by 1% agarose gel electrophoresis. The target fragment was excised and purified using a UV gel imaging system, and the ORF sequence (843 bp) of HrDof from sea buckthorn was obtained by sequencing. It has the nucleotide sequence shown in SEQ ID NO.1.

[0034] Example 2

[0035] Constructing a sea buckthorn HrDof gene overexpression vector

[0036] Based on the HrDof gene sequence of *Hippophae rhamnoides*, an upstream primer (with the nucleotide sequence shown in SEQ ID NO. 4) containing a KpnI restriction enzyme site was designed: GCGGGTCGACGGTACCATGTTCAATAACCCTTTTGACG, and a downstream primer (with the nucleotide sequence shown in SEQ ID NO. 5) was designed: TAGACATATGGGTACCTCAAGATCTAGAGAACACCTG. Using the reverse-transcribed cDNA as a template, the target fragment containing the restriction enzyme site was amplified. The pCambia1301-KY linearized vector plasmid was digested with enzymes in the following reaction system:

[0037]

[0038] After purification, the enzyme digestion product was combined with the above PCR product for a recombination reaction (the recombination reaction kit was the Vazyme ClonExpress-II One Step Cloning Kit). The reaction system is as follows:

[0039]

[0040] The above reaction solution was gently mixed using a pipette, and the mixture was briefly centrifuged to collect the solution at the bottom of the tube. The mixture was incubated at 37°C for 30 min, and then immediately cooled on ice. The ligation product was transformed into *E. coli* DH5α, and transformants were screened on Kans resistant medium. Positive clones were selected, and plasmids were extracted for restriction enzyme digestion and identification. (See vector diagram). Figure 1 As shown.

[0041] Example 3

[0042] Agrobacterium tumefaciens was transformed using a sea buckthorn HrDof gene overexpression vector.

[0043] Thaw one tube of Agrobacterium GV3101 on ice, add 5 μL of plasmid, mix well, flash freeze in liquid nitrogen for 1 min, and then place in a 37°C water bath for 15 min. Add 800 μL of YEP medium and incubate at 28°C for 2–4 h. Centrifuge at 5000 rpm for 3 min, discard the supernatant, and resuspend the cells in 100 μL of YEP medium. Spread the resuspended cells on YEP plates containing 25 mg / L Rif + 50 mg / L Kan + 25 mg / L Gen and incubate at 28°C for 3 days. Pick a single colony and inoculate it into YEP medium containing 25 mg / L Rif + 50 mg / L Kan + 25 mg / L Gen, and incubate overnight. Using the bacterial suspension of a positive single colony as a template, perform PCR detection using HrDof gene-specific primers. The product fragment is consistent in size with the target gene, indicating that the Agrobacterium strain containing the recombinant expression vector pCambia1301-HrDof has been successfully obtained.

[0044] Application Example 1

[0045] The pCambia1301-HrDof recombinant expression vector prepared in Example 3 was used to transform tobacco.

[0046] Sterilized tomato seeds were sown on MS solid medium and cultured in the dark overnight at 25°C, followed by 7 days of light culture. After the cotyledons unfolded, explants were harvested and pre-cultured for 2 days (medium: MS + ZT + IAA). Figure 2 Figure A shows the transformation of Agrobacterium strains, with an OD value of 0.6, an infection time of 10 min, and co-culture for 2 days (medium: MS + ZT + IAA + AS). Figure 2 (Figure B), dark culture. Seedlings will emerge after approximately two months of selection culture (culture medium: MS + ZT + IAA + 300 mg / L termethin + 10 mg / L hygromycin). Figure 2 (Figure C), remove and place into rooting culture (22℃, culture medium: 1 / 2 MS + 150 mg / L termethin + 5 mg / L hygromycin) Figure 2 (D diagram).

[0047] Application Example 2

[0048] Molecular detection of transformed tomatoes

[0049] Genomic DNA was extracted from leaves of untransformed tomatoes and transformed tomatoes selected by Kan, following the method of the genomic DNA extraction kit from Tiangen Biotech Co., Ltd. Using the genomic DNA as a template, PCR amplification was performed using HrDof-specific primers from sea buckthorn. The reaction system and amplification conditions were as described in Example 1. The size of the target band was verified by 1% agarose gel electrophoresis. Three transgenic lines amplified bands of the same size as the target gene, while no amplified band was observed in WT plants, indicating that the HrDof gene had been successfully transferred into tomatoes.

[0050] Application Example 3

[0051] Determining the oil content of tomato fruits

[0052] The chloroform-methanol method was used. Freeze-dried fruit powder was transferred to a glass test tube, and methanol and chloroform (volume concentration ratio 2:1) were added. After vortexing and sonication for 30 min, the supernatant was transferred to a new test tube. The residue was extracted again with chloroform-methanol solution. The combined supernatants were mixed with 1 / 4 volume of potassium chloride solution (mass concentration 0.88%), and the lower layer was collected into a glass sample vial and evaporated to constant weight. Oil content (%) = (m1-m2) / m × 100; m1 is the mass (g) of oil and glass sample vial; m2 is the mass (g) of glass sample vial; m is the mass (g) of dried sample powder. The experiment was repeated three times.

[0053] Fourteen days after flowering, the oil content of unconverted tomato fruit was approximately 3.37%, while the oil content of tomato fruit converted with the HrDof gene was 5.71%. This shows that converting sea buckthorn with the HrDof gene can increase the oil content of tomato fruit by 2.34%.

[0054] The embodiments described above are merely preferred embodiments of the present invention, and not all feasible embodiments of the present invention. Any obvious modifications made by those skilled in the art without departing from the principles and spirit of the present invention should be considered to be included within the scope of protection of the claims of the present invention.

Claims

1. A type of sea buckthorn HrDof Genes, characterized by, The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The sea buckthorn as described in claim 1 HrDof The method of gene construction is characterized by, The specific steps are as follows: (1) Extract RNA from sea buckthorn pulp and obtain HrDof Gene cDNA; (2) Constructing sea buckthorn HrDof Gene overexpression vectors; (3) Utilizing sea buckthorn HrDof Gene overexpression vector was transformed into Agrobacterium.

3. The sea buckthorn as described in claim 1 HrDof Application of genes in increasing the oil content of tomato fruits.

4. The sea buckthorn as described in claim 2 HrDof The method of gene construction is characterized by, In step (3): the culture medium containing Agrobacterium rhizogenes contains 25 mg / L rifampicin, 25 mg / L gentamicin and 50 mg / L kanamycin.

5. The application as described in claim 3, characterized in that, The specific steps are as follows: S1. Using pCambia1301- HrDof Transformation of MicroTomato with recombinant expression vector; S2. Molecular detection of MicroTomato transformation; S3. Determine the oil content of Micro Tom tomatoes.

6. The application as described in claim 5, characterized in that, In step S1, the MS pre-culture solid medium used in the tomato conversion process has the following formula: 4.74 g / L MS medium powder, 30 g / L sucrose, 7 g / L agar powder, 0.5 mg / L 6-benzylaminopurine, 0.1 mg / L α-naphthaleneacetic acid, pH 6.

0.

7. The application as described in claim 5, characterized in that, In step S1, the rooting medium used in the tomato conversion process is: 1 / 2 MS + 150 mg / L termethin + 5 mg / L hygromycin.