A novel MYB transcription factor for increasing anthocyanin content in plants

By isolating the SrMYB1 gene from lilac and overexpressing it in tobacco, the lack of theoretical understanding of anthocyanin synthesis in existing technologies was solved, and the anthocyanin content in tobacco was significantly increased.

CN119913169BActive Publication Date: 2026-03-24QINGHAI UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-25
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Current technology cannot theoretically guide the determination of which MYB transcription factors in *Syringa vulgaris* are involved in regulating anthocyanin biosynthesis, making it difficult to increase the anthocyanin content in the plant.

Method used

The SrMYB1 gene was isolated from Syringa vulgaris, a recombinant plasmid was constructed, and it was transferred into the tobacco genome using Agrobacterium-mediated transformation to achieve overexpression of the SrMYB1 gene and enhance anthocyanin synthesis.

Benefits of technology

The transformed tobacco plants significantly accumulate anthocyanins in their roots, stems, leaves, flowers, fruits, and seeds, with the total anthocyanin content in the leaves increasing to 12.8 times that of the wild type.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119913169B_ABST
    Figure CN119913169B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of transgenic organism synthesis, and particularly relates to a novel MYB transcription factor for increasing anthocyanin content in plants. The SrMYB1 gene is isolated from Epigaea regina, and the SrMYB1 gene is constructed into an expression vector through genetic engineering technology, and a transgenic tobacco overexpressing the SrMYB1 gene is obtained by using an agrobacterium-mediated infection method. The transgenic tobacco overexpressing the SrMYB1 gene of the present application significantly accumulates anthocyanin in different tissues such as roots, stems, leaves, flowers, fruits and seeds, and is purple. The total anthocyanin content in the leaves of the transgenic tobacco of the present application is about 12.8 times that of wild-type tobacco. It is shown that the SrMYB1 gene isolated from Epigaea regina can be used to increase the anthocyanin content in tobacco, and provides more options for biosynthesis of anthocyanin, and has a good application prospect in biosynthesis of anthocyanin.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of transgenic biosynthesis, and particularly relates to a novel MYB transcription factor for increasing the content of anthocyanin in plants. BACKGROUND

[0002] Anthocyanin is a kind of water-soluble pigment widely existing in plants, belongs to flavonoids, and is also the main coloring material of plants. Anthocyanin in plants also has important functions such as anti-tumor, anti-inflammatory and anti-oxidation in animals and human bodies. At present, anthocyanin as a new type of medical resource has attracted widespread attention.

[0003] The anthocyanin biosynthesis pathway has been widely studied in plants. Under the regulation of different genes, a series of enzymatic reactions are carried out to finally synthesize different types of anthocyanin. The biosynthesis of anthocyanin in plants is mainly participated by two types of genes, one is the structural gene which can encode various enzymes, and the other is the regulatory factor which regulates the expression of the structural gene. The regulatory factors for regulating anthocyanin biosynthesis mainly include three categories, MYB transcription factor, bHLH transcription factor and WD40 transcription factor, which mainly regulate the expression of structural genes by forming MBW complex. MYB transcription factor is the main determinant factor in MBW complex. It is found that MYB transcription factor determines the type and content of anthocyanin by regulating the expression of structural genes in the anthocyanin biosynthesis pathway, and finally affects the color of different tissues of plants.

[0004] Many structural genes and regulatory genes for regulating anthocyanin synthesis in plants have been verified, such as Arabidopsis thaliana, potato, wolfberry, grape and tea tree. At present, the research on anthocyanin biosynthesis related genes in Syringa oblata on the domestic and foreign markets mainly focuses on the cloning and transcriptional expression analysis of structural genes, and lacks the functional analysis of transcription factors for regulating anthocyanin synthesis. Therefore, it is impossible to determine which MYB transcription factor can be used to regulate the biosynthesis of anthocyanin and to increase the content of anthocyanin in plants through theoretical guidance.

[0005] Due to the biological characteristics such as easy operation, strong regeneration ability and large growth, tobacco has been used as a gene engineering research object and model organism for a long time, and is used for synthesizing and extracting medicinal substances. Since 2008, using gene engineering technology, tobacco has been used as an object to obtain tumor cell surface protein, ZMapp, serum protein activator TPA, cancer immune substance and artemisinic acid for treating non-Hodgkin's lymphoma, Ebola virus infection, heart disease, cancer and malaria and other diseases.

[0006] There is no report on using Epigaea reginae MYB transcription factor to create transgenic tobacco rich in anthocyanin. People cannot determine which MYB transcription factor in Epigaea reginae participates in regulating anthocyanin biosynthesis through theoretical guidance in existing research results, and it is difficult to use new type of regulatory gene to improve anthocyanin content. Therefore, exploring new type of regulatory gene for improving anthocyanin content is still a problem to be solved in the field. SUMMARY

[0007] The application provides a SrMYB1 gene isolated from Epigaea reginae, and aims at improving anthocyanin content in tobacco.

[0008] The application provides a SrMYB1 gene, and a CDS sequence of the SrMYB1 gene is shown as SEQ ID No. 1.

[0009] The application provides a recombinant plasmid, and the recombinant plasmid comprises the CDS sequence of the SrMYB1 gene.

[0010] Preferably, the recombinant plasmid is a plasmid obtained by inserting the CDS sequence of the SrMYB1 gene into a vector; and the vector is pDONR207 and pJAM1502.

[0011] The application provides a recombinant bacterium, and the recombinant bacterium comprises the recombinant plasmid.

[0012] Preferably, the recombinant bacterium is a recombinant Agrobacterium.

[0013] Preferably, the recombinant Agrobacterium is a recombinant Agrobacterium tumefaciens.

[0014] The application provides a method for preparing a transgenic plant with high anthocyanin yield, and the method comprises the following step: introducing the SrMYB1 gene into a plant to obtain a plant expressing SrMYB1 protein.

[0015] Preferably, the method for introducing the plant is one of an Agrobacterium method, a gene gun method, an electric transformation method, a PEG-mediated method, a liposome method and a calcium phosphate-DNA co-precipitation method.

[0016] Preferably, the method for introducing the plant is the Agrobacterium method.

[0017] Preferably, the plant is tobacco.

[0018] The application provides the SrMYB1 gene, the recombinant plasmid and the recombinant bacterium for preparing a transgenic plant with high anthocyanin yield.

[0019] Preferably, the transgenic plant is transgenic tobacco.

[0020] The application separates SrMYB1 gene from Epigaea regina, constructs an expression vector by genetic engineering technology, and obtains transgenic tobacco overexpressing SrMYB1 gene by using an agrobacterium-mediated infection method. The transgenic tobacco overexpressing SrMYB1 gene of the application significantly accumulates anthocyanins in different tissues such as roots, stems, leaves, flowers, fruits and seeds, and is purple. The total anthocyanin content in the leaves of the transgenic tobacco is about 12.8 times that of wild-type tobacco. It is shown that the SrMYB1 gene separated from Epigaea regina can be used to increase the anthocyanin content in tobacco, provides more options for biosynthesis of anthocyanins, and has a good application prospect in biosynthesis of anthocyanins.

[0021] Obviously, according to the above content of the application, according to the ordinary technical knowledge and common means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical idea of the application.

[0022] The above content of the application will be further described in detail through the specific embodiments in the form of examples. However, it should not be understood that the scope of the above subject matter of the application is limited to the following examples. Any technology realized based on the above content of the application belongs to the scope of the application. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 It is an agarose gel electrophoresis diagram of SrMYB1 gene amplification products; wherein, lane M is a D2000 DNA marker; lanes 1-4 are positive amplification products of SrMYB1 gene respectively.

[0024] Figure 2 It is an agarose gel electrophoresis diagram of screening bacteria of SrMYB1 gene connected with pLB vector; wherein, lane M is a D2000 DNA marker; lanes 1-5 are positive bacteria respectively.

[0025] Figure 3 It is an agarose gel electrophoresis diagram of primer amplification products of SrMYB1-attB1-F and SrMYB1-attB2-R; wherein, lane M is a D2000 DNA marker; lanes 1-6 are positive amplification products respectively.

[0026] Figure 4 It is an agarose gel electrophoresis diagram of SrMYB1 expression vector constructed; wherein, lane M is a D2000 DNA marker; lane 1 is a Bp reaction positive bacteria; lane 2 is a LR reaction positive bacteria; lane 3 is a Bp reaction positive bacteria plasmid; lane 4 is a LR reaction positive bacteria plasmid.

[0027] Figure 5Figure 1 is an agarose gel electrophoresis diagram of screening of Agrobacterium transformation of SrMYB1; wherein lane M is a D2000 DNA marker; lanes 1-10 are positive bacteria.

[0028] Figure 6 Figure 4 is a PCR identification result diagram of transgenic tobacco lines overexpressing SrMYB1; wherein lane M is a D2000 DNA marker; lanes 1-4 are positive amplification products.

[0029] Figure 7 Figure 5 is a photograph of wild-type tobacco and transgenic tobacco overexpressing SrMYB1.

[0030] Figure 8 Figure 6 is a diagram of determination results of total anthocyanin content in leaves of transgenic tobacco lines overexpressing SrMYB1; wherein WT is wild-type tobacco, SrMYB1 is a transgenic tobacco line, and FW is fresh weight. DETAILED DESCRIPTION

[0031] In the following examples and experimental examples, reagents and materials not specifically stated are commercially available.

[0032] Example 1 Cloning of SrMYB1 gene

[0033] By using a MYB transcription factor known to regulate anthocyanin synthesis, homologous alignment was performed in the transcriptome database of P. damavii to find the target gene SrMYB1 sequence.

[0034] RNA in P. damavii leaves was extracted using a TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa, Beijing, China) kit according to the operating procedures of the instructions, and cDNA was synthesized using a TaKaRa PrimeScript TM 1st Strand cDNA Synthesis Kit (TaKaRa, Beijing, China) kit according to the operating procedures of the instructions.

[0035] Using cDNA as a template, primers SrMYB1-F and SrMYB1-R were designed according to the coding region of SrMYB1 gene, and the primer sequences were 5'-TCAGTCGATACAACTTTTTGGGA-3' (SEQ ID No. 2); 5'-AACAGACAAATCAAAATGGGAAACG-3' (SEQ ID No. 3), and PCR amplification was performed. The amplification reaction system is as follows in Table 1:

[0036] Table 1 PCR amplification reaction system

[0037]

[0038] PCR reaction program was: 94℃, 3min; 94℃, 30s, 58℃, 30s, 72℃, 90s, 35 cycles; 72℃, 5min, 4℃ preservation, PCR product was detected using 2% agarose gel electrophoresis, the results are shown in Figure 1 .

[0039] The SanPrep column DNA gel recovery kit (Shanghai Shengong Bioengineering Technology Service Co., Ltd.) was used according to the operation process of the instruction manual. According to the operation process of the pLB zero background rapid cloning kit (TIANGEN, China), after the target fragment was connected, positive bacteria screening was performed, and the positive bacteria were sent to Shanghai Shengong for sequencing. After successful sequencing, the positive bacteria plasmid was extracted using the rapid plasmid extraction kit (TIANGEN, China) according to the operation process of the instruction manual, and was used for the next step of expression vector construction. The results are shown in Figure 2The plasmid successfully connecting the target gene (SrMYB1 gene) was proved by the result shown. By sequencing, the CDS sequence of SrMYB1 gene was determined as: ATGTTAGGCACAGAAGAAATGTCAAGTACACCAGTTGGAGTGAGAAAAGGTGCATGGACTGAAGATGAAGATAAACTTCTCCGGAAATGCATTGACAAGTATGGAGAAGGAAAATGGCATCAAGTTCCTCTCAGATCAGGGTTGAACAGATGCAGGAAGAGCTGTAGGCTGAGGTGGTTAAACTATCTGAGGCCAAATATCAAAAGAGGAGAGTTCACACCAGATGAAGATGATCTCATTATAAGGCTTCATAACTTGTTAGGAAACAGATGGTCACTGATATCCGGTAGACTTCCTGGAAGAACAGGCAACGACGTGAAAAACCATTGGAACACCCATCTGCAGAAGAAGGTATTGGCTGGAGAAGAGGGGGAGAGGAAAGCCCAAAAAACCACGAAAACGACAATCTTGAGACCTCGACCTCTGACCTTCAAAAGAATTGGATCTCTTTCGCCAAGAGAGAACGTGAATGATATTTCAGTAACTGATCAAAATTCAGACGTTCCATCTCCATCATCGTCAAAACAAGTGGACGATGCATGCACCCAATGGTGGAGTAATTACTTGCTTGATTCTGTCGAGATTGATCATGGAGAAACTGAGCCAGGATCTGAAGGAATATCTCTGGAATTGCACCAAGACAATGGCTGCTGGAATGACTTTTCTCTTGACAAGGGCATTTGGGAACTTCTGAGTTCTGAAAACATCATATGA (SEQ ID No. 1).

[0040] The CDS of the gene is 714 bp.

[0041] Example 2 Construction of expression vector of SrMYB1 gene and transformation

[0042] I. Construction of SrMYB1 expression vector

[0043] Gateway Cloning kit (Invitrogen, USA) kit according to the instructions design primers SrMYB1-attB1-F and SrMYB1-attB2-R, the sequence of SrMYB1-attB1-F primer is: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTATGTTAGGCACAGAAGA-3' (SEQ ID No. 4), the sequence of SrMYB1-attB2-R primer is: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCATATGATGTTTTCAGA-3' (SEQ ID No. 5). Using 2xPfu PCR Mix (TIANGEN, China) according to the instructions operation process to amplify SrMYB1 plasmid, the reaction system of amplifying SrMYB1 plasmid is as follows Table 2:

[0044] Table 2 Reaction system for amplifying SrMYB1 plasmid

[0045]

[0046] PCR reaction program is: 94℃, 3min; 94℃, 30s, 58℃, 30s, 72℃, 2min, 30 cycles; 72℃, 5min, 4℃ preservation, PCR product is detected using 2% agarose gel electrophoresis. The results are shown in Figure 3 .

[0047] Recovery of PCR products, according to the Gateway Cloning kit (Invitrogen, USA) kit instructions operation process to construct SrMYB1 expression vector.

[0048] (1) Construction of entry vector (Bp reaction): the CDS sequence of SrMYB1 gene is connected to the entry vector pDONR207, and pDONR207-SrMYB1 is obtained.

[0049] (2) Construction of expression vector (LR reaction): pDONR207-SrMYB1 and expression vector pJAM1502 are recombined to obtain expression vector pJAM1502-SrMYB1.

[0050] The results are shown in Figure 4 , which proves that the expression vector pJAM1502-SrMYB1 is successfully constructed. The successfully constructed expression vector pJAM1502-SrMYB1 is transformed into E. coli DH5α competent cells, and positive bacteria are picked and the plasmid is extracted for the next step of Agrobacterium transformation.

[0051] II. SrMYB1 expression vector into Agrobacterium

[0052] The pJAM1502-SrMYB1 expression vector was transformed into Agrobacterium GV3101 by freeze-thaw method. The specific method is as follows:

[0053] 1. The GV3101 Agrobacterium competent cells were dissolved on ice, and the reaction system was as follows: 1 μL pJAM1502-SrMYB1 expression vector, 100 μL Agrobacterium competent cells were taken respectively. After mixing well, ice bath for 30 min, then frozen in liquid nitrogen for 5 min, immediately taken out and water bath in 37°C water bath for 5 min, finally placed on ice for 5 min.

[0054] 2. In the clean bench, 500 μL of YEP liquid medium (Agrobacterium culture medium) was added to the above reaction system, and after sealing, it was placed in a shaking bed at 220 rpm and 28°C for 2 h.

[0055] 3. In the clean bench, 100 μL of the shaken bacteria liquid was sucked and spread on YEP solid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and cultured at 28°C in the dark for two days.

[0056] 4. The colonies were detected by PCR using primers SrMYB1-attB1-F and SrMYB1-attB2-R. The results are shown in Figure 5 , which proves that the SrMYB1 expression vector is successfully transformed into Agrobacterium.

[0057] III. SrMYB1 gene transformation of tobacco

[0058] 1. Transformation method

[0059] The pJAM1502-SrMYB1 expression vector was transformed into the tobacco genome by Agrobacterium-mediated transformation method, and the specific method was as follows:

[0060] (1) After the tobacco (Nicotiana tabacum L.) sterile tissue culture seedlings were cultured for 2-3 weeks, the leaves were cut into about 1 cm x 1 cm in length x width, and the cut leaves were placed in Agrobacterium liquid containing pJAM1502-SrMYB1 expression vector for 10 min, and the concentration of Agrobacterium was about 0.6 (OD600).

[0061] (2) After the bacteria liquid on the leaves was absorbed with sterile water paper, it was placed on the basic medium and cultured at 28°C in the dark for 2 days. Then the leaves were transferred to the basic medium containing 300 mg / L cefotaxime and 50 mg / L kanamycin (Diamond, Shanghai, China) for resistance screening.

[0062] (3) When the leaf differentiation seedlings grow to about 1.5 cm, the seedlings are transferred to MS medium containing 300 mg / L cefotaxime and 50 mg / L kanamycin, and cultured for 20 days at 25°C, to obtain SrMYB1 gene transformed tobacco.

[0063] 2. Identification and detection of transgenic tobacco overexpressing SrMYB1 gene

[0064] (1) PCR identification

[0065] Experimental method: The DNA of transformed tobacco is amplified using specific primers SrMYB1-attB1-F and SrMYB1-attB2-R to identify the transgenic tobacco. The amplification reaction system of SrMYB1 gene in tobacco is shown in Table 3:

[0066] Table 3 Amplification reaction system of SrMYB1 gene in tobacco

[0067]

[0068] The PCR reaction program is: 94°C, 3 min; 94°C, 30 s, 58°C, 30 s, 72°C, 90 s, 35 cycles; 72°C, 5 min, 4°C storage, and the PCR product is detected by 2% agarose gel electrophoresis.

[0069] Experimental results: Through PCR detection, a total of 4 transgenic tobacco lines overexpressing SrMYB1 were screened, as shown in Table 4. Figure 6

[0070] (2) Phenotype observation identification

[0071] As shown in Table 5, the phenotype observation of transgenic tobacco lines found that, compared with wild type tobacco (Nicotiana tabacum L.), the transgenic tobacco different tissues significantly accumulated anthocyanins. The wild type tobacco root was white, stem, leaf, fruit, seed were green, and flower was light pink; compared with wild type tobacco, the root, stem, leaf, flower, fruit, seed of transgenic tobacco significantly accumulated anthocyanins. It is proved that the transformation method of the present embodiment successfully obtained the transgenic tobacco lines with anthocyanin accumulation. Figure 7 (3) Total anthocyanin detection

[0072]

[0073] ​​The total anthocyanin content detection method is as follows: 0.1 g of wild type tobacco (Nicotiana tabacum L.) leaves and transgenic tobacco leaves obtained in the embodiment are precisely weighed, placed in 50 ml brown volumetric flasks, 25 ml of extraction solution (concentrated HCl: 80% methanol = 1:1000, V / V) is added, the flasks are tightly sealed and weighed, ultrasonic treatment is performed for 1 h, then the flasks are weighed again, the deficiency is made up with the extraction solution, and the flasks are shaken uniformly to obtain a test solution of the wild type tobacco leaves and a test solution of the transgenic tobacco leaves. The test solution is prepared in two portions. One portion is diluted with a potassium chloride buffer solution (0.025 mol / L, pH 1.0), and the other portion is diluted with a sodium acetate buffer solution (0.4 mol / L, pH 4.5) (test solution: buffer solution = 1:4, v / v). The absorbance of the samples is measured at 530 nm and 700 nm within 20-50 min, and the anthocyanin content is calculated.

[0074] The detection results are shown in Table 1. Figure 8 The total anthocyanin content is detected, and it is found that the total anthocyanin content in the leaves of the transgenic tobacco strain overexpressing the SrMYB1 gene is significantly increased, which is about 12.8 times that of the total anthocyanin content in the leaves of the wild type tobacco (Nicotiana tabacum L.).

[0075] As can be seen from the above embodiment, the SrMYB1 gene is isolated from Syringa reticulata, the SrMYB1 gene is constructed into an expression vector by genetic engineering technology, and a transgenic tobacco overexpressing the SrMYB1 gene is obtained by using the agrobacterium-mediated infection method. The roots, stems, leaves, flowers, fruits, seeds and other different tissues of the transgenic tobacco of the embodiment all significantly accumulate anthocyanin and are purple. The total anthocyanin content in the leaves of the transgenic tobacco of the embodiment is about 12.8 times that of the wild type tobacco. It is shown that the SrMYB1 gene isolated from Syringa reticulata in the embodiment can be used to increase the anthocyanin content in tobacco, and more choices are provided for the biosynthesis of anthocyanin, and the SrMYB1 gene has a good application prospect in the biosynthesis of anthocyanin.

Claims

1. A method for preparing transgenic plants with high anthocyanin production, characterized in that: It is to SrMYB1 The gene was transferred into plants to obtain plants expressing the SrMYB1 protein; SrMYB1 The CDS sequence of the gene is shown in SEQ ID No. 1, and the plant is tobacco.

2. The method according to claim 1, characterized in that: The method for transferring the substance into the plant is one of the following: Agrobacterium-mediated transformation, gene gun method, electroporation, PEG-mediated transformation, liposome method, or calcium phosphate-DNA coprecipitation method.

3. SrMYB1 The use of genes, recombinant plasmids, or recombinant bacteria in the production of transgenic plants with high anthocyanin yields, characterized by: The SrMYB1 The CDS sequence of the gene is shown in SEQ ID No. 1; the recombinant plasmid includes the... SrMYB1 The CDS sequence of the gene; the recombinant bacteria contain the recombinant plasmid, and the transgenic plant is a transgenic tobacco.

4. The use according to claim 3, characterized in that: The recombinant bacteria is recombinant Agrobacterium.

5. The use according to claim 4, characterized in that: The recombinant Agrobacterium is a recombinant Agrobacterium tumefaciens.

Citation Information

Patent Citations

  • SoMYB1 gene and application thereof in preparation of transgenic plant with high yield of cyanidin-3-O-rutinoside

    CN118813644A