IS26-based drug-resistant gene resistance and control plasmid, engineering bacterium, microbial inoculum and application of IS26-based drug-resistant gene resistance and control plasmid, engineering bacterium and microbial inoculum

Abstract

The invention discloses an IS26-based drug-resistant gene resistance and control plasmid, an engineering bacterium, a fungicide and application, and belongs to the technical field of gene engineering, and the nucleotide sequence of the IS26-based drug-resistant gene resistance and control plasmid is shown as SEQ ID NO: 1 or SEQ ID NO: 2. Engineering bacteria containing the drug-resistant gene resistance and control plasmid and a microbial inoculum can be used for resistance and control of drug-resistant genes, and the insertion sequence IS26 is specifically destroyed, so that the number of the drug-resistant genes is fundamentally reduced, spreading of the drug-resistant genes is blocked, and a precise solution is provided for treatment of drug resistance; the compound has broad-spectrum drug-resistant bacterium resistance and control performance, gentamicin, tetracycline, chloramphenicol and ampicillin drug-resistant bacteria in wastewater can be effectively prevented and controlled, and the highest resistance and control efficiency can reach 83.76%; the plasmid, the engineering bacterium and the fungicide are low in preparation cost, can be used for in-situ wastewater treatment, are low in treatment cost and good in effect, and have wide application prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a drug-resistant gene plasmid based on IS26, a drug-resistant gene barrier engineering bacterium, a bacterial agent and applications. Background Art

[0002] With the rapid development of animal husbandry, the post-treatment and discharge of aquaculture wastewater have become increasingly prominent, especially the pollution of drug-resistant bacteria and drug-resistant genes in aquaculture wastewater. The emergence of this phenomenon is closely related to the extensive use of antibiotics in aquaculture - antibiotics are widely used to prevent and treat livestock and poultry diseases, promote growth, etc. After the antibiotics that are not completely metabolized in livestock and poultry enter the aquaculture wastewater, they provide a breeding ground for the growth of drug-resistant bacteria and the spread of drug-resistant genes.

[0003] Pathogens such as Escherichia coli, Salmonella, Klebsiella, Pseudomonas, and Acinetobacter commonly found in aquaculture wastewater are not only susceptible to antibiotic resistance such as tetracycline, sulfonamides, and quinolones, but the drug-resistant genes they carry can also be spread between different bacterial species through mobile genetic elements such as plasmids and transposons. The insertion sequence IS26 is particularly noteworthy. Many studies have shown that it is a highly active gene transfer vector and is often associated with a variety of drug-resistant genes (such as tetM, blaCTX-M It is directly connected to the host cell (such as mitochondria) and promotes the capture and spread of drug-resistant genes by forming a composite transposon structure, becoming a key driving factor for the spread of drug resistance.

[0004] The existing technology for treating drug-resistant bacteria in aquaculture wastewater has significant limitations: although conventional physical and chemical methods such as chlorine disinfection and ultraviolet light can inactivate some bacteria, they cannot degrade free drug-resistant gene fragments and may produce toxic byproducts; although biological treatment methods such as activated sludge and biofilm can remove organic matter and some pathogens, they provide a microbial enrichment environment for the horizontal transfer of drug-resistant genes; some emerging treatment methods, such as photocatalytic oxidation and advanced oxidation, have a degradative effect on drug-resistant genes, but their high cost and complex operation limit their large-scale application. These methods lack the ability to specifically block mobile elements such as IS26, making it difficult to curb the transmission chain of drug-resistant genes. Based on the core role of IS26 in the spread of drug-resistant genes, the development of targeted in situ blocking and control technologies has important potential. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a drug-resistant gene-control plasmid for controlling the insertion sequence IS26; the second purpose is to provide drug-resistant gene-control engineering bacteria, bacterial agents and applications containing the plasmid.

[0006] Technical solution: The IS26-based drug-resistant gene control plasmid of the present invention has a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0007] The drug-resistant gene control engineering bacteria described in the present invention are donor bacteria containing the aforementioned IS26-based drug-resistant gene control plasmid.

[0008] Preferably, the donor bacteria is Escherichia coli S17-1 λpir or Escherichia coli SM10 λpir.

[0009] The drug-resistant gene blocking bacteria agent of the present invention contains the live bacteria of the drug-resistant gene blocking engineered bacteria.

[0010] The invention discloses an application of the drug-resistant gene blocking engineered bacteria or the drug-resistant gene blocking bacterial agent in in-situ treatment of drug-resistant bacteria in wastewater.

[0011] Preferably, the application is the in-situ treatment of drug-resistant bacteria in wastewater from livestock and poultry farms.

[0012] Preferably, the livestock and poultry farm is a pig farm or a cattle farm.

[0013] Preferably, the drug-resistant bacteria are Gram-negative drug-resistant bacteria containing an IS26 insertion sequence.

[0014] Preferably, the application step includes: adding drug-resistant gene blocking engineered bacteria or drug-resistant gene blocking bacterial agent to the wastewater, fully mixing and treating for 12-36 hours, wherein the final concentration of the drug-resistant gene blocking engineered bacteria is 1-100 times the bacterial concentration in the wastewater.

[0015] Preferably, the final concentration of the drug-resistant gene barrier engineering bacteria is not less than 10 times the bacterial concentration in the wastewater.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. By specifically destroying the insertion sequence IS26, the number of drug-resistant genes can be fundamentally reduced, the spread of drug-resistant genes can be blocked, and a precise solution can be provided for drug resistance management; 2. It has a broad-spectrum drug-resistant bacteria control performance, and can effectively control gentamicin, tetracycline, chloramphenicol, and ampicillin-resistant bacteria, with a control efficiency of up to 83.76%; 3. It can be used for in-situ wastewater treatment with low treatment cost and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a diagram showing the knockout efficiency of IS26 by different sgRNAs;

[0018] Figure 2 The escape frequency diagram of IS26 knockout by different sgRNAs;

[0019] Figure 3The results of drug-resistant gene control engineering bacteria removing drug-resistant genes in Escherichia coli J53 / pUC57-IS26, where (A) is the control efficiency diagram for drug-resistant Escherichia coli J53 / pUC57-IS26, and (B) is the IS26 and ampicillin resistance genes in drug-resistant Escherichia coli J53 / pUC57-IS26 treated with different treatments bla , the relative copy number of the plasmid replication origin ori uidA The difference fold diagram, (C) is the result of the determination of the minimum inhibitory concentration of antibiotics for the drug-resistant E. coli J53 / pUC57-IS26 and E. coli J53 under different treatments;

[0020] Figure 4 The results of drug-resistant gene control engineering bacteria to eliminate drug-resistant genes in Klebsiella pneumoniae ATCC13883 / pEX18Gm-IS26, where (A) is the control efficiency diagram of drug-resistant Klebsiella pneumoniae ATCC13883 / pEX18Gm-IS26, and (B) is the IS26 and gentamicin resistance genes in drug-resistant Klebsiella pneumoniae ATCC13883 / pEX18Gm-IS26 treated with different treatments aacC1 , the relative copy number of the plasmid replication origin ori uidA The difference fold diagram, (C) is the result of the determination of the antibiotic minimum inhibitory concentration of resistant Klebsiella pneumoniae ATCC13883 / pEX18Gm-IS26 and Klebsiella pneumoniae ATCC13883 under different treatments;

[0021] Figure 5 This is the control result diagram of drug-resistant bacteria in the in-situ treatment of pig farm wastewater, where CK means untreated;

[0022] Figure 6 This is the control result diagram of drug-resistant bacteria in the in-situ treatment of cattle farm wastewater, where CK means untreated;

[0023] Figure 7 This is the result of detecting the abundance of the insertion sequence IS26 after in-situ treatment of aquaculture wastewater, where CK means untreated. DETAILED DESCRIPTION

[0024] The technical solution of the present invention is further described below.

[0025] Example 1: Design and verification of sgRNA

[0026] 1. Construction of pCas9-sgRNA plasmid

[0027] (1) Design sgRNA1 and sgRNA2 targeting IS26, and design sgRNA0 that does not target IS26 as a negative control. To facilitate subsequent insertion, design restriction enzyme cutting sites at the same time;

[0028] The complete sequences of the forward and reverse strands of the specific sgRNA are as follows, where lowercase letters represent restriction sites and uppercase letters represent sgRNA:

[0029] sgRNA0-F, as shown in SEQ ID NO: 6: aaacTTCGACGTGAACTTGGTACGg;

[0030] sgRNA0-R, as shown in SEQ ID NO: 7: aaaacCGTACCAAGTTCACGTCGAA;

[0031] sgRNA1-F, as shown in SEQ ID NO: 8: aaacTTCAGCGTGACATCATTCTGg;

[0032] sgRNA1-R, as shown in SEQ ID NO: 9: aaaacCAGAATGATGTCACGCTGAA;

[0033] sgRNA2-F, as shown in SEQ ID NO: 10: aaacCGATCTTTGCCCGTGGCACAg;

[0034] sgRNA2-R, as shown in SEQ ID NO: 11: aaaacTGTGCCACGGGCAAAGATCG;

[0035] (2) The sgRNA was synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The positive and reverse strands were incubated at 95°C for 5 minutes and then at 50°C for 1 minute to obtain double-stranded sgDNA;

[0036] (3) Digest the pCas9 plasmid with BsaI endonuclease at 37°C for 1 h, and then cut the gel to recover the linearized vector;

[0037] (4) The double-stranded sgRNA and linearized vector were ligated using T4 ligase at 16°C for 16 h;

[0038] (5) The ligation product was transformed into E. coli DH5α, plated on LB plates containing chloramphenicol for screening, and cultured at 37°C for 14 h. Single clones were selected for sequencing to ensure successful insertion of sgRNA.

[0039] 2. Determination of knockout activity of sgRNA

[0040] (1) Designing the pUC57-IS26 plasmid with the sequence shown in SEQ ID NO: 4 and submitting it to Nanjing Qingke Biotechnology Co., Ltd. for synthesis;

[0041] (2) Transforming the pUC57-IS26 plasmid into Escherichia coli J53, obtaining Escherichia coli J53 containing the pUC57-IS26 plasmid by screening the resistance gene tag of the transformed plasmid, and preparing the Escherichia coli DH5α containing the pUC57-IS26 plasmid into competent cells;

[0042] (3) Transform pCas9-sg0, pCas9-sg1, and pCas9-sg2 into the above competent cells respectively;

[0043] (4) Spread a portion of the transformed bacteria on a plate containing chloramphenicol to represent all transformants. At the same time, spread the same volume of bacteria on a plate containing chloramphenicol and ampicillin to screen for bacteria that have not been successfully knocked out.

[0044] (5) Calculate the knockout efficiency according to formula (I),

[0045] Knockout efficiency (%) = [1-(bacteria that failed to be knocked out ÷ total transformants)] × 100 （I） ;

[0046] (6) Calculate the escape rate according to formula (II):

[0047] Escape rate (%) = (bacteria that were not successfully knocked out ÷ total transformants) × 100 (II);

[0048] The results are as follows Figure 1 , 2 As shown in Figure 2, the editing efficiency of the two sgRNAs targeting IS26 is as high as over 99%. The escape rate was measured and it was found that the escape rates of the two sgRNAs targeting IS26 were extremely low, at 10 -3.95 and 10 -5.22 , it can be concluded that the designed sgRNA has strong targeting and high activity to IS26.

[0049] Example 2: Design and synthesis of drug-resistant gene-blocking plasmids, preparation and verification of drug-resistant gene-blocking engineered bacteria

[0050] 1. Construction of drug-resistant gene control plasmid and drug-resistant gene control engineering bacteria

[0051] (1) Designing a pEdit plasmid having a nucleotide sequence as shown in SEQ ID NO: 3, and combining it with the sgRNA targeting IS26 designed in Example 1, obtaining drug-resistant gene blocking plasmids having nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. According to the results of Example 1, the plasmid having a nucleotide sequence as shown in SEQ ID NO: 2 was selected as the drug-resistant gene blocking plasmid in subsequent experiments;

[0052] (2) The drug-resistant gene control plasmid designed above was delivered to Nanjing Qingke Biotechnology Co., Ltd. for synthesis, and at the same time, the drug-resistant gene control plasmid pEdit-sgRNA was obtained;

[0053] (3) The pEdit-sgRNA and pCas9-sg2 plasmids were transformed into Escherichia coli S17-1 λpir, and the drug-resistant gene-controlled engineered bacteria containing the pEdit-sgRNA plasmid and the control engineered bacteria containing the pCas9-sg2 plasmid were obtained by screening with the mCherry tag and chloramphenicol resistance gene, respectively.

[0054] 2. Verification of drug-resistant gene-blocking engineering bacteria

[0055] (1) The pEX18Gm-IS26 plasmid with the sequence shown in SEQ ID NO: 5 was designed and delivered to Nanjing Qingke Biotechnology Co., Ltd. for synthesis;

[0056] (2) The pEX18Gm-IS26 plasmid was transformed into Klebsiella pneumoniae ATCC13883, and the Klebsiella pneumoniae ATCC13883 containing the pEX18Gm-IS26 plasmid was obtained by screening the resistance gene tag of the transformed plasmid;

[0057] (3) The drug-resistant gene-blocking engineered bacteria, the control engineered bacteria, the Escherichia coli J53 containing the pUC57-IS26 plasmid obtained in Example 1, and the Klebsiella pneumoniae ATCC13883 containing the pEX18Gm-IS26 plasmid were streaked on LB plates and cultured at 37°C for 14 h;

[0058] (4) Pick a single clone and culture it in LB liquid medium without antibiotics or with corresponding antibiotics at 37°C for 14 h;

[0059] (5) Transfer the overnight cultured bacteria into fresh LB liquid medium containing the corresponding antibiotics and culture until the OD 600 =0.5;

[0060] (6) Thoroughly mix 200 μL of drug-resistant gene-blocking engineered bacteria or control engineered bacteria and 200 μL of Escherichia coli J53 containing pUC57-IS26 plasmid or Klebsiella pneumoniae ATCC13883 containing pEX18Gm-IS26 plasmid, respectively, and drop them onto the center of a 0.2 μm filter membrane. Stick the filter membrane onto LB medium without antibiotics and culture at 37°C for 24 h.

[0061] 2.1 Determination of resistance control efficiency

[0062] The bacteria on the filter membrane were washed with sterile PBS, and the bacteria were spread on LB plates containing corresponding antibiotics in a stepwise dilution manner, and cultured at 37°C for 24 hours, and the control efficiency was calculated;

[0063] Control of drug resistance of E. coli J53 containing pUC57-IS26 plasmid: E. coli J53 itself has sodium azide resistance, so bacteria on sodium azide resistance plates that spontaneously emit mCherry red fluorescence represent conjugated bacteria. Bacteria on sodium azide and ampicillin double resistance plates that spontaneously emit mCherry red fluorescence represent uncontrolled bacteria. The control efficiency (i.e., knockout efficiency) is calculated according to the above formula (I);

[0064] Control of drug resistance of Klebsiella pneumoniae ATCC13883 containing pEX18Gm-IS26 plasmid: Klebsiella pneumoniae ATCC13883 itself has ampicillin resistance, so bacteria on ampicillin resistance plates that spontaneously emit mCherry red fluorescence represent conjugated bacteria. Bacteria on ampicillin and gentamicin double resistance plates that spontaneously emit mCherry red fluorescence represent uncontrolled bacteria. The control efficiency (i.e., knockout efficiency) was calculated according to the above formula (I).

[0065] 2.2 Gene copy number determination

[0066] (1) Extract the whole genome DNA of the strain to be tested and dilute the DNA concentration of all samples to 1 ng / μL;

[0067] (2) Real-time fluorescence quantitative PCR was used to determine the copy number of drug resistance genes, IS26 and plasmid replication origin in bacteria. The internal reference gene was uidA , the specific primers are as follows:

[0068] blaTEM-F, as shown in SEQ ID NO: 12: CTACGATACGGGAGGGCTTA;

[0069] blaTEM-R, as shown in SEQ ID NO: 13: ATAAATCTGGAGCCGGTGAG;

[0070] aacC1-F, as shown in SEQ ID NO: 14: CATCATTCGCACATGTAGGCTCGG;

[0071] aacC1-R, as shown in SEQ ID NO: 15: GCTGATGTTGGGAGTAGGTGGCTA;

[0072] IS26-F, as shown in SEQ ID NO: 16: TCGATCACTCCACGATTTACCGCT;

[0073] IS26-R, as shown in SEQ ID NO: 17: GTAGGTTTCATCCATGTGCCACGG;

[0074] ori-F, as shown in SEQ ID NO: 18: GGTGGTTTGTTTGCCGGATCAAGA;

[0075] ori-R, as shown in SEQ ID NO: 19: ACAGAGTTCTTGAAGTGGTGGCCT;

[0076] uidA-F, as shown in SEQ ID NO: 20: TCTGGCAACCGGGTGAAG;

[0077] uidA-R, as shown in SEQ ID NO: 21: TAGATATCACACTCTGTCTGGCT;

[0078] The qPCR reaction system is shown in Table 1, and the reaction conditions are shown in Table 2:

[0079] Table 1 qPCR reaction system

[0080]

[0081] Table 2 qPCR reaction conditions

[0082]

[0083] Three replicate qPCR reactions were performed to obtain uidA The average Ct value of the gene was calculated and the fold change of each gene under test in each sample was determined using the ΔΔCT method to represent the relative copy number change of the gene.

[0084] 2.3 Antibiotic Minimum Inhibitory Concentration (MIC) Determination

[0085] (1) The antibiotics were diluted two-fold in a 96-well plate. The concentration gradient of ampicillin was 0, 2, 4, 8, 16, 32, 64, 128, 256, 512 g / L, and the concentration gradient of gentamicin was 0, 2, 4, 8, 16, 32, 64, 128 g / L.

[0086] (2) Dilute the overnight cultured strain to an OD of 600 = 1, and then diluted 1000 times with MH medium, and 100 μL was added to the 96-well plate containing antibiotics. After culturing at 37°C for 24 hours, the OD was measured by microplate reader. 600 , each treatment was repeated 3 times;

[0087] The results of the antibiotic minimum inhibitory concentration of Escherichia coli J53 after treatment are as follows: Figure 3 :like Figure 3As shown in (A), the control efficiency of pEdit-sgRNA on the drug-resistant plasmid pUC57-IS26 in Escherichia coli J53 is extremely high, reaching more than 99%; Figure 3 As shown in (B), the copy number of several key genes on the drug-resistant plasmid pUC57-IS26 was determined, and the insertion sequence IS26, ampicillin resistance gene bla The copy numbers of pEdit-sgRNA were all reduced to 0, indicating that pEdit-sgRNA completely eliminated the bacterial resistance gene. At the same time, the replication initiator ori of the plasmid was also reduced to 0, further indicating that the resistance plasmid had been completely eliminated. Figure 3 As shown in (C), the bacterial MIC results showed that pEdit-sgRNA restored the sensitivity of Escherichia coli that was originally resistant to ampicillin to ampicillin;

[0088] The results of the antibiotic minimum inhibitory concentration of Klebsiella pneumoniae ATCC13883 after treatment are as follows Figure 4 :like Figure 4 As shown in (A), the blocking efficiency of pEdit-sgRNA on the drug-resistant plasmid pEX18Gm-IS26 in Klebsiella pneumoniae ATCC13883 is also extremely high, reaching more than 99%; Figure 4 As shown in (B), the copy number of several key genes on the drug-resistant plasmid pEX18Gm-IS26 was determined, and the insertion sequence IS26, gentamicin resistance gene aacC1 The copy numbers of pEdit-sgRNA were all reduced to 0, indicating that pEdit-sgRNA completely eliminated the drug-resistant genes in the bacteria, and the replication initiator ori of the plasmid was also reduced to 0, further indicating that the drug-resistant plasmid had been completely eliminated; Figure 4 As shown in (C), the bacterial MIC results indicate that pEdit-sgRNA restored the sensitivity of Klebsiella pneumoniae, which was originally resistant to gentamicin, to gentamicin.

[0089] In summary, pEdit-sgRNA has a broad spectrum of drug-resistant gene control properties.

[0090] Example 3: Drug-resistant gene-controlled engineered bacteria are used to in situ control drug resistance of aquaculture wastewater bacteria

[0091] (1) A pig farm and a cattle farm were selected in a certain place, and the aquaculture wastewater was collected. The collected aquaculture wastewater was diluted 10 times in stages, with a gradient of original solution, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , spread on LB plates and culture at 37℃ for 24h, and calculate the bacterial concentration in the aquaculture wastewater;

[0092] (2) The drug-resistant gene barrier engineering bacteria and the control engineering bacteria constructed in Example 2 were streaked on LB plates and cultured at 37°C for 14 h;

[0093] (2) Pick a single clone and culture it in LB liquid medium at 37°C for 14 h;

[0094] (3) Transfer the overnight cultured bacteria into fresh LB liquid medium containing the corresponding antibiotics and culture until the OD 600 =0.5;

[0095] (4) Add drug-resistant gene-blocking engineered bacteria or control engineered bacteria according to the bacterial concentration in the aquaculture wastewater obtained in step 1. The final concentration of the engineered bacteria is 10 times the bacterial concentration in the wastewater. After fully mixing, leave it to stand at room temperature for 24 hours;

[0096] (5) Add drug-resistant gene-controlled engineered bacteria or control engineered bacteria according to the bacterial concentration in the aquaculture wastewater. The final concentration of the engineered bacteria is 10 times the bacterial concentration in the wastewater. After thorough mixing, leave it to stand at room temperature for 24 hours.

[0097] 1. Determination of the number of bacteria with different drug resistance in aquaculture wastewater after treatment

[0098] After 24 hours, the aquaculture wastewater was diluted 10 times in stages, with the gradient being original solution, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , spread on ampicillin, chloramphenicol, tetracycline, and gentamicin resistance plates respectively, culture at 37°C for 24 hours, and count the number of resistant bacteria.

[0099] 2. Determination of the absolute copy number of IS26 in treated aquaculture wastewater

[0100] (1) Streak the E. coli DH5α containing the pUC57-IS26 plasmid on an LB plate containing ampicillin and culture at 37°C for 14 h.

[0101] (2) Pick a single clone and culture it in LB liquid medium containing the corresponding antibiotics at 37°C for 14 h;

[0102] (3) Extract the plasmid, determine the plasmid concentration, and dilute it 10 times in stages (stock solution, 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10-7 , 10 -8 ), the standard curve of IS26 was constructed by real-time fluorescence quantitative PCR, and the specific primers are as follows:

[0103] IS26-F2, as shown in SEQ ID NO: 22: GTAGGTTTCATCCATGTGCCACGG;

[0104] IS26-R2, as shown in SEQ ID NO: 23: TCGATCACTCCACGATTTACCGCT;

[0105] The qPCR reaction system and reaction conditions were the same as in Example 2;

[0106] (4) Extract DNA from aquaculture wastewater, amplify IS26 using the above primers, reaction system and conditions, and substitute the obtained CT value into the IS26 standard curve obtained in step 3 to obtain the absolute abundance of IS26.

[0107] The results of the determination of the number of bacteria with different drug resistance in the treated pig farm wastewater are as follows: Figure 5 The results of the determination of the number of bacteria with different drug resistance in cattle farm wastewater are shown in Figure 6 As shown in the data, pEdit-sgRNA effectively blocked gentamicin, tetracycline, chloramphenicol, and ampicillin-resistant bacteria in pig and cattle farm wastewater. Among them, the number of tetracycline-resistant bacteria in pig farm wastewater was particularly reduced, reaching 83.76%.

[0108] The results of the absolute copy number determination of IS26 in the treated aquaculture wastewater are as follows Figure 7 As shown in the figure, pEdit-sgRNA significantly reduced the copy number of the insertion sequence IS26 in the wastewater of pig farms and cattle farms, with the reduction ratio reaching 58.14% and 30.56%, respectively. The above results suggest that the number of IS26-related drug resistance genes has been significantly reduced.

Claims

1. A drug resistance gene control plasmid based on IS26, characterized in that: The plasmid has a nucleotide sequence as shown in SEQ ID NO:1 or SEQ ID NO:

2.

2. A drug-resistant gene-blocking engineered bacterium, characterized in that: The engineered bacteria are donor bacteria containing the IS26-based drug-resistant gene control plasmid as described in claim 1.

3. The drug-resistant gene-blocking engineering bacteria according to claim 2, characterized in that: The donor bacteria is Escherichia coli S17-1 λpir or Escherichia coli SM10 λpir.

4. A drug-resistant gene control agent, characterized in that: The bacterial agent contains live bacteria of the drug-resistant gene-controlled engineered bacteria as described in claim 2.

5. Use of the drug-resistant gene blocking engineered bacteria described in claim 2 or the drug-resistant gene blocking bacterial agent described in claim 4 in the in-situ treatment of drug-resistant bacteria in wastewater.

6. The use according to claim 5, characterized in that: The application is the in-situ treatment of drug-resistant bacteria in wastewater from livestock and poultry farms.

7. The use according to claim 6, characterized in that: The livestock and poultry farm is a pig farm or a cattle farm.

8. The use according to claim 5, characterized in that: The drug-resistant bacteria are Gram-negative drug-resistant bacteria containing IS26 insertion sequences.

9. The use according to claim 5, characterized in that: The application steps include: adding drug-resistant gene blocking engineering bacteria or drug-resistant gene blocking bacterial agent into wastewater, fully mixing and treating for 12-36 hours, wherein the final concentration of drug-resistant gene blocking engineering bacteria is 1-100 times the bacterial concentration in the wastewater.

10. The use according to claim 9, characterized in that: The final concentration of drug-resistant gene-blocking engineered bacteria shall not be less than 10 times the bacterial concentration in the wastewater.

Images