Nucleic acid product for detecting 4q genotype in Chr4q35 region and application of nucleic acid product

Abstract

The invention provides a nucleic acid product for detecting a 4q genotype in a Chr4q35 region and application of the nucleic acid product. The nucleic acid product comprises one or two of the following primer pairs: a first primer pair with a forward primer sequence as shown in SEQ ID NO: 1 and a reverse primer sequence as shown in SEQ ID NO: 2; the forward primer sequence of the second primer pair is shown as SEQ ID NO: 3, and the reverse primer sequence of the second primer pair is shown as SEQ ID NO: 4.

Description

Technical Field

[0001] The present application relates to the field of molecular biology technology, and in particular to a nucleic acid product for detecting 4q genotype in the Chr4q35 region and its application. Background Art

[0002] Facioscapulohumerial muscular dystrophy (FSHD) is a progressive neuromuscular disease. It is the most common hereditary myopathy after Duchenne muscular dystrophy and myotonic dystrophy, with an incidence of about 1 / 20,000. It is mainly manifested by symmetrical or asymmetrical muscle weakness and atrophy, involving the facial muscles, shoulder girdle muscles and upper arm muscles, showing typical appearances such as cat face, fish mouth, winged scapula, free shoulder, and hanger shoulder, and gradually progresses downward to involve the trunk muscles and lower limb muscles. The penetrance rate reaches 95% at the age of 20. More severe FSHD patients also have problems with vision, hearing, or intelligence.

[0003] FSHD is divided into FSHD type 1 (OMIM: # 158900, accounting for 95% of the cases) and FSHD type 2 (OMIM: # 158901, accounting for 5% of the cases) according to the different pathogenic genes. FSHD type 1 is inherited in an autosomal dominant manner, and two genetic factors must exist at the same time to cause the disease: ① The number of D4Z4 repeat units in the chromosome 4q35 region is reduced. Normal people generally have 11-150 repeats, and patients have 1-10 repeats. ② The 4qA genotype exists at the far end of the last repeat unit of D4Z4. FSHD type 2 is inherited in a digenic manner, and two genetic factors must exist at the same time to cause the disease: ① Mutation of DNA methylation regulatory genes (SMCHD1 gene or DNMT3B gene); ② The 4qA genotype exists at the far end of the last repeat unit of D4Z4. In summary, the cause of FSHD is the reduction of D4Z4 repeat units or defects in methylation regulatory genes, which lead to the openness of the chromatin structure and reduced methylation in the region. The double homeobox gene 4 (DUX4) that was originally silent in the repeat region is stably expressed with the help of polyadenylic acid sequences (4qA genotype). DUX4 protein is toxic to muscle cells, leading to muscle cell apoptosis, oxidative stress, interference with myogenic differentiation, and causing myotube atrophy.

[0004] Whether it is FSHD1 or FSHD2, a 4qA genotype carrying a polyadenylation signal is a necessary condition. Currently, the representative detection methods that can directly determine the 4q genotype are Southern Blot and Bionano single-molecule optical mapping technology. Southern Blot requires high-quality DNA, the technical operation is complex, the required instruments are expensive, and there are disadvantages such as radioactive contamination, so it is difficult to promote and apply it clinically. Bionano single-molecule optical mapping technology uses nucleases to recognize, digest, resynthesize and label DNA with fluorescence, generate multiple specific digestion labeling sites within the genome, and then perform ultra-long single-molecule high-resolution fluorescence imaging. By comparing the sample genome map with the reference genome, large-fragment genomes are identified, which can be used for whole genome assembly, some types of chromosome structural variations, etc. Bionano has a shorter detection cycle than Southern Blot, but the technology platform also requires a large amount of long-fragment DNA, and the experimental cost is relatively high. In order to solve the problems of complex operation and high cost of existing detection technologies, there is an urgent need for a related technology and product for efficient and accurate identification of the 4qA genotype in the Chr4q35 region. Summary of the invention

[0005] Based on this, the present application provides a nucleic acid product for detecting the 4q genotype in the Chr4q35 region and its application.

[0006] According to the first aspect of the present application, a nucleic acid product for detecting the 4q genotype in the Chr4q35 region is provided, wherein the nucleic acid product comprises one or two pairs of the following primer pairs:

[0007] A first primer pair having a forward primer sequence as shown in SEQ ID NO: 1 and a reverse primer sequence as shown in SEQ ID NO: 2;

[0008] The second primer pair has a forward primer sequence as shown in SEQ ID NO: 3 and a reverse primer sequence as shown in SEQ ID NO: 4.

[0009] In one embodiment, the nucleic acid product includes two primer pairs, namely the first primer pair and the second primer pair.

[0010] The second aspect of the present application provides the use of the above-mentioned nucleic acid product in the preparation of a detection kit for facioscapulohumeral muscular dystrophy.

[0011] In a third aspect of the present application, a kit for detecting facioscapulohumeral muscular dystrophy is provided, wherein the kit comprises the nucleic acid product as described above.

[0012] In one embodiment, the kit further includes at least one of a negative control, a positive control, a nucleic acid extraction reagent, a PCR amplification reagent, a sequencing reagent, and an electrophoresis detection reagent.

[0013] In one embodiment, the PCR amplification reagents include one or more of PCR buffer, DNA polymerase, magnesium ions and dNTPs.

[0014] In a fourth aspect of the present application, a method for detecting the 4q genotype in the Chr4q35 region is provided, comprising the following steps:

[0015] Using the DNA of the sample to be tested as a template, using the above-mentioned nucleic acid product or the above-mentioned kit to perform PCR amplification, and obtaining the sequence information of the Chr4q35 region 4q of the sample to be tested according to the obtained amplification result;

[0016] The sequence information is analyzed, and the 4q genotype of the sample to be tested in the Chr4q35 region is determined based on the obtained analysis results.

[0017] In one embodiment, the following steps are also included:

[0018] Comparing the sequence information of the sample to be tested with the reference sequence information to determine the 4q genotype in the Chr4q35 region;

[0019] The reference sequence is shown as SEQ ID NO: 5 and / or SEQ ID NO: 6.

[0020] In one embodiment, the program of the PCR amplification reaction is set as: pre-denaturation at 94°C~96°C for 3min~5min, denaturation at 94°C~96°C for 30s~45s, annealing at 56°C~60°C for 30s~60s, extension at 70°C~74°C for 38s~42s, and cycled 30~38 times.

[0021] In one embodiment, the DNA of the sample to be tested includes peripheral blood genomic DNA, amniotic fluid cell genomic DNA and trace cell whole genome amplification products.

[0022] Compared with the traditional technology, this application has the following beneficial effects:

[0023] The present application takes the 4q site in the Chr4q35 region as the research object, and finds the best detection first primer pair (SEQ ID No: 1: 5'- GGTCAAAAGCATACCTCTGTCTG -3'; SEQ ID No: 2: 5'- CACAGGGAGGGGGCATTTTA -3') and the second primer pair (SEQ ID No: 3: 5'- TTTCCTCCGGGACAAAAGA -3'; SEQ ID No: 4: 5'-CGGCACACATGTTTGTCTC -3'). The above primer pairs can bind to the 4q site target nucleic acid sequence in the test sample more specifically, more sensitively and more accurately. A detection method for the 4q genotype in the Chr4q35 region was successfully established. Through specificity testing, the results confirmed that the method can specifically detect the 4q site in the Chr4q35 region in the sample, and can improve the detection specificity, sensitivity and accuracy compared with traditional detection methods. The detection method for detecting the 4q genotype in the Chr4q35 region established in the present application can be used to detect genomic DNA of various tissue materials and trace cell whole genome amplification products, etc.

[0024] In addition, the detection method of the present application can detect multiple samples at the same time, and has the advantages of low cost, strong versatility, and high accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the electrophoresis diagram of the single-plex detection of 4qA genotype in Example 1;

[0026] Figure 2 This is the Sanger sequencing image of the reverse primer at the 4qA site in Example 1;

[0027] Figure 3 This is the electrophoresis diagram of the single-plex detection of the 4qA (164 bp) genotype in Example 1;

[0028] Figure 4 This is the electrophoresis diagram of 4qB genotype detection in Example 1;

[0029] Figure 5 The Sanger sequencing image of the reverse primer at the 4qB site in Example 1;

[0030] Figure 6 This is the electrophoresis diagram of 4qB (405bp) genotype detection in Example 1;

[0031] Figure 7 This is the electrophoresis diagram of 4qB (3754 bp) genotype detection in Example 1;

[0032] Figure 8 The electrophoresis diagram of the double PCR in Example 1 is a mixture of primers for 4qA genotype and 4qB genotype at different ratios;

[0033] Fig. 9 The electrophoresis diagram of dual PCR of 4qA genotype and 4qB genotype with different template amounts in Example 1;

[0034] Fig.10 The electrophoresis diagram of the dual PCR of 4qA genotype and 4qB genotype in Example 1;

[0035] Fig.11 This is the agarose electrophoresis diagram of the 4q genotypes of 38 samples in Example 2. DETAILED DESCRIPTION

[0036] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present application. The terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. Unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present application, etc. can be purchased from the market or can be prepared by existing methods.

[0038] the term

[0039] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0040] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0041] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0042] As used herein, the term "PCR reaction" has a meaning generally understood by those skilled in the art, and refers to a reaction (polymerase chain reaction) of amplifying a target nucleic acid using a nucleic acid polymerase and a primer.

[0043] As used herein, the terms "target nucleic acid sequence", "target nucleic acid" and "target sequence" refer to a target nucleic acid sequence to be detected. In the present application, the terms "target nucleic acid sequence", "target nucleic acid" and "target sequence" have the same meaning and are used interchangeably. As used herein, the terms "target sequence" and "target-specific sequence" refer to a sequence that can selectively / specifically hybridize or anneal with a target nucleic acid sequence under conditions that allow nucleic acid hybridization, annealing or amplification, and that includes a sequence that is complementary to the target nucleic acid sequence. In the present application, the terms "target sequence" and "target-specific sequence" have the same meaning and are used interchangeably. It is easy to understand that a targeting sequence or a target-specific sequence is specific for a target nucleic acid sequence. In other words, under conditions that allow nucleic acid hybridization, annealing or amplification, a targeting sequence or a target-specific sequence hybridizes or anneals only with a specific target nucleic acid sequence, and does not hybridize or anneal with other nucleic acid sequences.

[0044] One embodiment of the present application provides a nucleic acid product for detecting the 4q genotype in the Chr4q35 region, the nucleic acid product comprising one or two pairs of the following primer pairs:

[0045] A first primer pair having a forward primer sequence as shown in SEQ ID NO: 1 and a reverse primer sequence as shown in SEQ ID NO: 2;

[0046] The second primer pair has a forward primer sequence as shown in SEQ ID NO: 3 and a reverse primer sequence as shown in SEQ ID NO: 4.

[0047] Specifically, the nucleotide sequence shown in SEQ ID No: 1 is: 5'- GGTCAAAAGCATACCTCTGTCTG -3'; the nucleotide sequence shown in SEQ ID No: 2 is: 5'- CACAGGGAGGGGGCATTTTA -3', the nucleotide sequence shown in SEQ ID No: 3 is: 5'- TTTCCTCCGGGACAAAAGA -3', and the nucleotide sequence shown in SEQ ID No: 4 is: 5'- CGGCACACATGTTTGTCTC -3'.

[0048] This application takes the 4q site in the Chr4q35 region as the research object, and finds the best detection first primer pair (SEQ ID No: 1: 5'- GGTCAAAAGCATACCTCTGTCTG -3'; SEQ ID No: 2: 5'- CACAGGGAGGGGGCATTTTA -3') and the second primer pair (SEQ ID No: 3: 5'- TTTCCTCCGGGACAAAAGA -3'; SEQ ID No: 4: 5'-CGGCACACATGTTTGTCTC -3'). The above primer pairs can bind more specifically, more sensitively and more accurately to the 4q site target nucleic acid sequence in the test sample. By detecting the 4q site information in the Chr4q35 region, it is possible to understand whether the 4qA genotype exists in the 4q region of the chromosome in the Chr4q35 region. By detecting the sequence information of the 4q site in the Chr4q35 region, the 4q genotype can be detected quickly and accurately.

[0049] In some of the embodiments, the nucleic acid product comprises two primer pairs, namely the first primer pair and the second primer pair.

[0050] The above two pairs of primers are mixed and then double PCR is performed to further simplify the detection process, which can efficiently and accurately detect the 4q genotype in the Chr4q35 region.

[0051] The present application also provides an application of the above-mentioned nucleic acid product in the preparation of a detection kit for facioscapulohumeral muscular dystrophy.

[0052] Other embodiments of the present application also provide a kit comprising the above-mentioned nucleic acid product.

[0053] In some embodiments, the above-mentioned kit also includes at least one of a negative control, a positive control, a nucleic acid extraction reagent, a PCR amplification reagent, a sequencing reagent, and an electrophoresis detection reagent.

[0054] In one embodiment, the positive control is a DNA sample whose genotypes in the Chr4q35 region 4q are AA genotype, BB genotype and AB genotype respectively.

[0055] In one embodiment, the negative control substance is deionized water.

[0056] In some specific examples, the PCR amplification reagents include one or more of a PCR buffer, a DNA polymerase, magnesium ions, and dNTPs.

[0057] It is understandable that, in some other specific examples, the above-mentioned kit may not include any of the positive controls, negative controls, PCR amplification reagents, sequencing reagents and electrophoresis detection reagents, and the excluded reagents may be reasonably obtained from the outside.

[0058] The kit of the present application is used to detect the 4q genotype in the Chr4q35 region, and the sequence information of multiple samples can be detected simultaneously, and the detection results are highly accurate.

[0059] Other embodiments of the present application also provide a method for detecting the 4q genotype in the Chr4q35 region, comprising step S10 and step S20.

[0060] Step S10: Using the DNA of the sample to be tested as a template, the above-mentioned nucleic acid product or kit is used for PCR amplification, and the sequence information of the Chr4q35 region 4q of the sample to be tested is obtained according to the obtained amplification result.

[0061] In one embodiment, in step S10, the DNA of the sample to be tested includes peripheral blood genomic DNA, amniotic fluid cell genomic DNA, or a cell whole genome amplification product.

[0062] In some embodiments, the reaction system of the PCR amplification reaction includes: 25 μL of PCR reaction solution, 1 μL of the first primer pair and 0.5 μL to 5 μL of the nucleic acid sample.

[0063] In some embodiments, the reaction system of the PCR amplification reaction includes: 25 μL of PCR reaction solution, 1 μL of the second primer pair and 0.5 μL-5 μL of the nucleic acid sample.

[0064] In some embodiments, the reaction system of the PCR amplification reaction includes: 10 μL of PCR reaction solution, 1.2 μL of a mixed primer pair of a first primer pair and a second primer pair, and 0.5 μL to 5 μL of a nucleic acid sample.

[0065] In some of the embodiments, the mass ratio of the first primer pair to the second primer pair in the mixed primer pair is 1:(1-4).

[0066] In a specific example, the mass ratio of the first primer pair to the second primer pair in the mixed primer pair is 1:2.

[0067] In a specific example, the PCR reaction solution is 2×Go Taq Green mix.

[0068] In some of the embodiments, the program of the PCR amplification reaction is set as: pre-denaturation at 94°C~96°C for 3min~5min, denaturation at 94°C~96°C for 30s~45s, annealing at 56°C~60°C for 30s~60s, extension at 70°C~74°C for 38s~42s, and cycled 30~38 times.

[0069] In a specific example, the program setting of the PCR amplification reaction is: 95°C pre-denaturation for 5 min, 95°C denaturation for 40 s, 58°C annealing for 40 s, 72°C extension for 40 s, 35 cycles, and 72°C total extension for 10 min.

[0070] In some embodiments, in step S10, the method for obtaining sequence information includes Sanger sequencing. It is understandable that the method for obtaining sequence information is not limited thereto, and other existing methods for obtaining sequence information may also be used. Optionally, the genome reference sequence may be from a public database, such as a human genome sequence may be a human genome reference sequence hg19, hg38, etc. in the NCBI or UCSC database.

[0071] Step S20: Analyze the sequence information, and determine the 4q genotype of the sample to be tested in the Chr4q35 region according to the obtained analysis results.

[0072] In some specific examples, step S20 further includes: comparing the sequence information of the sample to be tested with the reference sequence information to determine the 4q genotype of the Chr4q35 region; the reference sequence is shown in SEQ ID NO:10 and / or SEQ ID NO:11.

[0073] Specifically, the nucleotide sequence as shown in SEQ ID No: 10 is: 5'- GGTCAAAAGCATACCTCTGTCTGTCTTTGCCCGCTTCCTGGCTAGACCTGCGCGCAGTGCGCACCCCGGCTGACGTGCAAGGGAGCTCGCTGGCCTCTCTGTGCCCTTGTTCTTCCGTGAAATTCTGGCTGAATGTCTCCCCCCACCTTCCGACGCTGTCTAGGCAAACCTGGATTAGAGTTACATCTCCTGGATGATTAGTTCAGAGATATATTAAAATGCCCCCTCCCTGTG-3'; The nucleotide sequence shown in No:11 is: 5'-TTTCCTCCGGGACAAAAGACCGGGACTCGAGACTCCGTTCAATAAATGGTGCTGGGATAACTGGCTAGCCACATGCTGAAGATTGAACTGGGCCCCTTTCTTACACCATACAC AAAAATGAACTCAGGATGGATTAAAGACTTAAGTGTAAAACCCAAAAATATAAAAACCCTGGAAGACAACCTAGGCAATACCATCCTGGACATAAGGACAGGCAAAGATTTCATGACAAAGACAACAAAAG CAATAGCAATGAAAGCAAAAATTGACGTGGGATCTAGTTAAACTAAAGAGCTTCTACACAGCAAAAGAAACTATCAACAAAGTAAACAGGCAACTTGCAGATTGGGAGAAAGTATTTACAAACTATGCATC TGACAAAGGTCTAATATCCAGCATCTATAAGGAACTTAAACAAATTTACAAGAGAAAAACAACCCATTAAAAAGTGGGCCAAGGACATAAAGAGACACTTCTCCAAAGGAGACAAACATGTGTGCCG-3'.

[0074] In one embodiment, in step S20, specifically, when only a 234bp band appears in the electrophoresis graph of the amplified product, the 4q genotype of the sample is judged to be AA type, and when only a 503bp band appears in the electrophoresis graph of the amplified product, the 4q genotype of the sample is judged to be BB type; if both 234bp and 503bp bands appear in the electrophoresis graph of the amplified product, the 4q genotype of the sample is judged to be AB type.

[0075] It is understandable that the above method for detecting the 4q genotype in the Chr4q35 region can be a disease diagnosis method or a non-disease diagnosis purpose. The detection object of this method is a human embryo within 14 days of fertilization that has not been implanted in the uterus and has not undergone in vivo development, or an embryo that has died, etc. It is not a living human or animal body, and its detection results do not involve disease diagnosis results, so it does not belong to the diagnosis and treatment of diseases.

[0076] The nucleic acid composition and kit for detecting the genotype of Chr4q35 region 4q, according to the characteristics of the genotype of Chr4q35 region 4q, selects the 4q of Chr4q35 region as the detection object, performs PCR amplification by using a specific PCR amplification primer pair, analyzes the amplification reaction results, and sequences the amplified products, which can detect the sequence information of the 4q site of Chr4q35 region 4q, thereby determining the genotype of Chr4q35 region 4q. The whole experiment is simple to operate, and can efficiently and accurately display the sequence information of the 4q site of Chr4q35 region. It provides technical support for the application of genetic diagnosis and later reproductive intervention of clinical facioscapulohumeral muscular dystrophy.

[0077] The present application will be further described below in conjunction with specific embodiments and comparative examples, but they should not be construed as limiting the scope of protection of the present application.

[0078] Example 1: Primer design for the 4q site in the Chr4q35 region

[0079] In the early stage, several samples were tested by Bionano to clarify the 4q genotype in the Chr4q35 region. One sample each of the AA, AB, and BB genotypes were selected as positive standards (labeled as 343, 342, and 344, respectively). The peripheral blood genome was extracted using the DNA extraction kit of QIAGEN, Germany (catalog number 51106). Lymphocytes of the AB genotype were selected for whole genome amplification, and the REPLI-g single cell amplification kit of QIAGEN, Germany (catalog number 150345) was used to design the primers for this application.

[0080] 1. 4qA genotyping

[0081] 1.1 Genotype A contains a characteristic sequence of polyadenylation signal (PAS), which exists in both Chr4q35 and Chr10q26, but there are also several base differences between the two. In order to specifically amplify the PAS sequence of chromosome 4, that is, to identify the 4qA genotype, the primers are designed as follows: 4qA-F (SEQ ID No: 1): 5'-GGTCAAAAGCATACCTCTGTCTG-3'; 4qA-R (SEQ ID No: 2): 5'-CACAGGGAGGGGGCATTTTA-3'. The primers were compared with the NCBI database, and it was predicted that the product could be obtained. The target product is a 234bp fragment of chromosome 4.

[0082] 1.2 Testing samples with known AA, AB, and BB genotypes

[0083] ①The total reaction volume is 50μL: 2×Go Taq Green mix 25μL+H2O 23.5μL+1μL mixed primer (first primer pair: 0.5μL each of 10μM forward and reverse primers)+0.5μL DNA template (more than 10ng), mix well.

[0084] ②PCR thermal cycling conditions: denaturation at 95°C for 5 min, 95°C for 40 s → 58°C for 40 s → 72°C for 40 s (35 cycles), and total extension at 72°C for 10 min.

[0085] ③ Electrophoresis analysis: After the PCR reaction is completed, take 3 μL of the product directly and run it on a 2% agarose gel at 200V for 15 min. Then image it with ultraviolet light on a gel imager to determine whether there is a target band of about 200 bp.

[0086] The results are as follows Figure 1 As shown, from left to right are lane M: marker, and the fragments from small to large are 50bp, 100bp, 150bp, 200bp, 250bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp. Lane 343: sample with known 4q genotype of AA; lane 342: sample with known 4q genotype of AB; lane 344: sample with known 4q genotype of BB; lane H2O: blank control. Because the 4q genotype of 344 is BB, no target band is seen. The target bands are visible in samples 343 and 342, and the remaining PCR products of the two samples are subjected to sanger sequencing (forward sequencing) to clarify the amplification content. As shown Figure 2The arrows point to T and G (specific for the reverse primer), indicating that the product amplified by the above primers is a 4qA-specific sequence (rather than 10qA). Therefore, the above primers and amplification system can specifically identify the 4qA genotype in the 4q35 region.

[0087] 1.3 Other primer attempts

[0088] The primers were designed as follows: 4q-PAS-F2 (SEQ ID No: 5): 5'- TGACGTGCAAGGGAGCTC -3'; 4qA-R (SEQ ID No: 2): 5'-CACAGGGAGGGGGCATTTTA-3'. The primers were compared with the NCBI database and it was predicted that the product could be obtained. The target product was a 164 bp fragment of chromosome 4. Amplification was performed according to the detection conditions in 1.2 above.

[0089] The results are as follows Figure 3 As shown, from left to right, lane M is marker, and from small to large, the fragments are 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp, and 1500bp. Lanes 1, 2, and 3: Whole genome amplification products (WGA) of lymphocytes with 4q genotype AB; Lanes 4, 5, and 6: Peripheral blood genome with 4q genotype AB. Figure 3 As shown in the figure, although 4q-PAS-F2 / 4qA-R has good amplification specificity at the genome level, multiple non-specific products of about 300-500 bp appeared when amplified with WGA as the template. Therefore, the 4q-PAS-F2 / 4qA-R primer pair was not used.

[0090] 2. 4qB genotyping

[0091] 2.1 The 4qB genotype has no significant specific sequence, and has a high degree of homology with multiple chromosomes such as the short arm of chromosome 4, chromosome 21 and chromosome 22. Through repeated screening and comparison, the specific primers were designed as follows: 4qB-F (SEQ ID No: 3): 5'-TTTCCTCCGGGACAAAAGA-3'; 4qB-R (SEQ ID No: 4): 5'-CGGCACACATGTTTGTCTC-3'. The primers were compared with the database, and it was predicted that the product could be obtained, and the target fragment size was 503bp.

[0092] 2.2 Testing samples with known AA, AB, and BB genotypes

[0093] ①The total reaction volume is 50μL: 2×Go Taq Green mix 25μL+H2O 23.5μL+1μL mixed primer (second primer pair: 0.5μL each of 10μM forward and reverse primers)+0.5μL DNA template (more than 10ng), mix well.

[0094] ②PCR thermal cycling conditions: denaturation at 95°C for 5 min, 95°C for 40 s → 58°C for 40 s → 72°C for 40 s (35 cycles), and total extension at 72°C for 10 min.

[0095] ③ Electrophoresis analysis: After the PCR reaction is completed, take 3 μL of the product directly and run it on a 2% agarose gel at 200V for 15 min. Then image it with ultraviolet light on a gel imager to determine whether there is a target band of about 500 bp.

[0096] The results are as follows Figure 4 As shown, from left to right are lane M: marker, and the fragments from small to large are 50bp, 100bp, 150bp, 200bp, 250bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, and 1000bp. Lane 343: sample with known 4q genotype of AA; lane 342: sample with known 4q genotype of AB; lane 344: sample with known 4q genotype of BB; H2O: blank control. Because the 4q genotype of 343 is AA, the target band is not seen. The target bands are visible in samples 342 and 344, and the remaining PCR products of the two samples are subjected to sanger sequencing (forward sequencing) to clarify the amplification content. As shown below Figure 5 The base indicated by the arrow is GA (specific for the reverse primer). Therefore, the product amplified by the above primers is a 4qB specific sequence.

[0097] 2.3 Other primer attempts

[0098] ①4qB-F2 (SEQ ID No: 6): 5'-TACACACCCCATTTCCATGGATAGA-3'; 4qB-R2 (SEQ ID No: 7): 5'-AGAAGTACCTACTGTCAGTGCCA-3'. The primers were compared with the NCBI database and it was predicted that the product could be obtained. The target product was a 405 bp fragment of chromosome 4. Amplification was performed according to the detection conditions in 2.2 above.

[0099] The results are as follows Figure 6As shown, from left to right, lane M is marker, and from small to large, the fragments are 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp, and 1500bp. Lane 1: Samples with a known 4q genotype of AA; Lane 2: Samples with a known 4q genotype of AB; Lane 3: Samples with a known 4q genotype of BB. Figure 6 As shown, theoretically, no band should appear in the sample in lane 1, indicating that 4qB-F2 / 4qB-R2 has poor specificity and is therefore not used.

[0100] ②4qB-F3 (SEQ ID No: 8): 5'-CGCGGTTCACAGACCGCACATC -3'; 4qB-R3 (SEQ ID No: 9): 5'-GCCCGGCACACATGTTTGTCTCCTT-3'. The primers were compared with the UCSC database and it was predicted that the product could be obtained. The target product was a 3754 bp fragment of chromosome 4. Amplification was performed according to the detection conditions in 2.2 above.

[0101] The results are as follows Figure 7 As shown, from left to right, lane M: marker. Lane 1: sample with known 4q genotype of AA; Lane 2: sample with known 4q genotype of AB; Lane 3: whole genome amplification product of lymphocytes with known 4q genotype of AB. Figure 7 As shown in lanes 1 and 2, the 4qB-F3 / 4qB-R3 primer pair has good specificity at the genome level, but lane 3 shows that the amplification efficiency is poor when the lymphocyte whole genome amplification product is used as a template. The amplified fragment of this primer is large and is not suitable for whole genome amplification products. The applicable samples are limited, so it is not used.

[0102] 3. Combined rapid detection of 4qA and 4qB

[0103] The above two pairs of primers 4qA-F (SEQ ID No: 1): 5'-GGTCAAAAGCATACCTCTGTCTG-3'; 4qA-R (SEQ ID No: 2): 5'-CACAGGGAGGGGGCATTTTA-3' and 4qB-F (SEQ ID No: 3): 5'-TTTCCTCCGGGACAAAAGA-3'; 4qB-R (SEQ ID No: 4): 5'-CGGCACACATGTTTGTCTC-3' were mixed in proportion and then double PCR was performed.

[0104] 3.1 Screening primer mix ratio

[0105] ① The total reaction volume is 20μL: 2×Go Taq Green mix 10μL + mixed primers (the ratio of site A primers to site B primers is shown in the table below) + DNA template 0.5μL (more than 10ng), add nuclease-free water to 20μL and mix well.

[0106] Table 1

[0107]

[0108] ②PCR thermal cycling conditions: denaturation at 95°C for 5 min, 95°C for 40 s → 58°C for 40 s → 72°C for 40 s (35 cycles), and total extension at 72°C for 10 min.

[0109] ③ Electrophoresis analysis: After the PCR reaction is completed, take 5 μL of the product directly, run electrophoresis on a 2% agarose gel at 200 V for 15 min, and then image it under UV light on a gel imager.

[0110] The results are as follows Figure 8 As shown, from left to right, lane M: marker, the fragments from small to large are 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp, 1500bp. The 4qA band is 234bp, and the 4qB band is 503bp. The 6 reactions all use the same amount of nucleic acid (about 10ng) of the same sample as the template, and the ratio of A and B primers is shown in Table 1 above. In contrast, the amplification effect is best when the ratio of A:B primers is 1:2 (lane 4), that is, the biased amplification advantage of the A site is significantly weakened.

[0111] 3.2 Sensitivity experiment

[0112] ①The total reaction volume is 20μL: 2×Go Taq Green mix 10μL + mixed primer 1.2μL (first primer pair: 10μM forward and reverse primer 0.2μL each; second primer pair: 10μM forward and reverse primer 0.4μL each) + DNA template 1μL (specific template amounts are 36ng; 18ng; 9ng; 4.5ng; 2.75ng respectively) + denuclearized water 7.8μL, mix well.

[0113] ②PCR thermal cycling conditions: denaturation at 95°C for 5 min, 95°C for 40 s → 58°C for 40 s → 72°C for 40 s (35 cycles), and total extension at 72°C for 10 min.

[0114] ③ Electrophoresis analysis: After the PCR reaction is completed, take 5 μL of the product directly, run electrophoresis on a 2% agarose gel at 200 V for 15 min, and then image it under UV light on a gel imager.

[0115] The results are as follows Fig. 9 As shown, from left to right, lane M: marker, from small to large fragments are 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp, 1500bp. The 4qA type band is 234bp, and the 4qB type band is 503bp. 1: 36ng; 2: 18ng; 3: 9ng; 4: 4.5ng; 5: 2.75ng. Using the same sample as a template, the concentration was diluted according to the gradient, and amplification was performed with different template amounts. When the template amount was less than 9ng (lanes 4 and 5), the amplification efficiency was poor. Therefore, the applicable nucleic acid template amount of this kit is above 9ng.

[0116] 3.3 Specificity experiments

[0117] ①The total reaction volume is 20μL: 2×Go Taq Green mix 10μL + mixed primer 1.2μL (first primer pair: 10μM forward and reverse primer 0.2μL each; second primer pair: 10μM forward and reverse primer 0.4μL each) + DNA template 1μL (more than 9ng) + denuclearized water 7.8μL, mix well.

[0118] ②PCR thermal cycling conditions: denaturation at 95°C for 5 min, 95°C for 40 s → 58°C for 40 s → 72°C for 40 s (35 cycles), and total extension at 72°C for 10 min.

[0119] ③ Electrophoresis analysis: After the PCR reaction is completed, take 5 μL of the product directly, run electrophoresis on a 2% agarose gel at 200 V for 15 min, and then image it under UV light on a gel imager.

[0120] ④4q genotype determination: If only the 234bp band appears, specifically, its nucleotide sequence is as shown in SEQ ID No: 10, indicating that the 4q genotype of the sample is AA type; if only the 503bp band appears, specifically, its nucleotide sequence is as shown in SEQ ID No: 11, indicating that the 4q genotype of the sample is BB type; if both the 234bp and 503bp bands appear, indicating that the 4q genotype of the sample is AB type.

[0121] The results are as follows Fig.10As shown, from left to right, lane M: marker, and from small to large fragments are 50bp, 100bp, 150bp, 200bp, 250bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp. Lane 343: It is known that the 4q genotype is AA, so only the 234bp band can be seen; Lane 342: It is known that the 4q genotype is AB, so the 234bp and 503bp bands can be seen; Lane 344: It is known that the 4q genotype is BB, so only the 503bp band can be seen; Lane H2O: blank control. Therefore, the above primers and amplification system are used to identify the 4qA genotype and 4qB genotype in the 4q35 region, with short detection time, high sensitivity, high accuracy and good specificity, and have high guiding significance for clinical application.

[0122] Example 2

[0123] 1. Provide a kit for detecting 4q genotype in Chr4q35 region

[0124] The kit includes PCR reaction solution and nucleic acid product for detecting 4q genotype in Chr4q35 region.

[0125] The PCR reaction solution consists of nuclease-free water, PCR buffer (containing enzyme), and primer mixture, with a volume of 19.5 μL.

[0126] Nucleic acid products include:

[0127] A first primer pair having sequences as shown in SEQ ID No: 1 and SEQ ID No: 2;

[0128] The second primer pair has sequences as shown in SEQ ID No:3 and SEQ ID No:4.

[0129] A total of 38 samples were collected, which had previously been confirmed by Bionano single-molecule optical mapping, Southern blot, or linkage analysis techniques for 4q genotype in the 4q35 region, including 31 peripheral blood genome samples (including 342, 343, and 344 as controls), 4 amniotic fluid or fetal tissue genomes, and 3 trace cell whole genome amplification products. The sample information was hidden and the order was disrupted, and the 4q genotype was blindly tested using this kit. The results were compared with the previous test results to evaluate the accuracy of this method.

[0130] The specific operation of the 4q genotype rapid detection kit includes the following steps:

[0131] 1) Take out 1 portion of the reaction solution, add 0.5μL (more than 9ng) of 1 portion of the sample to the reaction solution, mix well, and the total reaction volume is 20μL. Then put it into the PCR instrument and amplify according to the following program: denaturation at 95℃ for 5min, 95℃ for 40s→58℃ for 40s→72℃ for 40s (35 cycles), and total extension at 72℃ for 10min.

[0132] 2) After the PCR reaction is completed, 5 μL of the product is directly taken and electrophoresed on a 2% agarose gel at 200 V for 15 min, and then imaged with ultraviolet light on a gel imager.

[0133] 3) Result analysis: If only the 234bp band appears, it indicates that the 4q genotype of the sample is AA; if only the 503bp band appears, it indicates that the 4q genotype of the sample is BB; if both the 234bp and 503bp bands appear, it indicates that the 4q genotype of the sample is AB.

[0134] 4) Result comparison: Fig.11 A, B and C in the figure represent the agarose electrophoresis diagram of 4q genotypes of 38 samples. Fig.11 A in the middle is the agarose electrophoresis diagram of the 4q genotype of samples S1 to S4; Fig.11 Middle B is the agarose electrophoresis diagram of 4q genotypes of samples S5 to S24; Fig.11 Figure C is the 4q genotype agarose electrophoresis diagram of samples S25 to S38. Fig.11 The test results of each sample were compared with the previous test results, see Table 2, the consistency is 100%, indicating that this kit is effective.

[0135] Table 2 4q genotype detection results of 38 samples

[0136]

[0137] It can be seen from the data in the above table that 38 DNA samples from different sources were quickly tested with the kit of this application, and the test results consistent with those of Bionano and other methods were obtained, indicating the effectiveness of the kit of this application. In the above experiment, the use of the kit of this application can quickly exclude S4, S10, S17, and S21 as FSHD patients, so it can be used as a method to identify FSHD. In addition, this kit can quickly identify whether the 4q genotype of FSHD patients is AB or AA. If it indicates AB type, then this site is a very important linkage marker site downstream of the D4Z4 repeat unit in the 4q35 region, which can provide valuable information for prenatal diagnosis and preimplantation genetic testing.

[0138] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0139] The above-described embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be construed as limiting the scope of the patent application. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent application shall be subject to the attached claims.

Claims

1. A nucleic acid product for detecting 4q genotype in Chr4q35 region, characterized in that: The nucleic acid product includes one or two pairs of the following primer pairs: A first primer pair having a forward primer sequence as shown in SEQ ID NO: 1 and a reverse primer sequence as shown in SEQ ID NO: 2; The second primer pair has a forward primer sequence as shown in SEQ ID NO: 3 and a reverse primer sequence as shown in SEQ ID NO:

4.

2. The nucleic acid product for detecting 4q genotype in Chr4q35 region according to claim 1, characterized in that: The nucleic acid product includes two primer pairs, namely the first primer pair and the second primer pair.

3. Use of the nucleic acid product according to claim 1 or 2 in the preparation of a detection kit for facioscapulohumeral muscular dystrophy.

4. A kit for detecting facioscapulohumeral muscular dystrophy, characterized in that: The kit comprises the nucleic acid product according to any one of claims 1 to 2.

5. The kit for detecting facioscapulohumeral muscular dystrophy according to claim 4, characterized in that: The kit also includes at least one of a negative control substance, a positive control substance, a nucleic acid extraction reagent, a PCR amplification reagent, a sequencing reagent, and an electrophoresis detection reagent.

6. The kit for detecting facioscapulohumeral muscular dystrophy according to claim 5, characterized in that: The PCR amplification reagent includes one or more of a PCR buffer, a DNA polymerase, magnesium ions and dNTPs.

7. A method for detecting 4q genotype in Chr4q35 region, characterized in that: The following steps are involved: Using the DNA of the sample to be tested as a template, using the nucleic acid product according to any one of claims 1 to 2 or the kit according to any one of claims 4 to 6 to perform PCR amplification, and obtaining the sequence information of the Chr4q35 region 4q of the sample to be tested according to the obtained amplification result; The sequence information is analyzed, and the 4q genotype of the sample to be tested in the Chr4q35 region is determined according to the obtained analysis results.

8. The method for detecting 4q genotype in Chr4q35 region according to claim 7, characterized in that: The following steps are also included: Comparing the sequence information of the sample to be tested with the reference sequence information to determine the 4q genotype in the Chr4q35 region; The reference sequence is shown as SEQ ID NO:10 and / or SEQ ID NO:

11.

9. The method for detecting the 4q genotype in the Chr4q35 region according to any one of claims 7 to 8, characterized in that: The program of the PCR amplification reaction was set as follows: pre-denaturation at 94°C-96°C for 3min-5min, denaturation at 94°C-96°C for 30s-45s, annealing at 56°C-60°C for 30s-60s, extension at 70°C-74°C for 38s-42s, and 30-38 cycles.

10. The method for detecting the 4q genotype in the Chr4q35 region according to any one of claims 7 to 8, characterized in that: The DNA of the sample to be tested includes peripheral blood genomic DNA, amniotic fluid cell genomic DNA and trace cell whole genome amplification products.

Images