Application of lncRNA as tumor marker in preparation of liver cancer diagnosis or prognosis judging product

By using LINC01252 as a specific low-expression lncRNA and designing a specific detection kit, the difficulties in early diagnosis and prognosis of hepatocellular carcinoma were solved, and efficient and accurate diagnosis of liver cancer was achieved.

CN119913259BActive Publication Date: 2025-10-10WEIFANG MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510418355.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-10-10
Estimated Expiration
2045-04-03

AI Technical Summary

Technical Problem

In the existing technology, the molecular mechanism of the pathogenesis of hepatocellular carcinoma is not yet fully understood, and there is a lack of effective lncRNA as a tumor marker for early diagnosis and prognosis of liver cancer.

Method used

LINC01252 is used as a specific low-expression lncRNA, and specific detection reagents or kits are designed to detect its expression level through reverse transcription-PCR, real-time quantitative PCR, in situ hybridization, or chip technology for early diagnosis and prognosis of liver cancer.

Benefits of technology

It improves the diagnostic efficiency of liver cancer and the accuracy of prognosis, and provides the sensitivity and specificity for early diagnosis of clinical liver cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119913259B_ABST
    Figure CN119913259B_ABST
Patent Text Reader

Abstract

The application provides application of lncRNA as a tumor marker in preparation of a liver cancer diagnosis or prognosis product, wherein the lncRNA is LINC01252, and the nucleotide sequence of the LINC01252 is shown as SEQ ID NO. 1. The LINC01252 can be used as a tumor molecular marker to design and synthesize a specific detection reagent or kit, which is used for early auxiliary diagnosis of clinical liver cancer, and improves the diagnosis efficiency and prognosis efficiency of liver cancer. The application also provides application of a reagent for detecting the expression amount of lncRNA-LINC01252 in a sample, and a primer and a kit for specifically detecting lncRNA-LINC01252. The primer can specifically recognize LINC01252 and detect the expression amount of LINC01252 in a tissue.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of lncRNA as a tumor marker in the preparation of liver cancer diagnosis or prognosis products. Background Art

[0002] Long noncoding RNAs (lncRNAs) are a class of endogenous noncoding RNAs (long noncoding RNAs) greater than 200 nt in length. Due to their lack of open reading frames (ORFs), they cannot directly encode proteins, yet they play a key role in gene regulation. lncRNAs can influence tumor cell cycle, apoptosis, and metastasis, and can also macro-regulate many tumor cell characteristics at the epigenetic level. These lncRNAs have great potential as anti-tumor drugs, therapeutic targets, and tumor biomarkers, providing additional therapeutic targets and approaches for the treatment of hepatocellular carcinoma.

[0003] Hepatocellular carcinoma (HCC) is the most common subtype of primary liver cancer and the fourth most common malignant tumor in my country. However, the molecular mechanisms underlying HCC pathogenesis remain largely unknown. Numerous studies have demonstrated that lncRNAs (lncRNAs) play a crucial role in the development and progression of HCC. Several HCC-associated lncRNAs have been shown to be aberrantly expressed in cancerous tissues and to regulate HCC proliferation, apoptosis, invasion, migration, and angiogenesis by binding to DNA, RNA, or proteins.

[0004] Therefore, further research on lncRNA in the human genome will provide new tools for the early diagnosis and treatment of hepatocellular carcinoma. More hepatocellular carcinoma-related lncRNAs need to be developed, and existing technologies need to be further improved. Summary of the Invention

[0005] In response to the above-mentioned problems in the prior art, the present invention provides a use of a lncRNA as a tumor marker in the preparation of a liver cancer diagnosis or prognosis product. The lncRNA is LINC01252, which can be used as a marker for liver cancer diagnosis and prognosis for specific detection of liver cancer.

[0006] To solve the above problems, this application provides the following technical solutions:

[0007] In a first aspect, the present application provides a use of a lncRNA as a tumor marker in the preparation of a liver cancer diagnosis product or a prognosis judgment product, wherein the lncRNA is LINC01252, and its nucleotide sequence is shown in SEQ ID NO.1.

[0008] The marker LINC01252 is specifically low-expressed in liver cancer tissues, but not in normal tissues. It can be used as a tumor-specific molecular marker to design and synthesize specific detection reagents or kits for clinical early auxiliary diagnosis of liver cancer, thereby improving the diagnostic efficiency and prognostic efficiency of liver cancer.

[0009] The liver cancer diagnostic products include early liver cancer diagnostic products, liver cancer recurrence diagnostic products and late liver cancer diagnostic products, such as reagents for detecting LINC01252 expression levels through reverse transcription PCR, real-time quantitative PCR, in situ hybridization or chip technology.

[0010] Optionally, the diagnostic product and detection product are preparations, chips or detection kits.

[0011] In a second aspect, the present application further provides a use of a reagent for detecting the expression level of the aforementioned lncRNA in a sample in the preparation of a product having at least one of the following functions:

[0012] (1) Predict or assist in predicting the recurrence-free survival rate of patients with liver cancer after surgery;

[0013] (2) Predict or assist in predicting the overall survival rate of patients with liver cancer after surgery;

[0014] (3) Predict or assist in predicting the degree of tumor differentiation in patients with liver cancer, that is, predict or assist in predicting the stage of the disease in patients with liver cancer, whether it is in the late stage.

[0015] Optionally, in the application, the product is a preparation, a chip or a detection kit.

[0016] The present invention designs and synthesizes specific detection reagents (such as primers and DNA probes) based on the LINC01252 sequence. The reagents can detect the expression level of LINC01252 in samples based on quantitative PCR methods and / or high-throughput sequencing methods and / or probe hybridization methods, or detect the expression level of target genes regulated by LINC01252 based on immunological methods, and use this as effective information for the early diagnosis of liver cancer.

[0017] The reagents for detecting the expression level of LINC01252 in the chip include a probe that specifically recognizes the LINC01252 gene; the reagents for detecting the expression level of LINC01252 in the kit include primers that specifically amplify the LINC01252 gene or a probe that specifically recognizes the LINC01252 gene.

[0018] In a third aspect, the present application further provides a detection primer for specifically amplifying the above-mentioned lncRNA, and the sequence of the primer pair is shown in SEQ ID NO. 2~3.

[0019] The detection primers of the present invention can specifically identify LINC01252 and detect the expression level of LINC01252 in tissues, providing effective information for the diagnosis or prognosis of clinical hepatocellular carcinoma.

[0020] In a fourth aspect, the present application also provides a kit comprising the aforementioned detection primers.

[0021] The kit of the present invention comprises the above-mentioned primers that can specifically recognize LINC01252 and detect the expression level of LINC01252 in tissues. It has a simple composition, is easy to use, has accurate quantitative results, and provides stable and reliable detection results, thereby improving the sensitivity and specificity of early diagnosis of clinical liver cancer.

[0022] Preferably, the kit further comprises a polymerase chain reaction reagent and its reaction buffer, dNTPs, an internal reference primer and a fluorescent dye. The internal reference primer can be a specific detection primer for the GAPDH housekeeping gene. The fluorescent dye can be SYBR-Green dye.

[0023] Preferably, the kit also includes an RNA extraction reagent and a cDNA reverse transcription reagent. This kit, combined with commonly used RNA extraction reagents and universal reverse transcription reagents, can specifically detect the expression level of LINC01252 in tissues and is effectively used for early auxiliary diagnosis of liver cancer.

[0024] The present invention has the following beneficial effects:

[0025] 1. This study discovered for the first time that LINC01252 expression is associated with liver cancer. LINC01252 can be used as a specific molecular marker to design and synthesize specific detection reagents or kits for clinical early auxiliary diagnosis of liver cancer, thereby improving the diagnostic efficiency and prognostic efficiency of liver cancer.

[0026] 2. The present invention also provides primers for amplifying LINC01252 and a kit containing the primers. The primers can specifically recognize LINC01252 and detect the expression level of LINC01252 in tissues. They are simple in composition, easy to use, quantitatively accurate, and provide stable and reliable test results, which can improve the sensitivity and specificity of early diagnosis of clinical liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Figure A is a graph showing the differential expression of LINC01252 between liver cancer tissues and normal tissues in Example 1; Figure B is a graph showing the relationship between LINC01252 expression levels and overall survival of patients with hepatocellular carcinoma;

[0028] Figure 2A is the graph of the effect of promoting the proliferation of liver cancer cells after knocking down LINC01252 in the CCK-8 experiment in Example 2; B is the graph of the effect of promoting the migration of liver cancer cells after knocking down LINC01252 in the crystal violet staining of the cell migration experiment in Example 2, C is the graph of the migration cells in the cell migration experiment in Example 2; SS-NC is the control group, and SS-LINC01252 is the LINC01252 knockdown cell group. DETAILED DESCRIPTION

[0029] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application. In the present application, unless specified, the devices and materials used are commercially available or commonly used in the art. The methods in the following examples are conventional methods in the art, unless otherwise specified.

[0030] Experimental reagents used in the embodiments:

[0031] 1. Reverse transcription kit: FastKing one-step genomic cDNA first-strand synthesis premix reagent (KR118) from Tian Gen Biochemical Technology (Beijing) Co., Ltd.

[0032] 2. qRT-PCR kit: Taq Pro Universal SYBR qPCR Master Mix from vazyme.

[0033] Example 1 Analysis of the expression level of LINC01252 in liver cancer tumor samples

[0034] In this example, LINC01252 as a cancer tissue biomarker was obtained, and its expression level in cancer tissue and its correlation with survival rate were compared.

[0035] 1. Experimental method

[0036] (1) The expression levels of LINC01252 in normal samples from the GTEx database and liver cancer tumor samples from the TCGA database were analyzed and compared by the GEPIA website (http: / / gepia.cancer-pku.cn).

[0037] (2) The Kaplan-Meier Plotter website (https: / / kmplot.com / analysis / ) was used to analyze the correlation between the expression level of LINC01252 in the TCGA database and the survival of patients with liver cancer.

[0038] The above-mentioned tumor survival analysis is a method for evaluating the survival rate and prognosis of tumor patients. The expression level of specific genes is correlated with the patient's survival rate and can be used to predict the prognosis of tumor patients.

[0039] 2. Experimental results and analysis

[0040] (1) If Figure 1 As shown in the results of A, the expression level of LINC01252 in cancer samples was lower than that in normal samples.

[0041] (2) The results of the correlation between LINC01252 expression level and survival of patients with liver cancer are as follows Figure 1 B, The results showed that patients with low LINC01252 expression had a significantly increased risk of liver cancer-related death.

[0042] This example shows that LINC01252 is specifically low-expressed in liver cancer samples and is associated with a worse survival prognosis. This suggests that LINC01252 can be used as a biomarker to provide important clues and evidence for the diagnosis, treatment, and prognosis of tumors.

[0043] Example 2 Functional Verification of LINC01252

[0044] 1. Cell transfection

[0045] In a six-well plate, 3.0 × 10 5 SK-Hep-1 hepatoma cells were inoculated at a cell density of 500 nmol / mL and 2 mL of complete medium containing 10% FBS was added. Transfection was performed when the cell density reached about 70%.

[0046] The cell transfection comprises the following steps:

[0047] (1) Synthesis of siRNA

[0048] siRNA targeting the human LINC01252 gene was designed and synthesized, and the control was Smart Silencer-lncRNA (purchased from Guangzhou Ruibo Biotechnology Co., Ltd.). The sequence of the siRNA is as follows:

[0049] siRNA-1: CCTACCTAACTTCCCTAAT (SEQ ID NO.4)

[0050] siRNA-2: CCCAACTCAAACCAGGGAAA (SEQ ID NO. 5)

[0051] siRNA-3: ACAATCAGTGCAGTCCGATG (SEQ ID NO. 6)

[0052] siRNA-4: TGCCTCAAGAGACCTGGGAA (SEQ ID NO. 7)

[0053] siRNA-5: CACCTCTTGAGATCTAAAT (SEQ ID NO. 8)

[0054] siRNA-6: GGAGCTTCTATGAATTACA (SEQ ID NO. 9)

[0055] (2) Preparation of siRNA diluent for human LINC01252 gene:

[0056] Dilute 5 μL of the above siRNA (20 μM per strand) in 200 μL of serum-free medium DMEM, mix well and stand at room temperature for 5 min.

[0057] Prepare Lipo2000 diluent: dilute 5 μL of Lipo2000 in 200 μL of serum-free medium DMEM, mix well and stand at room temperature for 5 min.

[0058] (3) Mix the above two diluents in equal volume at 1:1, stand at room temperature for 20 min;

[0059] (4) Add the above mixture to the supernatant of hep1 cells drop by drop, and quantitatively add 1 mL to each well, mix well by gently shaking the well plate;

[0060] (5) Incubate in a 37°C, 5% CO2 incubator for 6 h;

[0061] (6) Replace with 2 mL of complete medium containing 10% FBS DMEM, and culture the cells in each group at 37°C, 5% CO2 for 24 h to obtain LINC01252 knockdown cells. Collect the cells for subsequent experiments.

[0062] 2. Cell proliferation experiment

[0063] Cell proliferation assays are commonly used to assess and quantify the rate of tumor cell growth and replication. This experiment used the CCK-8 assay to detect tumor cell proliferation using Vazyme's CCK-8 Cell Counting Kit, a widely used cell proliferation assay based on WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonylphenyl)-2H-tetrazolium monosodium salt). This example used the CCK-8 assay to investigate the effect of LINC01252 on liver cancer cell proliferation.

[0064] (1) Experimental methods

[0065] ① Treat each group of transfected cells with trypsin and count them using a cell counter. Then resuspend each group of transfected cells with an appropriate amount of complete culture medium so that each 100 μl of cell suspension contains 1000 cells. Inoculate each group of transfected cells in a 96-well plate, with each well containing 100 μl of cell suspension. Set up 3 replicates for each group. Wells without culture medium need to be sealed with phosphate-buffered saline (PBS). Then place the 96-well plate in a 37°C, 5% CO2 incubator for incubation.

[0066] ② After the cells adhere to the wall, add 10 μl of CCK-8 reagent to the culture medium;

[0067] ③ Place the 96-well culture plate in an incubator and culture for 5 hours;

[0068] ④ After the cells have attached for 0 hours, 24 hours, 48 ​​hours, 72 hours, and 96 hours, add 10 μl of CCK-8 reagent to the culture medium, then return the 96-well plate to the incubator and continue culturing for 2 hours. Then use a microplate reader to measure the absorbance at 450 nm.

[0069] ⑤Process the experimental data and draw the cell growth curve with 0 hours, 24 hours, 48 ​​hours, 72 hours, and 96 hours as the horizontal axis and the absorbance value at 450nm as the vertical axis.

[0070] (2) Experimental results and analysis

[0071] The results of cell growth curves are as follows Figure 2 As shown in A, the proliferation of LINC01252 knockdown cells was greater than that of the control group. The experimental results showed that knockdown of LINC01252 significantly promoted the cell proliferation ability of liver cancer cells.

[0072] 3. Cell migration assay

[0073] Cell migration experiments are used to simulate the ability of tumor cells to move through the external environment. Transwell chambers are an ideal model for assessing cell migration. In this model, cells migrate from the upper chamber to the lower chamber through a porous polycarbonate membrane with a diameter of 8 μm, a process that simulates the migratory behavior of tumor cells.

[0074] (1) Experimental methods

[0075] ① Take Huh7 cells in good growth state and digest them with trypsin. Wash the cells once with serum-free medium. 4 The cells were resuspended in 150 μL serum-free medium;

[0076] ②Plant the cell suspension onto the upper layer of each Transwell chamber. Add 600 μL of complete culture medium containing 50% FBS to the lower layer of the Transwell chamber.

[0077] ③ Place the Transwell chamber containing cells in a cell culture incubator and culture for 24 hours;

[0078] ④ Fix the cells on the chamber membrane with 4% polymethanol for 15 minutes. Stain the cells with crystal violet for 15 minutes, then rinse gently with water.

[0079] ⑤ Gently wipe off the floating color with a cotton swab, take pictures of the cells on the lower surface of the polycarbonate membrane under a microscope, and perform statistical analysis.

[0080] (2) Experimental results and analysis

[0081] The electron microscopic results of the migration effect are as follows Figure 2 B and Figure 2 C. The results showed that compared with the control group, the number of cells passing through the porous polycarbonate membrane in the experimental group was significantly increased. Therefore, this result indicates that knockdown of LINC01252 promoted the cell migration ability of liver cancer cells.

[0082] Example 3 Application of LINC01252 as a liver cancer detection marker in detecting the risk of liver cancer recurrence and whether liver cancer is in the late stage

[0083] This embodiment provides a method for using LINC01252 as a liver cancer detection marker to detect the risk of liver cancer recurrence and whether liver cancer is in the late stage. The method predicts or assists in predicting the postoperative prognosis of the patient by detecting the expression level of lncRNA-LINC01252 in the cancer tissue sample of the patient to be tested. The method comprises the following steps:

[0084] 1. Extraction of total RNA:

[0085] (1) Add 1 mL of TRIzol to the cell or tissue sample, shake thoroughly to mix, transfer to an RNase-free centrifuge tube, and let it stand on ice for 5 minutes;

[0086] (2) Add 300 μL of chloroform, shake thoroughly again, let stand on ice for 10 minutes, and centrifuge at 12,000 g for 15 minutes at 4°C;

[0087] (3) Carefully transfer the supernatant to a new RNase-free EP tube, add an equal volume of isopropanol, and let it stand on ice for 15 minutes;

[0088] (4) Centrifuge again at 12,000 g for 15 minutes at 4°C. Discard the supernatant and wash the precipitate twice with 75% ethanol and then with anhydrous ethanol.

[0089] (5) Centrifuge at 12,000 g for 5 minutes at 4°C, discard the supernatant, and air-dry the precipitate at room temperature until it becomes transparent. Dilute with 40 μL of DEPC water. Subsequently, measure the concentration and purity of the RNA using a UV spectrophotometer and prepare cDNA by reverse transcription.

[0090] 2. qPCR detection of LINC01252

[0091] 1 ng of cDNA was used for qPCR, with ACTIN as the internal control. A qPCR reaction system with a final volume of 20 μL was established according to the kit instructions (Vazyme Taq Pro Universal SYBR qPCR Master Mix).

[0092] The reaction system includes: 1 ng of the above cDNA, 10 μL of SYBR Green I, 0.8 μL of each upstream and downstream primer (concentration of 10 μmol / L), and the balance is DEPC water.

[0093] The upstream and downstream primer sequences are:

[0094] LINC01252-F: AGAAGGGGTCCAGGAAGAAA (SEQ ID NO.2)

[0095] LINC01252-R:TCCTGACACTTCTGCCACTG (SEQ ID NO.3)

[0096] The thermal cycling program for qPCR was as follows: pre-denaturation at 95°C for 30 s, followed by a three-step reaction: denaturation at 95°C for 5 s, and annealing at 60°C for 30 s, for 40 cycles.

[0097] The final test results are 2 -ΔΔCt The relative expression level of lncRNA-LINC01252 was calculated by the method.

[0098] 3. Analysis of test results

[0099] The expression level of lncRNA-LINC01252 in the cancer tissue samples of the patients to be tested can be used to predict or assist in predicting the postoperative prognosis of the patients to be tested. The judgment criteria are as follows:

[0100] The recurrence-free survival rate of the patients to be tested in the high expression group is higher than that of the patients to be tested in the conventional expression group, and is also higher than that of the patients to be tested in the low expression group; and / or, the overall survival rate of the patients to be tested in the high expression group is higher than that of the patients to be tested in the conventional expression group, and is also higher than that of the patients to be tested in the low expression group.

[0101] Alternatively, the expression level of the lncRNA-LINC01252 gene measured by the above method can also be used as an intermediate result. By combining it with other clinical diagnostic results, further analysis can be performed to obtain more informative results on the risk of recurrence and whether liver cancer is in the advanced stage, and it can also be used as one of the reference information for formulating clinical treatment plans for patients.

[0102] It is understandable that those skilled in the art can make equivalent substitutions or changes based on the technical solutions and concepts of the present invention, and all these changes or substitutions should fall within the scope of protection of the claims attached to the present invention.

Claims

1. Use of a reagent for detecting the expression of lncRNA markers in the preparation of a liver cancer diagnosis product or a prognosis judgment product, characterized in that: The lncRNA is LINC01252, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. Use of a reagent for detecting the expression level of the lncRNA according to claim 1 in a sample in the preparation of a product having at least one of the following functions: (1) Predict or assist in predicting the recurrence-free survival rate of patients with liver cancer after surgery; (2) Predict or assist in predicting the overall survival rate of patients with liver cancer after surgery; (3) Predict or assist in predicting the degree of tumor differentiation in patients with liver cancer.

3. The use according to claim 2, wherein: The product is a chip or a detection kit.