Universal reference gene, primer probe and kit for nucleic acid amplification detection of reptile pathogens and application of universal reference gene, primer probe and kit
By using the Reptile tRNA gene as a general internal reference gene and designing corresponding primer probes, the problem of difficulty in achieving universal detection of multiple reptile animals and multiple tissues in the prior art is solved, and an efficient and simplified detection process is achieved, reducing the risk of false negatives and the cost of reagent development.
Patent Information
- Application Number
- CN202510229329.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-05-02
AI Technical Summary
The prior art is difficult to achieve general detection of multiple reptile animals and tissues in PCR detection of reptile pathogens, and the commonly used internal reference quality control methods cannot effectively monitor the sample collection, transportation and nucleic acid extraction processes, resulting in false negatives in the detection results.
The tRNA gene of the Reptile Class is used as a general internal reference gene, and corresponding primer probes are designed to detect nucleic acids in a variety of reptiles and tissues, which simplifies the experimental operation process and reduces material costs.
It has achieved efficient detection of a variety of reptiles and tissues, improved detection efficiency, reduced reagent development costs, and simplified experimental operation procedures, reducing false negative risks.
Smart Images
Figure CN119913296A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular biological detection, and particularly relates to a universal internal reference gene, a primer probe, a kit and applications thereof for nucleic acid amplification detection of reptile pathogens. Background Art
[0002] Reptiles are an important part of the ecosystem, and their contact with pathogens may affect their population and distribution. By detecting reptile pathogens, we can understand the impact of pathogens on these species, so as to take appropriate protective measures to protect biodiversity; reptiles may become a place or medium for the reproduction of pathogens and spread them to other places. Studying the relationship between reptiles and pathogens helps prevent and control the spread of diseases. Amphibians and reptiles are one of the early warning systems for environmental changes. They are very sensitive to environmental changes. By monitoring reptile pathogens, we can assess the health of the environment and provide a scientific basis for environmental management. For the treatment of reptile diseases, understanding the type of pathogen is crucial to choosing the right treatment plan. For example, reptiles infected with mycoplasma may require specific antibiotic treatment, and testing can help identify the pathogen, thereby improving the treatment effect. In food testing, when reptiles are used as a food source, the detection of pathogenic microorganisms is crucial to ensure food safety. For example, detecting Vibrio cholerae in amphibian and reptile foods can help prevent foodborne diseases. In summary, the detection of reptile pathogens is of great significance to many fields such as ecological protection, disease control, human health, environmental monitoring and scientific research. Therefore, it is very meaningful to widely apply PCR technology to the field of reptile disease detection. In order to improve the detection quality of PCR, it is necessary to introduce internal reference gene detection.
[0003] Since the PCR detection process involves many experimental processes, including clinical sample collection, sample storage and transportation, nucleic acid extraction, and PCR reaction, any operation error in any step may lead to nucleic acid degradation or excessive inhibitors causing amplification reaction failure, which may lead to false negative experiments. If endogenous reference genes are detected, the nucleic acid of endogenous genes in the sample can be detected while PCR is diagnosing pathogens. This can effectively control the quality of the entire experimental process, including clinical sample collection, sample storage and transportation, nucleic acid extraction, and PCR reaction, and eliminate experimental operation errors, reagent failures, and reaction failures. False negatives can be avoided to a certain extent, and the reliability of diagnostic results can be improved.
[0004] Many pathogens can use multiple reptiles as hosts, such as cytomegalovirus, green turtle papillomavirus, herpes virus, Chinese soft-shelled turtle yellow virus, iridovirus, frog virus, Aeromonas, Pseudomonas, Cryptosporidium, amoeba, etc. Therefore, when conducting PCR monitoring of reptile pathogens, it may be necessary to test samples from multiple reptiles, and internal reference primers that can be applied to multiple reptiles have strong practical value.
[0005] It is easy to design dedicated internal reference primers for PCR testing of specific species of reptiles. For example, the recognized 18s RNA gene is highly conserved in multiple species, and appropriate regions can be selected to design DNA internal reference gene primers for specific species. However, these genes may not be applicable to other reptiles. Designing specific internal reference primer probes for each reptile is time-consuming and labor-intensive, increasing various costs.
[0006] At present, the commonly used internal reference quality control method is to add exogenous genes or pseudoviruses containing exogenous genes after the samples are transported to the laboratory, before nucleic acid extraction or before PCR. However, this method cannot effectively monitor the upstream sample collection, transportation and storage, and nucleic acid extraction processes, and it adds additional experimental operation steps and material costs. Summary of the invention
[0007] In view of the above technical problems to be solved, one object of the present invention is to provide a universal internal reference gene suitable for nucleic acid amplification detection of reptile pathogens, which can be used for multiple reptiles and multiple tissues, is not interfered by other nucleic acids in the genome, and has a high detection efficiency.
[0008] Another object of the present invention is to provide a primer probe for detecting the universal internal reference gene.
[0009] Another object of the present invention is to provide a kit comprising the primer probe.
[0010] Another object of the present invention is to provide application of the primer probe.
[0011] In order to achieve the above invention objectives, the present invention provides a universal internal reference gene for nucleic acid amplification detection of reptile pathogens, wherein the universal internal reference gene is a reptile tRNA gene.
[0012] On the other hand, the present invention also provides a primer probe for detecting the universal internal reference gene, characterized in that the primer probe comprises:
[0013] Upstream primer: 5′-TCGTTGGTCTAGGGGTATGATT-3′;
[0014] Downstream primer: 5′-GGCTCGTCCGGGATTTG-3′;
[0015] Probe: 5′-VIC-CCGGGACCTCTCGCACCCTAAGC-BHQ1-3′.
[0016] On the other hand, the present invention also provides the use of the primer probe in preparing a nucleic acid amplification detection kit for reptile pathogens.
[0017] Preferably, the reptiles are any one or more of the orders Testudinata, Crocodilians, Squamata, Rhynchocephalus, and Amphiprion, more preferably any one or more of the orders turtle, crocodile, flat-breasted turtle, green turtle, flower turtle, temple turtle, alligator snapping turtle, yellow-spotted side-necked turtle, and two-clawed turtle.
[0018] Preferably, the pathogen includes any one or more of viruses, bacteria, and parasites.
[0019] Preferably, the pathogen is any one or more of cytomegalovirus, green turtle papillomavirus, herpes virus, Chinese soft-shelled turtle yellow virus, iris virus, frog virus, Aeromonas, Pseudomonas, Cryptosporidium, and amoeba.
[0020] Preferably, in the application, the reaction system for nucleic acid amplification detection is 25 μL: 5×Probe qPCR Buffer 5 μL, 10×HA buffer 2.5 μL, High Affinity HotStart Taq Enzyme 0.4 μL, 10 μM upstream primer 0.5 μL, 10 μM downstream primer 0.5 μL, 10 μM probe 0.4 μL, DNA template 5 μL, and nuclease-free water to make up to 25 μL.
[0021] Preferably, in the application, the reaction conditions for nucleic acid amplification detection are: denaturation at 95°C for 5 min; 95°C for 15 s, 61°C for 30 s, and 45 cycles.
[0022] On the other hand, the present invention also provides a method for detecting nucleic acid amplification of reptiles, wherein the method uses a reptilian tRNA gene as a universal internal reference gene. Preferably, in the method, the universal internal reference gene is detected using the primer probe according to the present invention.
[0023] On the other hand, the present invention also provides a kit for nucleic acid amplification detection of reptile pathogens, the kit comprising the primer probe according to the present invention.
[0024] Preferably, the nucleic acid amplification detection is DNA pathogen detection or RNA pathogen amplification detection.
[0025] Preferably, the nucleic acid amplification detection is any one of real-time fluorescence quantitative PCR detection, conventional PCR detection, loop-mediated isothermal amplification detection, nucleic acid sequence-dependent amplification detection, rolling circle amplification detection, single primer isothermal amplification detection, helicase-dependent DNA isothermal amplification, recombinase polymerase amplification, and chain replacement amplification.
[0026] Preferably, the kit is used to amplify nucleic acids extracted from reptile tissue.
[0027] The internal reference gene selected by the present invention is tRNA (transfer RNA) of Reptilia. Because tRNA has sequence conservation: tRNA molecules have well-defined sequence conservation, which reflects the need to maintain their structure and function during translation. Despite the large number of tRNA genes, specific tRNA sequence motifs are highly conserved in multicellular eukaryotes; tRNA has evolutionary conservation: evolutionary studies of tRNA sequences have shown that tRNA sequences are conserved during evolution, which may be related to their key functions in protein synthesis. Reptilia is a class in the phylum Chordata and belongs to the subphylum Vertebrata. Reptiles are a type of terrestrial vertebrates, and Reptilia includes multiple orders, some of the main orders of which include: Testudines, Crocodylia, Squamata, Rhynchocephalia, and Amphisbaenia.
[0028] Compared with the prior art, the present invention has the following beneficial effects:
[0029] (1) The present invention proposes to establish a universal internal reference gene in the PCR detection of reptile nucleic acid pathogens, and use the tRNA gene of the reptile class as a universal internal reference gene for the PCR detection of reptile pathogen nucleic acid.
[0030] (2) The detection primer probe for the universal reference gene proposed in the present invention overcomes the defect that the ordinary reference gene primers can only adapt to one type of reptile, so that the kit using the primers is universal for multiple reptiles and multiple tissues, is not interfered by other genomic nucleic acids, and can be applied to the detection of multiple reptile internal references, which greatly improves the sample application range, improves the detection efficiency, and saves the reagent development cost.
[0031] (3) The present invention uses endogenous reference gene detection, which does not require the addition of exogenous genes or pseudoviruses containing exogenous genes before nucleic acid extraction or before PCR, thereby simplifying the experimental operation process and reducing material costs. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1The test results of the amplification efficiency of the first set of primer probes designed in Example 2 are shown.
[0033] Figure 2 The test results of the amplification efficiency of the second set of primer probes designed in Example 2 are shown.
[0034] Figure 3 The test results of the amplification efficiency of the third set of primer probes designed in Example 2 are shown.
[0035] Figure 4 The amplification patterns of the 1st, 2nd and 3rd groups of primer probes in Example 3 for qPCR detection of nucleic acids extracted from crocodile muscle tissue are shown.
[0036] Figure 5 The amplification patterns of the 1st, 2nd and 3rd groups of primer probes in Example 3 for qPCR detection of nucleic acids extracted from muscle tissue of flat-breasted turtles are shown.
[0037] Figure 6 The amplification patterns of the 1st, 2nd and 3rd groups of primer probes in Example 3 for qPCR detection of nucleic acids extracted from the muscle tissue of the turtle are shown.
[0038] Figure 7 The amplification patterns of the 1st, 2nd and 3rd groups of primer probes in Example 3 for qPCR detection of nucleic acids extracted from muscle tissue of alligator turtles are shown.
[0039] Figure 8 The amplification patterns of the 1st, 2nd and 3rd groups of primer probes in Example 3 for qPCR detection of nucleic acids extracted from green turtle muscle tissue are shown.
[0040] Fig. 9 The amplification patterns of the 1st, 2nd and 3rd groups of primer probes in Example 3 for qPCR detection of nucleic acids extracted from the muscle tissue of turtles are shown.
[0041] Fig.10 The amplification patterns of the 1st, 2nd and 3rd groups of primer probes in Example 3 for qPCR detection of nucleic acids extracted from muscle tissue of yellow-spotted side-necked turtle are shown.
[0042] Fig.11 The amplification patterns of the 1st, 2nd and 3rd groups of primer probes in Example 3 for qPCR detection of nucleic acids extracted from muscle tissue of two-clawed soft-shelled turtle are shown.
[0043] Fig.12 The amplification pattern of the first group of primers and probes in Example 4 for qPCR detection of nucleic acids extracted from oral swabs, skin swabs, cloacal swabs, blood, and muscle tissues of turtles is shown.
[0044] Fig.13The amplification pattern of qPCR detection of golden coin turtle herpes virus infection samples in Example 5 is shown. DETAILED DESCRIPTION
[0045] In order to more clearly illustrate the technical solution of the present invention and make the above-mentioned purposes, features and advantages of the embodiments of the present invention more obvious and understandable, the following will be described in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to illustrate the present invention, and are not used to limit the scope of the present invention.
[0046] Unless otherwise specified, the materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels.
[0047] Example 1 - Candidate gene screening
[0048] The present invention downloads various tRNA sequences of reptiles from NCBI, and first compares the reference gene database of crocodiles, flat-breasted turtles, green turtles, flower turtles, temple turtles, snapping turtles, yellow-spotted side-necked turtles, and two-clawed turtles to screen out highly conserved tRNA gene fragments by bioinformatics methods. Highly conserved tRNA sequences with a consistency rate greater than 97% in the database can be used as candidate genes, and finally three target genes are screened out. The nucleotide sequences of the three candidate genes are shown in Table 1 below.
[0049] Table 1. Nucleotide sequences of candidate genes
[0050]
[0051] Example 2 - Primer screening and testing
[0052] According to the three candidate internal reference genes screened in Example 1, upstream and downstream primers were designed. In addition to meeting the general requirements for primer design, it was also required that the primer probes had no more than one base mismatch with the gene sequences of various reptiles. One set of primer probes was designed for each gene. The sequences of the three sets of primer probes are shown in Table 2 below.
[0053] Table 2. Primers and probes for candidate genes
[0054]
[0055] The specific probe of the candidate internal reference gene carries a VIC fluorescent reporter group and a BHQ1 fluorescent quencher group at its 5' end and 3' end, respectively.
[0056] The primer probes and plasmids to be screened were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the plasmids were used for amplification efficiency testing. The synthesized plasmid was 5 μg, and its total copy number was calculated according to the following formula:
[0057]
[0058] In this example, the total plasmid copy number was determined by the above method, and then the plasmid copy number was calibrated by a 10-fold gradient dilution method. 0 copies / μL to 1×10 5 The copies / μL plasmid copy number was used as a template to determine the amplification efficiency of each primer probe.
[0059] Q-PCR amplification was performed using the High Affinity HotStart Taq Kit (Tiangen, ET108-02). A 25 μL reaction system was prepared according to the instructions: 5 μL 5×Probe qPCR Buffer, 2.5 μL 10×HA buffer, 0.4 μL High Affinity HotStart Taq Enzyme, 0.5 μL internal reference gene upstream primer (10 μM), 0.5 μL internal reference gene downstream primer (10 μM), 0.4 μL internal reference gene probe (10 μM), 5 μL DNA template, and 10.7 μL nuclease-free water.
[0060] The reaction was carried out on an ABI7500 real-time fluorescence quantitative PCR instrument (Applied Biosystems, USA) under the following reaction conditions: denaturation at 95°C for 5 min, 95°C for 15 s, 61°C for 30 s, and 45 cycles.
[0061] The results are as follows Figures 1 to 3 shown. Figure 1 The results of the amplification efficiency test of the first set of primer probes are shown. Figure 2 The results of the amplification efficiency test of the second set of primer probes are shown. Figure 3 The results of the test of the amplification efficiency of the third set of primer probes are shown. The results show that the amplification efficiency of the three sets of primer probes is between 88% and 100%, R 2 The values were all above 0.99, meeting the preliminary screening requirements for PCR primers and probes.
[0062] Example 3-Testing of primer probes in different reptile muscle tissues
[0063] Further tests were performed based on the three sets of primer probes in Example 2 to verify their amplification effects in different reptiles.
[0064] Reptile cryopreserved samples were obtained from the Guangdong Wildlife Conservation Center, including crocodile (Crocodylussiamensis), flat-breasted turtle (Platysternon megacephalum), green turtle (Lepidochelys olivacea), flower turtle (Ocadia sinensis), temple turtle (Hieremys annandalei), alligator turtle (Macrochelys temminckii), yellow-spotted side-necked turtle (Podocnemis unifilis), and two-clawed turtle (Carettochelys insculpta). These cryopreserved samples were all muscle tissues. The muscle samples were minced and homogenized, and nucleic acids were extracted using a nucleic acid extraction reagent (TIANGEN DNA / RNA AllPrepKit, Cat. No. DP422).
[0065] Q-PCR amplification was performed using the High Affinity HotStart Taq kit (Tiangen, ET108-02). A 25 μL reaction system was prepared according to the instructions: 5 μL 5×Probe qPCR Buffer, 2.5 μL 10×HA buffer, 0.4 μL High Affinity HotStart Taq Enzyme, 0.5 μL upstream primer (10 μM), 0.5 μL downstream primer (10 μM), 0.4 μL probe (10 μM), 10.7 μL nuclease-free water, and 5 μL DNA template.
[0066] The reaction was carried out on a fluorescent quantitative PCR instrument (MacroStone, SLAN-48P) under the following conditions: denaturation at 95°C for 5 min, 95°C for 15 s, 61°C for 30 s, 45 cycles, with 2 replicates for each sample.
[0067] The final amplification analysis results are as follows Figures 4 to 11 shown. Figures 4 to 11 The amplification patterns of qPCR detection of nucleic acid extracted from muscle tissues of crocodiles, flat-breasted turtles, temple turtles, alligator snapping turtles, green turtles, flower turtles, yellow-spotted side-necked turtles, and two-clawed turtles by three sets of primer probes designed according to three candidate genes are shown respectively. As shown in the figure, the three sets of primer probes can have good amplification results for the above-mentioned various muscle tissues, and the Ct values are all between 22-27, which meets the needs of internal reference gene detection. The first set of primer probes is superior to the other two sets of primer probes in terms of fluorescence intensity and Ct value, so the primer probe of candidate gene 1 (i.e., the first set of primer probes) is selected for subsequent testing.
[0068] Example 4 - Tests in different tissues of soft-shell turtle (Trionyx sinensis)
[0069] The experimental conditions of Example 3 were adopted, and the first group of primers and probes were used to extract DNA from oral swabs, skin swabs, cloacal swabs, blood, and muscle tissues of soft-shell turtles, and then qPCR detection was performed. Each sample was repeated twice.
[0070] Test results such as Fig.12 As shown. Fig.12 It can be seen that the first group of primer probes can amplify DNA extracted from turtle oral swabs, skin swabs, cloaca swabs (feces), blood, and muscle tissues, with a Ct value range of 22-29, which can meet the needs of internal reference gene detection in different tissues.
[0071] Example 5-Test of samples infected with the golden coin turtle herpes virus (TeHV)
[0072] This embodiment takes the golden coin turtle herpes virus TeHV as an example to test the detection effect of the golden coin turtle herpes virus TeHV and the reptile internal reference gene.
[0073] The primer probe of the golden coin turtle herpes virus TeHV was obtained as follows: the nucleic acid sequence gly B gene (KP979724.1) of the virus was found in the NCBI library, and the gly B gene homologous regions of TeHV1 and TeHV3 were screened to design universal primer probes for both. The designed primer probe sequences are as follows:
[0074] Upstream primer TeHV-F: CTATTTCCCATGACCGCCAAATC;
[0075] Downstream primer TeHV-R: CGGGCTATCAGCATGGTTTC;
[0076] Probe TeHV-P: FAM-CCGTCGTGCCTCGTCATCCATCTC-BHQ1.
[0077] The samples infected with the herpesvirus TeHV of the golden coin turtle were samples of golden coin turtles that had been infected with the herpesvirus and died. Oral swabs and skin swabs of the golden coin turtles and a small amount of chopped muscle samples were mixed, and nucleic acid was extracted using a nucleic acid extraction reagent (TIANGENDNA / RNA AllPrep Kit, catalog number DP422), and then qPCR detection was performed using the following experimental conditions.
[0078] Prepare the following two PCR-mixes:
[0079] The first type contains a primer probe of the golden coin turtle herpes virus TeHV and the above-mentioned preferred first group of internal reference gene primer probes, and the system is prepared as follows: 5×Probe qPCR Buffer 5μL, 10×HAbuffer 2.5μL, High Affinity HotStart Taq Enzyme 0.4μL, golden coin turtle herpes virus TeHV upstream primer (10μM) 0.6μL, golden coin turtle herpes virus TeHV downstream primer (10μM) 0.6μL, golden coin turtle herpes virus TeHV probe (10μM) 0.5μL, the upstream primer of the first group of internal reference gene primer probes 0.5μL, the downstream primer of the first group of internal reference gene primer probes 0.5μL, the probe of the first group of internal reference gene primer probes 0.4μL, DNA template 5μL, and nuclease-free water 9μL. Two replicates were performed during amplification.
[0080] The second type only contains primers and probes of the golden coin turtle herpes virus TeHV, 5×Probe qPCR Buffer 5μL, 10×HA buffer 2.5μL, High Affinity HotStart Taq Enzyme 0.4μL, golden coin turtle herpes virus TeHV upstream primer (10μM) 0.6μL, golden coin turtle herpes virus TeHV downstream primer (10μM) 0.6μL, golden coin turtle herpes virus TeHV probe (10μM) 0.5μL, DNA template 5μL, nuclease-free water 10.4μL. Two replicates were performed during amplification.
[0081] The reaction was carried out on a fluorescent quantitative PCR instrument (MacroStone, SLAN-48P) under the following conditions: denaturation at 95°C for 5 min, 95°C for 15 s, 61°C for 30 s, 45 cycles, with 2 replicates for each sample.
[0082] The results are as follows Fig.13 As shown in the figure, the first PCR mix containing the golden coin turtle herpes virus TeHV and the first group of internal reference gene primers and probes can simultaneously detect TeHV and the internal reference gene (green curve), and compared with the second PCR mix without the internal reference gene primers, the Ct value of TeHV amplification is almost unchanged, and the fluorescence intensity does not decrease, indicating that the simultaneous amplification of the internal reference gene has no obvious effect on the amplification of TeHV.
[0083] The above-described embodiments of the present invention do not constitute a limitation on the protection scope of the present invention. Any modification, equivalent substitution, improvement and reverse complementation of sequences made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A universal internal reference gene for nucleic acid amplification detection of reptile pathogens, characterized in that: The universal internal reference gene is a Reptilian tRNA gene.
2. A primer probe for detecting the universal reference gene according to claim 1, characterized in that: The primer probe comprises: Upstream primer: 5′-TCGTTGGTCTAGGGGTATGATT-3′; Downstream primer: 5′-GGCTCGTCCGGGATTTG-3′; Probe: 5′-VIC-CCGGGACCTCTCGCACCCTAAGC-BHQ1-3′.
3. Use of the primer probe according to claim 2 in preparing a nucleic acid amplification detection kit for reptile pathogens.
4. The use according to claim 3, characterized in that: The reptiles are any one or more of the orders Testudinata, Crocodilians, Squamata, Rhynchocephalidae, and Calycosauridae.
5. The use according to claim 3, characterized in that: The pathogens include any one or more of viruses, bacteria, and parasites.
6. The use according to claim 3, characterized in that: The pathogen is any one or more of cytomegalovirus, green turtle papillomavirus, herpes virus, Chinese soft-shelled turtle yellow virus, iris virus, frog virus, Aeromonas, Pseudomonas, Cryptosporidium, and amoeba.
7. A kit for nucleic acid amplification detection of reptile pathogens, characterized in that: The kit comprises the primer probe according to claim 2.
8. The kit according to claim 7, characterized in that The nucleic acid amplification detection is DNA pathogen detection or RNA pathogen amplification detection.
9. The kit according to claim 7, characterized in that The nucleic acid amplification detection is any one of real-time fluorescence quantitative PCR detection, conventional PCR detection, loop-mediated isothermal amplification detection, nucleic acid sequence-dependent amplification detection, rolling circle amplification detection, single primer isothermal amplification detection, helicase-dependent DNA isothermal amplification, recombinase polymerase amplification, and chain replacement amplification.
10. The kit according to any one of claims 7 to 9, characterized in that The kit is used to amplify nucleic acids extracted from reptile tissues.