Molecular marker for fish identification as well as primer and application thereof

Abstract

The invention belongs to the technical field of fish genetic breeding and molecular biology, and particularly relates to a molecular marker for fish identification as well as a primer and application thereof. By developing, screening and identifying a retrotransposon SINEs insertion polymorphism molecular marker in a fish genome and designing a specific amplification primer, through primer amplification and a subsequent biological analysis method, fish strains are identified, genetic traceability and tracing are carried out, a mutant library is constructed, biological population diversity is identified, molecular breeding is assisted, and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of fish genetic breeding and molecular biology, and specifically relates to a molecular marker for fish identification and a primer and application thereof. Background Art

[0002] Fish genetic breeding is the application of genetic principles and biotechnology to improve fish varieties and cultivate new varieties. It involves selection, hybridization, genetic engineering and other technologies, aiming to improve the growth rate, disease resistance and ability of fish to adapt to specific environments. Through genetic breeding, new fish varieties with delicious meat, fast growth and strong adaptability can be cultivated. Fish distant hybridization recombines the genetic material of two species to form new hybrids with hybrid vigor. The hybridization of female white crucian carp and male red crucian carp, Hefang crucian carp 2, and the hybridization of female Hefang crucian carp and male white crucian carp, are new breakthroughs in the field of fish hybrid breeding. Compared with their parents, Hefang crucian carp and Hefang crucian carp 2 have significant hybrid advantages, which are manifested in good body shape, fast growth, tender meat, high nutritional value, and high fertilization rate and hatching rate. At present, Hefang crucian carp and Hefang crucian carp 2 lack effective hybrid molecular markers.

[0003] Short interspersed nuclear elements (SINEs) are moderately repetitive sequences widely distributed in the genomes of eukaryotic organisms, with a length of generally 80-400bp. As a non-autonomous jumping retrotransposon, SINEs jump from their original sites and insert into new sites in the genome by a "copy-paste" mechanism under the action of the transposase encoded by the autonomous retrotransposon Line, which can change the gene structure, change the gene function or generate new genes, leading to the formation of biological genetic diversity. Organisms lack the mechanism to delete and insert SINEs. SINEs are inserted into the genome to produce stable inheritance, resulting in two genotypes of SINEs insertion or deletion at the same locus in the genome of the species. This "insertion / deletion" polymorphic molecular marker can be used to trace the source of genetic material. This new type of molecular marker has the advantages of simple and rapid detection means, good repeatability, accurate judgment and low development cost. It has high application value and can be used for research on genetic evolution and molecular-assisted breeding of crucian carp hybrid strains. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker for fish identification, its primers and applications, by developing, screening and identifying retrotransposon SINE insertion polymorphic molecular markers in the genome of fish (especially crucian carp, such as the Hefang crucian carp strain), the marker is used for the identification of fish strains (especially crucian carp, such as the Hefang crucian carp strain) and molecular assisted breeding.

[0005] The technical solution of the present invention is a method for screening molecular markers for fish identification, comprising the following steps:

[0006] (1) The resequencing reads of the fish parental genomes and hybrid offspring genomes were aligned to the retrotransposon SINEs database using Bowtie2, and the reads that aligned to SINEs were screened;

[0007] (2) The reads of the aligned SINEs were blasted back to the reference genome using blastn, the blasted positions were retained, and the reference genome was slid with a fixed window using bedtools to detect the SINEs insertion sites and construct a data matrix of SINEs insertions or deletions in the genome resequencing sequence;

[0008] (3) Screening of SINEs for insertion polymorphic sites.

[0009] In step (3), SINEs are inserted into the polymorphic site and present two states: insertion and deletion.

[0010] In step (3), the SINEs insertion polymorphic sites screened out are at least one of WCC-2 (LG30: 28396075-28396410), WR-4 (LG07: 24848048-24848232) and WR-6 (LG37: 19073551-19073782). Furthermore, the SINEs insertion polymorphic sites screened out were WCC-2 (LG30: 28396075-28396410), or WR-6 (LG37: 19073551-19073782), or a combination of three sites: WCC-2 (LG30: 28396075-28396410), WR-4 (LG07: 24848048-24848232) and WR-6 (LG37: 19073551-19073782).

[0011] Furthermore, the fish is a freshwater fish, including Cypriniformes, Siluriformes, and Characiniformes, such as the crucian carp of the Cyprinidae family, the white crucian carp, the red crucian carp, and the hybrid strain of white crucian carp and red crucian carp (such as Hefang crucian carp and Hefang crucian carp No. 2).

[0012] A method for designing molecular marker primers for fish identification comprises the following steps: using a sequence containing a SINEs insertion polymorphic site obtained by the molecular marker screening method for fish identification as a template to design primers.

[0013] Furthermore, primers were designed using the flanking sequences containing the SINEs insertion polymorphic sites as templates.

[0014] Furthermore, primers were designed using Primer Premier 6.0.

[0015] Furthermore, the SINEs insertion polymorphic site is at least one of WCC-2 (LG30: 28396075-28396410), WR-4 (LG07: 24848048-24848232) and WR-6 (LG37: 19073551-19073782). Furthermore, the SINEs insertion polymorphic site is WCC-2 (LG30: 28396075-28396410), or WR-6 (LG37: 19073551-19073782), or a combination of three sites: WCC-2 (LG30: 28396075-28396410), WR-4 (LG07: 24848048-24848232) and WR-6 (LG37: 19073551-19073782).

[0016] A primer for molecular markers for fish identification, comprising at least one upstream and downstream primer of WCC-2, WR-4 and WR-6, wherein the upstream and downstream primers of WCC-2, WR-4 and WR-6 are as follows:

[0017] Upstream primer of WCC-2: TTTTCCCAGGTAGGCTATGTT (SEQ ID NO. 1);

[0018] Downstream primer of WCC-2: CCCTCCCTACTTTACAAGAACTG (SEQ ID NO. 2);

[0019] Upstream primer of WR-4: ACAGTCCTTCAGATGAATGGTT (SEQ ID NO. 3);

[0020] Downstream primer of WR-4: GAATACAGGCCCTGGTCTTT (SEQ ID NO. 4);

[0021] Upstream primer of WR-6: AAGTCCTCACAATGCCTGG (SEQ ID NO. 5);

[0022] Downstream primer of WR-6: GCATCAATTGCAACAGTCG (SEQ ID NO. 6).

[0023] Further, it contains upstream and downstream primers of WCC-2, or upstream and downstream primers of WR-6, or upstream and downstream primers of the polymorphic sites of three SINEs of WCC-2, WR-4 and WR-6.

[0024] Furthermore, the fish is a freshwater fish, including Cypriniformes, Siluriformes, and Characiniformes, such as the crucian carp of the Cyprinidae family, the white crucian carp, the red crucian carp, and the hybrid strain of white crucian carp and red crucian carp (such as Hefang crucian carp and Hefang crucian carp No. 2).

[0025] A molecular marker for fish identification is determined by the screening method of the molecular marker for fish identification, or is the amplification site of the primer of the molecular marker for fish identification.

[0026] The molecular marker for fish identification is a SINEs insertion polymorphic site, presenting two states of insertion and deletion. Further, the SINEs insertion polymorphic site is at least one of WCC-2 (LG30: 28396075-28396410), WR-4 (LG07: 24848048-24848232) and WR-6 (LG37: 19073551-19073782). Furthermore, the SINEs insertion polymorphic site is WCC-2 (LG30: 28396075-28396410), or WR-6 (LG37: 19073551-19073782), or a combination of three sites: WCC-2 (LG30: 28396075-28396410), WR-4 (LG07: 24848048-24848232) and WR-6 (LG37: 19073551-19073782).

[0027] The primers for the molecular marker for fish identification contain upstream and downstream primers of at least one of WCC-2, WR-4 and WR-6, and the upstream and downstream primers of WCC-2, WR-4 and WR-6 are shown in SEQ ID NO.1-2, SEQ ID NO.3-4, and SEQ ID NO.5-6, respectively. Further, the primers contain upstream and downstream primers of WCC-2, or upstream and downstream primers of WR-6, or a combination of upstream and downstream primers of three SINEs insertion polymorphic sites of WCC-2, WR-4 and WR-6.

[0028] The molecular marker for fish identification and / or the primer for the molecular marker for fish identification of the present invention have at least one of the following uses:

[0029] (1) Fish strain identification;

[0030] (2) Germplasm identification;

[0031] (3) Parentage tracing;

[0032] (4) Genetic tracing;

[0033] (5) Genetic tracing;

[0034] (6) Confirmation of genetic contribution;

[0035] (7) Construction of mutant library;

[0036] (8) Identification of biological population diversity;

[0037] (9) Molecular assisted breeding.

[0038] The fish strain identification is freshwater fish strain identification, and further is carp strain identification, specifically crucian carp, and the identification of white crucian carp, red crucian carp, and hybrid strains of white crucian carp and red crucian carp (such as Hefang crucian carp and Hefang crucian carp No. 2) among crucian carp.

[0039] The present invention provides at least one of the following products, containing the above-mentioned molecular marker for fish identification and / or the primer for the above-mentioned molecular marker for fish identification:

[0040] (1) Products for fish strain identification;

[0041] (2) Products for germplasm identification;

[0042] (3) Products for parentage tracing;

[0043] (4) Products for genetic tracing;

[0044] (5) Genetic tracing products;

[0045] (6) Products for confirming the genetic contribution;

[0046] (7) Products for mutant library construction;

[0047] (8) Products for identification of biological population diversity;

[0048] (9) Products for molecular assisted breeding.

[0049] The product may be a reagent, a kit, a consumable, an instrument or a device.

[0050] The fish strain is a freshwater fish strain, further a Cyprinidae strain, specifically crucian carp, white crucian carp, red crucian carp, and a hybrid strain of white crucian carp and red crucian carp (such as Hefang crucian carp and Hefang crucian carp No. 2).

[0051] The invention provides a biological experimental method, which comprises the following steps: extracting fish genome DNA as a template, using the primers of the molecular marker for fish identification of the invention to amplify, and performing biological analysis.

[0052] The biological analysis includes at least one of gel electrophoresis, Sanger sequencing, bioinformatics analysis and the like.

[0053] Specifically, the biological experimental method of the present invention can be used for identification of fish strains, especially identification of carp strains, such as identification of crucian carp, white crucian carp, red crucian carp, and hybrid strains of white crucian carp and red crucian carp.

[0054] When identifying fish strains, agarose gel electrophoresis is performed after primer amplification, and the number and size of primer amplified fragments are counted to identify the fish strain.

[0055] The present invention has the advantages that:

[0056] As demonstrated in the examples, molecular marker technology based on SINE site amplified fragment polymorphism was used to complete PCR amplification reaction and gel electrophoresis detection to quickly identify the Hefang crucian carp strain using specific PCR primer pairs. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 Gel electrophoresis of four strains of Hefang crucian carp amplified by WCC-2 primer pair, WCC: white crucian carp; RCC: red crucian carp; WR: Hefang crucian carp; WR2: Hefang crucian carp 2; 12 samples were tested for each strain, and the DNA ladder was 100bp.

[0058] Figure 2 Gel electrophoresis of four strains of Hefang crucian carp amplified by WR-4 primer pair, WCC: white crucian carp; RCC: red crucian carp; WR: Hefang crucian carp; WR2: Hefang crucian carp 2; 12 samples were tested for each strain, and the DNA ladder was 100bp.

[0059] Figure 3 Gel electrophoresis of four strains of Hefang crucian carp amplified by WR-6 primer pair, WCC: white crucian carp; RCC: red crucian carp; WR: Hefang crucian carp; WR2: Hefang crucian carp 2; 12 samples were tested for each strain, and the DNA ladder was 100bp. DETAILED DESCRIPTION

[0060] The process of inserting SINEs into polymorphic sites, amplifying SINEs into polymorphic sites with specific primers, PCR amplification, and verifying SINEs insertion or deletion is as follows:

[0061] Step 1: Primer Design

[0062] Bowtie2 was used to align the resequencing reads of the Hefang crucian carp strain to the retrotransposon SINEs database, and the reads that aligned to SINEs were screened. The reads that aligned to SINEs were back-linked to the reference genome by blastn, and the position of the backlink was retained. The reference genome was slid in a fixed window using bedtools to detect SINEs insertion sites and construct a data matrix of SINEs insertion or deletion in the genome resequencing sequence. Three SINEs insertion polymorphic sites WCC-2 (LG30: 28396075-28396410), WR-4 (LG07: 24848048-24848232), and WR-6 (LG37: 19073551-19073782) were screened. Primer Premier 6.0 software was used to design upstream and downstream specific primers based on the flanking sequences of the sites. They were synthesized by Shanghai Bioengineering Company. The primer sequences of the three sites are:

[0063] Upstream primer of WCC-2: TTTTCCCAGGTAGGCTATGTT (SEQ ID NO. 1);

[0064] Downstream primer of WCC-2: CCCTCCCTACTTTACAAGAACTG (SEQ ID NO. 2);

[0065] Upstream primer of WR-4: ACAGTCCTTCAGATGAATGGTT (SEQ ID NO. 3);

[0066] Downstream primer of WR-4: GAATACAGGCCCTGGTCTTT (SEQ ID NO. 4);

[0067] Upstream primer of WR-6: AAGTCCTCACAATGCCTGG (SEQ ID NO. 5);

[0068] Downstream primer of WR-6: GCATCAATTGCAACAGTCG (SEQ ID NO. 6).

[0069] Step 2: Extraction of genomic DNA from experimental materials

[0070] WCC (white crucian carp), RCC (red crucian carp), WR (Hefang crucian carp) and WR2 (Hefang crucian carp 2) strain samples were provided by Hunan Normal University. About 30 mg of dorsal fin was cut and genomic DNA was extracted using an animal tissue genomic DNA extraction kit according to the instructions. The concentration and purity of the extracted DNA were determined using an ultra-micro spectrophotometer (NanoDrop One; Thermofisher Scientific). The quality and integrity of the DNA were tested by 1% agarose gel electrophoresis and stored at -20°C.

[0071] Step 3: PCR amplification of genomic DNA

[0072] The 20 μL system of PCR amplification reaction contained 1 μL DNA template (about 200 ng), 1 μL of primers (10 μM), 10 μL 2× Taq Master Mix (Vazyme, Nanjing, China) and 7 μL ddH2O. The PCR reaction program was as follows: 95°C denaturation for 3 m; 95°C denaturation for 15 s, annealing for 15 s, 72°C extension for 30 s, 29 cycles; 72°C extension for 5 m. The PCR products were electrophoresed on 2% agarose gel and observed and photographed using the BioRad ChemiDoc XRS imaging system (Hercules, CA).

[0073] Step 4: Verification of SINEs insertion or deletion

[0074] PCR amplified bands were separated by 2% agarose gel electrophoresis, and the DNA fragments were purified and recovered, connected to the pSWE-Topo ZeroVector vector (Servicebio), transformed into competent cells, and positive clones were selected. After identification by bacterial liquid PCR, they were sequenced by Maipu Biotechnology to confirm the insertion or deletion of SINEs.

[0075] By using the molecular markers of SINEs insertion or deletion at the above three sites and based on the polymorphism of PCR-amplified DNA fragments, the genetic material sources of Hefang crucian carp strains and hybrids can be quickly and accurately identified.

[0076] That is, the present invention targets the SINEs site obtained in the genome of the Hefang crucian carp strain, and the SINEs site presents two states of insertion and deletion. According to the flanking sequence of the SINEs site, heterosexual primers are designed, and PCR amplification, agarose gel electrophoresis, molecular cloning and other methods are used to obtain the polymorphism of the DNA fragment of the SINEs site, so as to identify the Hefang crucian carp (WR) and Hefang crucian carp No. 2 (WR2) produced by hybridization of the original parent white crucian carp (WCC) and red crucian carp (RCC). The present invention uses specific primers of the SINEs site, through PCR amplification and gel electrophoresis detection, to quickly identify the hybrid Hefang crucian carp. Providing molecular basis in fish genetic breeding helps to improve breeding efficiency and effectively accelerate the breeding process.

[0077] The application of the amplification results in the identification of the combined crucian carp strains will be further described in detail below in conjunction with the attached drawings.

[0078] Example 1

[0079] The specific primers for the SINE insertion site have the following sequences:

[0080] The upstream primer of WCC-2 is shown in SEQ ID NO.1.

[0081] The downstream primer of WCC-2 is shown in SEQ ID NO.2.

[0082] from Figure 1 It can be seen that two DNA fragments were amplified from the four strains. Among the 12 samples of WCC, SINEs were inserted in 11 samples and only one sample lacked it, with the inserted DNA fragment size of 641bp; all 12 samples of RCC amplified a DNA fragment of 336bp, lacking SINEs insertion; among the 12 samples of WR, 10 samples simultaneously amplified DNA fragments of 641bp and 336bp, and were identified as the hybrid of white crucian carp and red crucian carp, with an identification accuracy of 83.3%; among the 12 samples of WR2, 8 samples simultaneously amplified DNA fragments of 641bp and 336bp, and were identified as the hybrid of white crucian carp and WR, with an identification accuracy of 66.7%.

[0083] Example 2

[0084] The specific primers for the SINE insertion site have the following sequences:

[0085] The upstream primer of WR-4 is shown in SEQ ID NO.3.

[0086] The downstream primer of WR-4 is shown in SEQ ID NO.4.

[0087] from Figure 2 It can be seen that two DNA fragments were amplified from the four strains. Among the 12 samples of WCC, SINEs were inserted in 10 samples and lacked in 2 samples, and the size of the inserted DNA fragment was 839bp; the 12 samples of RCC all amplified a 488bp DNA fragment lacking SINEs insertion; among the 12 samples of WR, 2 samples simultaneously amplified DNA fragments of 839bp and 488bp, and were identified as the hybrid of white crucian carp and red crucian carp, with an identification accuracy of 16.7%; among the 12 samples of WR2, 2 samples simultaneously amplified DNA fragments of 839bp and 488bp, and were identified as the hybrid of white crucian carp and WR, with an identification accuracy of 16.7%.

[0088] Example 3

[0089] The specific primers for the SINE insertion site have the following sequences:

[0090] The upstream primer of WR-6 is shown in SEQ ID NO.5.

[0091] The downstream primer of WR-6 is shown as SEQ ID NO.6.

[0092] from Figure 3It can be seen that two DNA fragments were amplified from the four strains. The 712bp DNA fragment amplified from the 12 samples of WCC had SINEs insertion; the 490bp DNA fragment amplified from the 12 samples of RCC lacked SINEs insertion; among the 12 samples of WR, 11 samples simultaneously amplified DNA fragments of 712bp and 490bp and were identified as the hybrid of white crucian carp and red crucian carp, with an identification accuracy of 91.7%; among the 12 samples of WR2, 7 samples simultaneously amplified DNA fragments of 712bp and 490bp and were identified as the hybrid of white crucian carp and WR, with an identification accuracy of 58.3%.

[0093] Example 4

[0094] Experimental methods

[0095] The specific primers for the SINE insertion site have the following sequences:

[0096] The upstream primer of WCC-2 is shown in SEQ ID NO.1.

[0097] The downstream primer of WCC-2 is shown in SEQ ID NO.2.

[0098] The upstream primer of WR-4 is shown in SEQ ID NO.3.

[0099] The downstream primer of WR-4 is shown in SEQ ID NO.4.

[0100] The upstream primer of WR-6 is shown in SEQ ID NO.5.

[0101] The downstream primer of WR-6 is shown as SEQ ID NO.6.

[0102] After PCR amplification, agarose gel electrophoresis was performed to detect Figure 1-3 It can be seen that WCC amplified three DNA bands of different sizes with SINEs inserted (641bp, 839bp, 712bp), while RCC4 amplified three corresponding DNA bands lacking SINEs (336bp, 488bp, 490bp). Based on the combined application of these different-sized bands, the recognition accuracy of hybrid WR was 100%, and the recognition accuracy of WR2 was 91.7%.

[0103] Finally, it should be noted that the above description of the embodiments is for the convenience of ordinary technicians in this technical field to understand and use the instructions. The implementation methods of the present invention are not limited to the above embodiments. Any other technical solutions obtained by changes, modifications, substitutions, combinations, and simplifications that do not deviate from the technical essence and principles of the present invention are included in the protection scope of the present invention.

Claims

1. A method for screening molecular markers for fish identification, comprising the steps of: (1) The resequencing reads of the fish parental genomes and hybrid offspring genomes were aligned to the retrotransposon SINEs database using Bowtie2, and the reads that aligned to SINEs were screened; (2) The reads of the aligned SINEs were blasted back to the reference genome using blastn, the blasted positions were retained, and the reference genome was slid with a fixed window using bedtools to detect the SINEs insertion sites and construct a data matrix of SINEs insertions or deletions in the genome resequencing sequence; (3) Screening of SINEs for insertion polymorphic sites.

2. A method for designing molecular marker primers for fish identification, characterized in that: The steps include: Primers are designed using the sequence containing the SINEs insertion polymorphic site obtained by the screening method of claim 1 as a template.

3. A primer for molecular markers for fish identification, characterized in that: Containing at least one of the upstream and downstream primers of WCC-2, WR-4 and WR-6, the upstream and downstream primers of WCC-2, WR-4 and WR-6 are as follows: Upstream primer of WCC-2: TTTTCCCAGGTAGGCTATGTT SEQ ID NO.1; Downstream primer of WCC-2: CCCTCCCTACTTTACAAGAACTG SEQ ID NO.2; Upstream primer of WR-4: ACAGTCCTTCAGATGAATGGTT SEQ ID NO.3; Downstream primer of WR-4: GAATACAGGCCCTGGTCTTT SEQ ID NO.4; Upstream primer of WR-6: AAGTCCTCACAATGCCTGG SEQ ID NO.5; Downstream primer of WR-6: GCATCAATTGCAACAGTCG SEQ ID NO.

6.

4. The primer according to claim 3, characterized in that contain: Upstream and downstream primers of WCC-2, or WR-6 upstream and downstream primers, or Upstream and downstream primers of WCC-2, WR-4 and WR-6.

5. A molecular marker for fish identification, characterized in that: Determined by the screening method of claim 1, or is the amplification site of the primer of claim 3 or 4.

6. The molecular marker for fish identification according to claim 5, characterized in that: At least one of WCC-2: LG30 28396075-28396410, WR-4: LG07 24848048-24848232 and WR-6: LG3719073551-19073782.

7. The molecular marker for fish identification according to claim 6, characterized in that: It is WCC-2: LG30 28396075-28396410, or WR-6: LG37 19073551-19073782, or the combination of WCC-2: LG30 28396075-28396410, WR-4: LG07 24848048-24848232 and WR-6: LG3719073551-19073782.

8. The molecular marker for fish identification according to any one of claims 5 to 7 and / or the primer according to claim 3 or 4, having at least one of the following uses: (1) Fish strain identification; (2) Germplasm identification; (3) Parentage tracing; (4) Genetic tracing; (5) Genetic tracing; (6) Confirmation of genetic contribution; (7) Construction of mutant library; (8) Identification of biological population diversity; (9) Molecular assisted breeding.

9. At least one of the following products contains the molecular marker for fish identification according to any one of claims 5 to 7 and / or the primer according to claim 3 or 4: (1) Products for fish strain identification; (2) Products for germplasm identification; (3) Products for parentage tracing; (4) Products for genetic tracing; (5) Genetic tracing products; (6) Products for confirming the genetic contribution; (7) Products for mutant library construction; (8) Products for identification of biological population diversity; (9) Products for molecular assisted breeding.

10. A biological experimental method, characterized in that: The steps include: Extract fish genomic DNA as a template, use the primers described in claim 3 or 4 for amplification, and perform biological analysis.

Images