Methods and kits for detecting single nucleotide polymorphisms (SNPs) by loop-mediated isothermal amplification (LAMP)

Abstract

The present invention provides a method of detecting and / or differentiating one or more single nucleotide polymorphisms (SNPs) in a target nucleic acid sequence in a sample, the method comprising: providing a first oligonucleotide probe complementary to a wild-type target sequence wherein the first oligonucleotide probe comprises a fluorescent label bound to an internal cytosine base, and wherein the oligonucleotide probe does not have a 3 '-end terminator; amplifying the target nucleic acid sequence in the sample by loop-mediated isothermal amplification (LAMP) in a reaction vessel with the first oligonucleotide probe and the second probe or an embedded dye and a blank oligonucleotide to provide an amplified nucleic acid, and probing the amplified nucleic acid sequence; detecting the presence of a target wild-type and / or mutant nucleic acid sequence; and d) differentiating the presence of the target wild-type and / or mutant nucleic acid sequence based on the fluorescent label. The invention also provides a kit for detecting nucleotide polymorphism of a target nucleic acid sequence in a sample.

Description

Technical Field

[0001] The present invention relates to a method and a kit for detecting one or more single nucleotide polymorphisms (SNPs) using LAMP loop-mediated isothermal amplification (LAMP) and fluorescent probes.

[0002] Nucleic acid amplification is one of the most valuable tools in the field of life sciences, including application-oriented fields such as clinical medicine, where the diagnosis of infectious diseases, genetic disorders and genetic traits is particularly beneficial. This process enables DNA, RNA molecules or fragments thereof to be copied for further study, such as detection of target sequences.

[0003] There are many nucleic acid amplification methods, including polymerase chain reaction (PCR) amplification technology, nucleic acid sequence-based amplification (NASBA), self-directed sequence replication (3SR), and loop-mediated isothermal amplification (LAMP). PCR uses thermal denaturation of double-stranded DNA products to promote the next round of DNA synthesis. 3SR and NASBA eliminate thermal denaturation by using a set of transcription and reverse transcription reactions to amplify the target sequence.

[0004] Nucleic acid amplification methods generally amplify target nucleic acids to similar extents, with detection limits of less than 10 copies and within one hour. Due to the poor specificity of target sequence selection, they require sophisticated instruments for amplification or complex methods to detect the amplified products. Although PCR is simple and can achieve high amplification amplitudes, the requirement for high-precision thermal cyclers has prevented this powerful method from being widely used as a routine diagnostic tool, such as in private clinics. Compared with PCR amplification technology, LAMP is a method that can amplify a few DNA copies to more than 100 within one hour under isothermal conditions with higher specificity.

[0005] In some cases, it may be desirable to determine the presence of mutated or otherwise altered nucleic acid sequences, which may exist in variant forms of DNA or RNA, such as genetic variants or defects, the formation of new variants comprising viruses, etc.

[0006] Genetic variation between individuals mostly occurs in the form of single nucleotide polymorphisms (SNPs) or less commonly dinucleotide or trinucleotide polymorphisms (DNPs and TNPs). Such polymorphisms can affect various characteristics of humans, animals, and agricultural products, including susceptibility to disease and resistance to pathogenic drugs. However, SNP mutations can also affect and / or increase the transmissibility and infectivity of pathogens, as demonstrated by the progression and persistence of the SARS-CoV-2 virus in recent years.

[0007] Nucleic acid sequencing methods can be used to detect SNPs. However, existing non-LAMP methods can be slow, costly, and / or unreliable, and often require specialized equipment and / or perishable assay components. For example, the polymerase chain reaction (PCR) amplification technique often used in SNP detection involves cycling the temperature of the reaction mixture during the detection process, which increases the complexity and cost of the assay and often requires specialized equipment.

[0008] Loop-mediated isothermal amplification (LAMP) is generally faster and does not require temperature cycling. LAMP requires 4–6 primers, can be deployed from a dry package at room temperature, and is performed at a single continuous temperature, without the need for the sophisticated temperature cycling equipment required for PCR. This gives it a clear advantage over other detection methods because it has the potential to be used in a wider range of settings. However, there are still some obstacles to the widespread application of LAMP for SNP mutation detection.

[0009] For example, existing methods for SNP detection using LAMP require additional features or complex processes, such as adding SNP mutations to the ends of FIP / BIPLAMP primers (see Costa-Junior et al., J. Parasit. Dis. 2021; 46(1): 47–55). In addition, such methods require post-amplification processing steps, such as enzymatic digestion of the amplified sample with restriction enzymes (see Carvalhais et al., Front Plant Sci. 2019; 10: 547) and / or probe annealing before SNPs can be detected (Hyman et al., 2021; bioRxiv doi: https: / / doi.org / 10.1101 / 2021.03.29.437576). These additional steps increase the technical complexity, cost, and time required to perform the amplification and detection processes.

[0010] Furthermore, despite additional processing, such methods often produce ambiguous results, manifested as changes in reaction amplification time (identifiable by direct visual detection or turbidity) or changes in the baseline fluorescence signal or fluorescence of nonspecific DNA intercalating dyes. Direct visual detection usually provides results at the reaction endpoint and therefore does not provide amplification data in real time. Turbidity and nonspecific intercalating dyes can provide real-time data as amplification occurs; however, this is nonspecific, i.e., all amplification will be detected, regardless of whether it is a true positive amplification or a false amplification due to mispriming or cross-specificity. Such results can be difficult to interpret if different amounts of nucleic acid template are used in the reaction, which is in fact always the case with clinical samples and cannot be analyzed in real time.

[0011] Therefore, there is a need to provide an improved SNP detection system that is simple to use, provides real-time results, and requires minimal equipment. For example, an improved SNP detection system can distinguish homologous sequences that differ only in the presence of one or more single nucleotide polymorphisms. Specifically, there is still a need for a SNP detection and / or differentiation system that provides one or more of the following:

[0012] No post-amplification manipulation (e.g., enzyme digestion or probe annealing) is required;

[0013] can clearly distinguish between wild-type (WT) and mutant sequences, optionally in an unbiased manner;

[0014] No need to compare amplification times or baseline fluorescence levels or use complex statistical analysis to obtain results;

[0015] · No need to replicate the test to obtain unbiased, definitive results; and / or

[0016] Suitable for clinical use, where samples reach different concentrations.

[0017] According to a first aspect of the present invention, a method for detecting a single nucleotide polymorphism (SNP) in a target nucleic acid sequence in a sample is provided, the method comprising: a) providing a first oligonucleotide probe complementary to a wild-type target sequence, wherein the first oligonucleotide probe comprises a fluorophore label that binds to an internal cytosine base, and wherein the oligonucleotide probe does not have a 3′ terminator; b) amplifying the target nucleic acid sequence in the sample by loop-mediated isothermal amplification in a reaction vessel with the first oligonucleotide probe and a second probe or an intercalating dye to provide an amplified nucleic acid, and detecting the amplified nucleic acid sequence; c) detecting the presence of the target wild-type and / or mutant nucleic acid sequence; and d) distinguishing the presence of the target wild-type and / or mutant nucleic acid sequence based on the fluorescent label. In another embodiment, the first oligonucleotide probe is complementary to the mutant sequence of the wild-type target sequence.

[0018] Since the fluorescent probe exists during the amplification process, the fluorescent probe will bind to the target sequence and can be integrated into the amplicon by the BST DNA polymerase. The fluorescence of the attached fluorescent label makes it possible to detect the presence of the amplified target nucleic acid sequence in real time and clearly in the reaction vessel. Since fluorescence can be detected during the reaction, it is particularly advantageous because there is no need to perform post-reaction operations on the amplified nucleic acid. In this way, simpler and more effective target nucleic acid sequence detection can be achieved.

[0019] Additionally, the use of a secondary probe or an intercalating dye allows for real-time detection of further amplified target nucleic acid sequences, and / or amplified nucleic acids throughout the reaction.

[0020] Using the first and second labeled probes in the same LAMP reaction, multiple sequences can be detected and distinguished by one assay, including single or multiple SNPs or wild-type sequences and corresponding mutant sequences. Using the second competing probe (mutant probe) and the first probe (wild-type probe) in the same reaction also increases the specificity of the detection, because the first and second probes compete for binding sites during the reaction. The presence of additional probes in the reaction reduces the chance of the probe binding to an incompletely complementary nucleic acid sequence and producing a false positive result. In the absence of a competing probe (second probe), the first probe (wild-type probe) is more likely to non-specifically bind to a mutant sequence that has only one nucleotide difference from the wild-type sequence. A competing probe with a complete sequence match to the mutant sequence will bind to a sequence with a point mutation (SNP) with a higher affinity than the wild-type probe. The competitive mutant probe will block the binding site in the mutant sequence, preventing the wild-type probe from non-specifically annealing and producing an erroneous amplification signal in the presence of the mutant sequence. The oligonucleotide probe according to the present invention does not have a 3' end terminator. For example, the non-existent 3' end terminator may be a ddNTP. Since there is no 3' end terminator, the labeled oligonucleotide can be incorporated into the amplicon. Therefore, the 3' end of the probe is not "blocked".

[0021] In one aspect of the present invention, the first probe is complementary to the target nucleic acid sequence. Any suitable target sequence can be used. The target sequence can be selected from the wild-type target sequence of any organism. In one embodiment, the first probe can be a wild-type DNA or RNA sequence, optionally with a single point mutation opposite the nucleotide at or near the 3' end of the probe. When there is no competing probe (e.g., a second probe complementary to the mutant sequence of the wild-type target sequence, or there is no competing sequence (e.g., so-called "blank oligonucleotide")), this scheme is particularly advantageous because it reduces potential costs and detection complexity.

[0022] In one embodiment, the target nucleic acid sequence can be a virus. Any suitable virus can be used. For example, the virus can be selected from SARS-CoV-2 or a variant thereof.

[0023] In one aspect of the present invention, the second probe can be selected from a probe complementary to the mutant sequence of the wild-type target sequence, or a universal probe, such as a universal probe capable of detecting both the wild-type target sequence and the mutant sequence of the wild-type target sequence. On the one hand, the second probe can be selected from a probe complementary to the mutant sequence of the wild-type target sequence. In an alternative aspect, the second probe can be selected from a universal probe capable of detecting both the wild-type target sequence and the mutant sequence of the wild-type target sequence. In another approach, the second probe can be selected from a probe complementary to the wild-type target sequence. This approach is suitable when the first probe is selected from a probe complementary to the mutant sequence of the wild-type target sequence.

[0024] In one embodiment, for example, the method of step b) of item 1 involves providing an intercalating dye or a universal probe. The universal probe may be similar to the first probe, except that it targets a nucleic acid sequence common to the wild-type target sequence and the mutant sequence. In a further scheme, the universal probe may not include the nucleotides in which the SNP occurs. In a further scheme, there is no overlap between the sequence of the first probe and the universal probe. In a further scheme, the universal probe targets a gene different from the first and / or second probe in the sample, wherein the different target genes have a sequence more conservative than the sequence targeted by the wild-type and / or mutant probe, and optionally an additional primer set is used. This universal probe can detect wild-type and mutant sequence amplification, thereby the total amplification during the wild-type and / or mutant sequence amplification and the LAMP reaction can be compared.

[0025] In one or more embodiments of the present invention, at least one probe comprises a single point mutation or a double point mutation. Optionally, each probe comprises a single point mutation or a double point mutation. Probes comprising a single point mutation or a double point mutation can detect corresponding single point mutations or double point mutations in a sample nucleic acid sequence.

[0026] In some embodiments of the present invention, a second probe complementary to a mutant sequence of a wild-type target sequence is used, wherein the second probe further comprises a fluorescent label bound to an internal cytosine base and does not have a 3′ terminator; and wherein at least one of the first and second probes contains a single or double point mutation at or near the 3′ end.

[0027] In some aspects of the invention, one or more so-called "blank oligonucleotides" may be used. Any suitable blank oligonucleotide may be used. The blank oligonucleotide is not labeled with a fluorophore, and alternatively, the blank oligonucleotide may include a sequence identical to the first probe. For example, the blank oligonucleotide may include one or more SNP mutations at or near the 3' end or in the middle of the sequence. In one embodiment, the SNP at the 3' end may include a SNP at the terminal nucleotide base at the 3' end of the nucleic acid sequence, and the SNP near the 3' end may include a SNP at the second nucleotide base at the 3' end. In another embodiment, one or more blank oligonucleotides may be identical or different.

[0028] In some aspects of the invention, the blank oligonucleotide may be complementary to the wild-type target sequence. In this approach, the first probe may include one or more SNP mutations at or near the 3' end or in the middle of the sequence. The first probe may be complementary to the mutant sequence of the wild-type sequence. In another approach, one or more probes may include one or more SNP mutations at or near the 3' end or in the middle of the sequence. One or more probes may be complementary to one or more wild-type mutant sequences.

[0029] The purpose of using a blank oligonucleotide is to increase the specificity of the reaction by competing with the fluorescent probe for binding sites, so that the oligonucleotide that more closely reflects the target sequence can be incorporated into the amplified nucleic acid without the presence of a second probe. When it is impossible to design or manufacture a functional competitive second probe labeled with a fluorophore that can be distinguished from the first probe, or a mutant contains multiple SNPs that cannot be covered by a single probe, but they are located in the same position or close to each other and they all produce the same phenotype (e.g., antibiotic resistance), a blank oligonucleotide can be used. In addition, if the mutant sequence includes several different point mutations that are close to each other and cannot be covered by 1 or 2 fluorescent probes, multiple different blank oligonucleotides can be used in the same reaction. In one embodiment, the second probe can be selected from a universal probe, and the method involves providing an intercalated dye or a universal probe, and one or more blank oligonucleotides. In a further embodiment, one or more blank oligonucleotides can be wrapped in or near one or more SNP mutations at the 3′ end or one or more SNPs in the middle of the sequence. For example, in some embodiments, the method includes providing an intercalating dye or universal probe, and one or more blank oligonucleotides having the same sequence as the first probe but without the fluorescent label and including one or more SNP mutations at or near the 3' end.

[0030] In one aspect of the present invention, blank oligonucleotides can be provided at a concentration equimolar to the first probe. In some schemes, blank oligonucleotides of excessive concentration can be provided to the first probe. If blank oligonucleotides are provided in excess concentration without a second probe competing with the first probe, the reaction specificity can be further improved. The reaction specificity can be further improved by increasing the competition for the target binding site by excessive blank oligonucleotides, especially when there is a target sequence of blank oligonucleotides in the sample. For example, when there is a first probe complementary to the wild-type target sequence but without a competitive second probe and a blank oligonucleotide excessively complementary to the mutant sequence of the wild-type target sequence, when there is only a wild-type mutant sequence, the first probe is incorporated into the growing amplicon to produce a weak fluorescent signal or there is no fluorescent signal. In the same example, when there is only a wild-type sequence in the sample, the first fluorescent probe will generate a signal. When the sample is detected by real-time detection of LAMP assay, when an excessive amount of blank oligonucleotides and the first probe are used without a competitive second probe, the CT value difference between the sample including the wild-type sequence and the sample including the wild-type mutant sequence can be more obvious. In some embodiments, the method includes providing an insertion dye or universal probe and one or more blank oligonucleotides, wherein at least one blank oligonucleotide has the same sequence as the first probe but without a fluorescent label, and includes one or more SNPs in the middle of the sequence. In an alternative, the method includes providing an insertion dye or universal probe and one or more blank oligonucleotides without a fluorescent label, wherein at least one blank oligonucleotide has the same sequence as the wild-type sequence and the first probe includes the mutant sequence of the wild-type target sequence.

[0031] In some aspects of the invention, the method may be carried out in the presence of a buffer. Any suitable buffer may be used. In one embodiment, the buffer may be a Tris buffer, which is a buffer that can be used in a wide range of LAMP reactions and nucleic acid samples. In another embodiment, when one or more blank oligonucleotides include one or more SNPs in the middle of the sequence, the buffer may be a CHES CAPSO buffer. The use of a buffer in the method, particularly a CHES CAPSO buffer, enables probe design to be performed when a single or double point mutation is located in the middle of the probe sequence, which has advantages when the mutation cannot be designed at the 3′ end of the probe. Tris buffer is compatible with most LAMP assays, but CHES CAPSO buffer may provide higher specificity for problematic primers that are prone to primer dimers.

[0032] In some embodiments, where the method omits a blank oligonucleotide, the method may include providing an intercalating dye or a universal probe, wherein the first probe is specific for a wild-type DNA or RNA sequence having a single point mutation located at a position opposite the nucleotide at or near the 3' end of the probe.

[0033] Any suitable fluorescent label or fluorophore label can be used for the present invention.In some aspects, fluorescent label, fluorophore label and / or intercalating dye can comprise following one or more: TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO and V13, or any other dye suitable for nucleic acid detection.In one scheme, fluorescent label, fluorophore label or intercalating dye can be different, thus can make distinction in detection.For example, the first and second probes can comprise different labels, or the first probe and intercalating dye can comprise different labels.

[0034] In some aspects of the invention, the first probe is configured to serve as a loop-mediated isothermal amplification primer. In another aspect of the invention, the second probe is configured to serve as a loop-mediated isothermal amplification primer. In another aspect of the invention, one or more blank oligonucleotides are configured to serve as loop-mediated isothermal amplification primers. In a further aspect of the invention, the first and / or second probe is configured to serve as a loop-mediated isothermal amplification primer. In a further aspect of the invention, the first and / or second probe and / or one or more blank oligonucleotides are configured to serve as loop-mediated isothermal amplification primers. In some aspects of the invention, the loop-mediated isothermal amplification primer is a LF or LB circular primer.

[0035] In another aspect of the present invention, the first probe, the second probe and / or the target nucleic acid may be a DNA sequence or an RNA sequence. In a further aspect of the present invention, the first probe, the second probe, the blank oligonucleotide and / or the target nucleic acid may be a DNA sequence or an RNA sequence. Any suitable DNA sequence or RNA sequence may be used. In one aspect of the present invention, the first probe may be a DNA sequence or an RNA sequence. In a further aspect of the present invention, the second probe may be a DNA sequence or an RNA sequence. In another aspect of the present invention, the first probe may be a DNA sequence or an RNA sequence, and the second probe may be a DNA sequence or an RNA sequence. In some aspects of the present invention, each of the probe, primer and / or blank oligonucleotide used in the LAMP reaction may be a DNA sequence. In some other aspects of the present invention, all probes, primers and blank oligonucleotides used in the LAMP reaction may be DNA sequences.

[0036] Optionally, loop-mediated isothermal amplification can be performed with RB (tris) buffer.

[0037] In some embodiments, the first or second probe or blank oligonucleotide may include one or more of the following sequences:

[0038] SEQ ID NO: 1: 5′GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3′ (SARS-CoV-2 WT probe S gene, used to distinguish A23063T N501Y point mutation)

[0039] SEQ ID NO:2: 5′AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3′ (SARS-CoV-2WT probe S gene, used to distinguish E484K point mutation)

[0040] SEQ ID NO:3: 5′AAAGGAAAGTAACAATTAAAACCTTT 3′ (SARS-CoV-2 mutant blank oligonucleotide, used to distinguish the E484K point mutation).

[0041] In some aspects of the invention, the presence of target nucleic acid and / or mutant nucleic acid sequence can be detected by loop-mediated isothermal amplification (LAMP). This can be done with or without any post-amplification operation, preferably without any post-amplification operation. This method without post-amplification operation is particularly advantageous because it reduces the complexity of the method and allows faster detection of SNPs in samples.

[0042] In some embodiments, the methods of the invention are capable of detecting SNPs wherein the target nucleic acid is from a virus, such as SARS-CoV-2 or a variant thereof.

[0043] Any suitable primer set can be used in the LAMP method. Suitable primer sets include at least FIP, BIP, F3 and B3 primers, and may optionally include ring F and / or ring B primers. In some embodiments, ring F and / or ring B primers can be used to increase the speed and / or sensitivity of the LAMP reaction. In some embodiments, for example, in the case where it is impossible to design a primer set including ring F and / or ring B primers, and / or reduce the chance of false amplification, only FIP, BIP, F3 and B3 primers can be used.

[0044] In some aspects of the invention, the LAMP reaction can be carried out in any suitable container. In further aspects of the invention, the detection of the amplified nucleic acid sequence can be carried out in any suitable container. In yet further aspects of the invention, the LAMP reaction and the detection of the amplified nucleic acid sequence can be carried out in the same reaction vessel. If the LAMP reaction and the detection of the amplified nucleic acid sequence are carried out in the same reaction vessel, the reaction can be analyzed in real time by the equipment necessary for carrying out the method.

[0045] In an alternative aspect of the present invention, a kit for detecting nucleotide polymorphisms in a target nucleic acid sequence in a sample is provided. The kit comprises: a) a first oligonucleotide probe complementary to a wild-type target sequence, wherein the first oligonucleotide probe comprises a fluorescent label bound to an internal cytosine base, and wherein the oligonucleotide probe sequence does not have a 3′ terminator; and b) a loop-mediated isothermal amplification reagent buffer, an enzyme, dNTPs, and a loop-mediated isothermal amplification primer; wherein the first probe is configured for use in a single reaction vessel.

[0046] In some aspects of the invention, the kit may further include an intercalating dye or a second oligonucleotide probe, wherein the second oligonucleotide probe is selected from a probe complementary to a mutant sequence of a wild-type target sequence, or a universal probe capable of detecting both wild-type and mutant target sequences; wherein the second oligonucleotide probe and / or the intercalating dye include additional fluorescent labels that can be distinguished from the first probe; and the first probe, the second probe, and / or the intercalating dye are configured to be used in a single reaction vessel. In some aspects, the kit may further include one or more blank oligonucleotides. The kit may also include one or all of a loop-mediated isothermal amplification reagent buffer, an enzyme, a deoxyribonucleoside 5′-triphosphate (dNTP), and a loop-mediated isothermal amplification primer. Optionally, the kit may include RB (tris) buffer.

[0047] In an alternative to the kit, a) a first oligonucleotide probe complementary to a wild-type mutant sequence is provided, wherein the first oligonucleotide probe includes a fluorescent label that binds to an internal cytosine base, and wherein the oligonucleotide probe sequence does not have a 3' end terminator; and b) loop-mediated isothermal amplification reagent buffer, enzyme, dNTP and loop-mediated isothermal amplification primer; wherein the first probe is configured to be used in a single reaction vessel. The kit may also include an intercalating dye or a second oligonucleotide probe, wherein the second oligonucleotide probe is selected from a probe complementary to the wild-type sequence, or a universal probe capable of detecting both wild-type and mutant target sequences; wherein the second oligonucleotide probe and / or the intercalating dye include an additional fluorescent label that can be distinguished from the first probe; and the first probe, the second probe and / or the intercalating dye are configured to be used in a single reaction vessel. In some aspects, the kit may also include one or more blank oligonucleotides. The one or more blank oligonucleotides may be complementary to the wild-type sequence.

[0048] Optionally, the kit may include additional labeled probes. For example, the kit may provide 2 or at least 2 labeled probes, 3 or at least 3 labeled probes, 4 or at least 4 labeled probes, 5 or at least 5 labeled probes, 6 or at least 6 labeled probes, or 10 or at least 10 labeled probes. In another embodiment, the kit may provide 2-10 labeled probes, 2-9 labeled probes, 2-8 labeled probes, 3-7 labeled probes, or 3-6 labeled probes. In one embodiment, any suitable number of labeled probes may be used. These probes may be used to detect additional SNPs or wild-type sequences.

[0049] In some aspects of the invention, the kit may include at least one probe comprising a mutation. For example, at least one probe may include a single or double point mutation, optionally at or near the 3' end.

[0050] In some further aspects of the invention, the kit may include a second probe that is complementary to a mutant sequence of a wild-type target sequence. In one embodiment, the second probe may also include a fluorophore label. This label may bind to an internal cytosine base, and optionally, the second probe does not have a 3' terminator. In a further embodiment, at least one of the first and / or second probes includes a single or double point mutation at or near the 3' end. In another embodiment, the kit may include a second probe that is complementary to a wild-type target sequence. This embodiment is suitable when the first probe is complementary to a mutant sequence of a wild-type target sequence.

[0051] In some aspects of the invention, the kit may include a second probe complementary to a mutant sequence of a wild-type target sequence. In one embodiment, the second probe may include a fluorophore label that binds to an internal cytosine base and does not have a 3' terminator. Optionally, at least one of the first and second probes may contain a single or double point mutation at or near the 3' end.

[0052] In a further aspect of the invention, the kit provides a second probe, which can be selected from a probe complementary to the mutant sequence of the wild-type target sequence, or a universal probe capable of detecting both the wild-type target sequence and the mutant sequence of the wild-type target sequence. In one aspect, the second probe can be selected from a probe complementary to the mutant sequence of the wild-type target sequence. In an alternative aspect, the second probe can be selected from a universal probe capable of detecting both the wild-type target sequence and the mutant sequence of the wild-type target sequence.

[0053] When the kit provides an intercalating dye or a universal probe, the kit may further provide one or more so-called "blank oligonucleotides" available. Any suitable blank oligonucleotide may be used. The blank oligonucleotide is not labeled with a fluorophore. Optionally, the blank oligonucleotide may include the same sequence as the first probe, and may include one or more SNP mutations at or near the 3' end or in the middle of the sequence. In one embodiment, the SNP at the 3' end is included in the SNP of the terminal nucleotide base at the 3' end of the nucleic acid sequence, and the SNP close to the 3' end is included in the SNP of the second nucleotide base at the 3' end. When more than one blank oligonucleotide is used, one or more blank oligonucleotides may be the same or different. In other embodiments, the blank oligonucleotide may include a wild-type sequence, and the first probe may include a mutant sequence of a wild-type comprising one or more SNP mutations at or near the 3' end or in the middle of the sequence.

[0054] Alternatively, or in addition, when the kit includes an intercalating dye or universal probe, and one or more blank oligonucleotides, the one or more blank oligonucleotides may have the same sequence as the first probe, but without a fluorophore label. In a further embodiment, the one or more blank oligonucleotides may be wrapped in or near one or more SNP mutations at the 3′ end or one or more SNPs in the middle of the sequence. In another embodiment, if the mutant sequence includes several different point mutations close to each other that cannot be covered by 1 or 2 fluorescent probes, multiple different blank oligonucleotides may be used in the same reaction.

[0055] In some aspects of the present invention, the kit may include a buffer. Any suitable buffer may be used. In one embodiment, the buffer may be RB (tris) buffer, which is a buffer that can be used in a wide range of LAMP reactions and nucleic acid samples. In another embodiment, when one or more blank oligonucleotides include one or more SNPs in the middle of the sequence, the buffer may be CHESCAPSO buffer. Using a buffer in the method, particularly a CHES CAPSO buffer, enables probe design to be performed when a single or double point mutation is located in the middle of the probe sequence, which has advantages when the mutation cannot be designed at the 3′ end of the probe. In some embodiments, the second probe may be selected from a universal probe, and the kit provides an intercalating dye or a universal probe. In some embodiments, the first probe may include one or more SNPs in the middle of the sequence, one or more blank oligonucleotides are complementary to the wild-type target sequence, and the buffer may be a CHES CAPSO buffer.

[0056] In some embodiments, the blank oligonucleotide is omitted from the kit and the first probe is specific for a wild-type DNA or RNA sequence having a single point mutation relative to the nucleotide at or near the 3' end of the probe.

[0057] Any suitable fluorescent label or fluorophore label can be used together with the probe in the test kit. Fluorescent label, fluorophore label or intercalating dye can comprise following one or more: TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO and V13, or any other dye suitable for nucleic acid detection. In one embodiment, fluorescent label, fluorophore label or intercalating dye can be different. For example, the first and second probes can comprise different labels, or the first probe and intercalating dye can comprise different labels.

[0058] In some aspects of the invention, a kit can be provided, wherein the first probe can be configured to serve as a loop-mediated isothermal amplification primer. In other aspects of the invention, the second probe is configured to serve as a loop-mediated isothermal amplification primer. In other aspects of the invention, a blank oligonucleotide is configured to serve as a loop-mediated isothermal amplification primer. In further aspects of the invention, the first and / or second probes are configured to serve as loop-mediated isothermal amplification primers. In further aspects of the invention, the first probe, the second probe and / or the blank oligonucleotide are configured to serve as loop-mediated isothermal amplification primers. In some aspects of the invention, the isothermal amplification primer is a LF or LB loop primer.

[0059] Additionally or alternatively, the first probe, the second probe and / or the target nucleic acid can be a DNA sequence or an RNA sequence. Additionally or alternatively, the first probe, the second probe, the blank oligonucleotide and / or the target nucleic acid can be a DNA sequence or an RNA sequence. Any suitable DNA sequence or RNA sequence can be used. In one aspect of the present invention, the first probe can be a DNA sequence or an RNA sequence. In a further aspect of the present invention, the second probe can be a DNA sequence or an RNA sequence. In another aspect of the present invention, the first probe can be a DNA sequence or an RNA sequence and the second probe or the blank oligonucleotide can be a DNA sequence or an RNA sequence. In some aspects of the present invention, each in the probe, the primer and / or the blank oligonucleotide can be a DNA sequence. In some other aspects of the present invention, all probes, primers and the blank oligonucleotide can be DNA sequences.

[0060] In a preferred embodiment, the first or second probe or blank oligonucleotide comprises one or more of the following sequences:

[0061] SEQ ID NO: 1: 5′GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3′ (SARS-CoV-2 WT probe S gene, used to distinguish A23063T N501Y point mutation);

[0062] SEQ ID NO: 2: 5′AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3′ (SARS-CoV-2 WT probe S gene, used to distinguish the E484K point mutation); and

[0063] SEQ ID NO:3: 5′AAAGGAAAGTAACAATTAAAACCTTT 3′ (SARS-CoV-2 mutant blank oligonucleotide, used to distinguish the E484K point mutation).

[0064] The test kit can be configured to detect the presence of target nucleic acid and / or mutant nucleic acid sequence, which can be detected by loop-mediated isothermal amplification (LAMP). In some aspects of the invention, the test kit can be configured to allow the presence of target wild-type and / or mutant nucleic acid sequence to be detected during LAMP without any amplification post-operation. Preferably, the test kit can be applicable to detecting such nucleic acid sequence without any amplification post-operation.

[0065] In some embodiments, the kit can be suitable for detecting a target nucleic acid from a virus, such as the virus SARS-CoV-2 or a variant thereof.

[0066] The kit can be configured to be used for the LAMP method, wherein any suitable primer set can be used for LAMP. Suitable primer sets include at least FIP, BIP, F3 and B3 primers, and may optionally include loop F and / or loop B primers. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1a -1b is an amplification curve of the LAMP assay according to Example 1, including two fluorescent probes.

[0068] Figure 2a -2c is an amplification curve of the LAMP assay according to Example 2, including a single fluorescent probe and an intercalating dye.

[0069] Figure 3a -3d is an amplification curve of the LAMP assay according to Example 2a, including a single fluorescent probe, a blank oligonucleotide and an intercalating dye, wherein the SNP on the blank oligonucleotide is located at the 3′ end.

[0070] Figure 4a -4d is an amplification curve of the LAMP assay according to Example 2b, including a single fluorescent probe, a blank oligonucleotide and an intercalating dye, wherein the SNP on the blank oligonucleotide is at the second nucleotide from the 3′ end.

[0071] Figure 5a-5d is an amplification curve of the LAMP assay according to Example 2c, including a single fluorescent probe, a blank oligonucleotide and an intercalating dye, wherein the blank oligonucleotide includes double point mutations at the 3′ end and the second nucleotide from the 3′ end.

[0072] Figure 6a -6c is an amplification curve of the LAMP assay according to Example 2d, which is Figure 3a – 3d, Figure 4a Control experiments for experiments 4d and 5a–5d were performed in the absence of blank oligonucleotide.

[0073] Figure 7a -7d is an amplification curve of the LAMP assay according to Example 3a, including a single fluorescent probe, a blank oligonucleotide and an intercalating dye, wherein the SNP on the blank oligonucleotide is located in the middle of the blank oligonucleotide sequence, and is performed under RB (tris) buffer conditions.

[0074] Figure 8a -8d is an amplification curve of the LAMP assay according to Example 3b, including a single fluorescent probe, a blank oligonucleotide and an intercalating dye, wherein the SNP on the blank oligonucleotide is located in the middle of the blank oligonucleotide sequence, and is performed under RB (Tris) buffer conditions.

[0075] Figure 9a -9d is an amplification curve of the LAMP assay according to Example 3c, including a single fluorescent probe, a blank oligonucleotide and an intercalating dye, wherein the SNP on the blank oligonucleotide is located in the middle of the blank oligonucleotide sequence, and is performed under CHESCAPSO buffer conditions.

[0076] Fig.10a -10d is an amplification curve of a LAMP assay according to Example 3d, comprising a single fluorescent probe, a blank oligonucleotide and an intercalating dye, wherein the SNP on the blank oligonucleotide is located in the middle of the blank oligonucleotide sequence, and is performed under CHESCAPSO buffer conditions.

[0077] Fig.11a –11d is the amplification curve of the LAMP assay or SARS-CoV-2 RNA according to Example 4, including the fluorescent wild-type probe and the universal control probe. DETAILED DESCRIPTION

[0078] According to one aspect of the present invention, a method and a kit are provided, which are configured to detect SNP using two fluorescently labeled oligonucleotide probes in the same LAMP reaction. The first probe is an oligonucleotide comprising a fluorophore label that binds to an internal cytosine base, and it does not have a 3' terminator at the end. The first probe is complementary to the wild-type target sequence. The second probe is an oligonucleotide sequence comprising a fluorophore label that is distinguishable from the fluorescent label of the first probe, binds to an internal cytosine base, and it does not have a 3' terminator at the end. The second probe is complementary to the mutant sequence of the wild-type sequence, and contains a single or double point mutation at or near the 3' end of the oligonucleotide sequence. In some embodiments, at or near the 3' end, the terminal nucleotide base at the 3' end and the second nucleotide base at the 3' end are included.

[0079] The target nucleic acid sequence in the sample is amplified using LAMP to provide an amplified nucleic acid and an oligonucleotide first probe in a reaction container, and the amplified nucleic acid sequence is detected. In the presence of both the first and second probes, the target nucleic acid sequence is amplified using the LAMP reaction. In some embodiments, the LAMP reaction is a single container reaction. The two probes compete for binding sites on the amplified nucleic acid sequence. Therefore, by detecting the fluorescence of the fluorescent label of the first probe, an amplified nucleic acid sequence including a wild-type sequence complementary to the first probe can be detected, and by detecting the fluorescence of the fluorescent label of the second probe, an amplified nucleic acid sequence including a mutant sequence complementary to the second probe can be detected. Therefore, the presence of target wild-type and / or mutant nucleic acid sequences can be detected with their fluorescence, and can be distinguished based on their fluorescent labels.

[0080] According to a further aspect of the present invention, a method for detecting SNP using a fluorescently labeled oligonucleotide probe and a blank oligonucleotide in the same LAMP reaction is provided. The fluorescently labeled oligonucleotide probe is an oligonucleotide probe complementary to the WT target sequence (WT fluorescent probe). The blank oligonucleotide is an oligonucleotide sequence having the same sequence as the WT fluorescent probe, but it is not labeled with a fluorophore and contains one or more SNP mutations (i.e., single or double point mutations) at or near the 3' end of the oligonucleotide sequence. In some embodiments, at or near the 3' end, include a terminal nucleotide base at the 3' end and a second nucleotide base at the 3' end.

[0081] In the presence of a first probe and a blank oligonucleotide, a target nucleic acid sequence in a sample is amplified using a LAMP reaction to provide an amplified nucleic acid in a reaction vessel, wherein the amplified nucleic acid sequence is detected. One or more fluorescent signals are used to detect the presence of the amplified WT sequence, and, if an intercalating dye or universal probe is present, the presence of the WT or SNP sequence can be distinguished.

[0082] According to a further aspect of the present invention, a method for detecting SNP using a fluorescently labeled oligonucleotide probe and a blank oligonucleotide in the same LAMP reaction is provided. The fluorescently labeled oligonucleotide probe is an oligonucleotide probe having the same sequence as the WT target sequence, but it contains one or more SNP mutations (i.e., single or double point mutations) at or near the 3' end of the oligonucleotide sequence. In some embodiments, the mutation at or near the 3' end of the oligonucleotide sequence may include a SNP at the terminal nucleotide base at the 3' end, and / or a SNP at the second nucleotide base at the 3' end. A blank oligonucleotide is an oligonucleotide sequence having the same sequence as the target WT sequence, but is not labeled with a fluorophore.

[0083] According to a further aspect of the present invention, a method for detecting SNP using a fluorescently labeled oligonucleotide probe and a blank oligonucleotide in the same LAMP reaction is provided, wherein the SNP is substantially located in the middle portion of the blank oligonucleotide. The fluorescently labeled oligonucleotide probe is an oligonucleotide probe comprising a fluorophore labeled with an internal cytosine base, and it does not have a 3' terminator. The first probe is complementary to the WT target sequence. The blank oligonucleotide is an oligonucleotide having the same sequence as the WT fluorescent probe, but is not labeled with a fluorophore and contains one or more SNP mutations (i.e., single or double point mutations) in the middle of the blank oligonucleotide sequence. In some embodiments, the middle of the sequence includes any nucleotide between the 3' end to the 5' end second nucleotide of the sequence.

[0084] According to a further aspect of the present invention, a method for detecting SNP using a fluorescently labeled oligonucleotide probe and a blank oligonucleotide in the same LAMP reaction is provided, wherein the SNP is substantially located in the middle portion of the fluorescently labeled probe. The fluorescently labeled oligonucleotide probe is an oligonucleotide probe comprising a fluorophore labeled oligonucleotide that is bound to an internal cytosine base, and it does not have a 3' terminator. The blank oligonucleotide is complementary to the WT target sequence and is not labeled with a fluorophore. The fluorescently labeled probe has the same sequence as the blank oligonucleotide, but it contains one or more SNP mutations (i.e., single or double point mutations) in the middle of the oligonucleotide probe sequence. In some embodiments, the mutation in the middle of the oligonucleotide probe sequence may include one or more SNPs in any nucleotide between the 3' end and the second nucleotide at the 5' end of the sequence. The reaction may also include a fluorescent intercalating dye or a universal fluorescent probe, whose fluorescence can be distinguished from the first probe. The universal fluorescent probe targets a common nucleic acid sequence of WT and mutation (SNP) samples, but does not include nucleotides where SNP occurs. The fluorescent intercalating dye or universal probe can provide a detectable fluorescent control signal when present in the sample and corresponding to the WT and mutation target sequences. In some embodiments, universal probe can be designed to target a target gene different from the first probe, wherein the different target genes have a more conservative sequence than wild-type and mutant variants. In the scheme of some universal probe targeting different target genes, other primer sets can be used. In some schemes, there is no overlap between the sequence of the first probe and the universal probe.

[0085] In the presence of a first probe and a blank oligonucleotide, a target nucleic acid sequence in a sample is amplified using a LAMP reaction to provide an amplified nucleic acid in a reaction vessel, wherein the amplified nucleic acid sequence is detected. One or more fluorescent signals are used to detect the presence of the amplified WT sequence, and, if an intercalating dye or universal probe is present, the presence of the WT or SNP sequence can be distinguished.

[0086] According to a further aspect of the present invention, one or more blank oligonucleotides can be provided at a concentration equal to the first fluorescently labeled probe.In another scheme, the concentration of the one or more blank oligonucleotides exceeds the concentration of the first probe.In some embodiments, the concentration of the one or more blank oligonucleotides is provided as about 1.5 times or more, about 2 times or more, or about 4 times or more than the concentration of the first probe.In some embodiments, the concentration ratio of the one or more blank oligonucleotides is provided as about 1.25 to about 6 times, about 1.5 to about 5 times, about 1.75 to about 4.75 times, about 1.5 to about 4.5 times, about 1.75 to about 4.0 times, about 2 to about 3.75 times, about 2.25 to about 3.5 times, about 2.5 to about 3.25 times, or 2.75 to about 3 times, of the concentration ratio of the one or more blank oligonucleotides provided as the first probe.In some embodiments, the concentration of the one or more blank oligonucleotides is about 2 times or about 4 times higher than the concentration of the first probe.

[0087] In the LAMP reaction including the first probe and blank oligonucleotide and the absence of the second probe competing with the first probe, since the reaction specificity can be further improved, it is particularly preferred to provide blank oligonucleotide with an excessive concentration. Excessive blank oligonucleotide increases the proximity competition to the target binding site, and particularly when there is a target sequence of blank oligonucleotide in the sample, the reaction specificity can be further increased. For example, when there is a first probe complementary to the wild-type target sequence but without a competitive second probe and an excessively complementary blank oligonucleotide with a mutant sequence of the wild-type target sequence, when there is only a wild-type mutant sequence, the first probe is incorporated into the growing amplicon to produce a weak fluorescent signal or there is no fluorescent signal. In the same example, when there is only a wild-type sequence in the sample, the first fluorescent probe will produce a signal. When the sample is detected by real-time detection of LAMP assay, when using excessive blank oligonucleotide and the first probe in the absence of a competitive second probe, the CT value difference between the sample including only the wild-type sequence and the sample including only the mutant sequence of the wild-type can be more distinguished.

[0088] According to another embodiment of the present invention, a method for detecting SNP using fluorescently labeled oligonucleotide probes in a LAMP reaction is provided, wherein the method omits a blank oligonucleotide and the first probe is specific for a WT nucleic acid sequence having a single point mutation relative to the nucleotide at or near the 3′ end of the probe.

[0089] The fluorescently labeled oligonucleotide probe is an oligonucleotide probe that includes a fluorophore label bound to an internal cytosine base and does not have a 3' end terminator. The first probe is complementary to the WT target sequence.

[0090] The reaction may also include a fluorescent intercalating dye or a universal fluorescent probe whose fluorescence is distinguishable from the first probe. The fluorescent intercalating dye or universal probe can provide a detectable fluorescent control signal when both WT and mutant target sequences are present in the sample.

[0091] In the presence of the first probe, a target nucleic acid sequence in the sample is amplified using a LAMP reaction to provide an amplified nucleic acid in a reaction vessel, wherein the amplified nucleic acid sequence is detected. One or more fluorescent signals are used to detect the presence of the amplified WT sequence, and, if an intercalating dye or universal probe is present, the presence of the WT or SNP sequence can be distinguished.

[0092] This method is simplified and therefore easier and cheaper to perform because it does not require competing probes or blank oligonucleotides.

[0093] In some embodiments, the LAMP reaction and detection of the amplified nucleic acid sequence are performed in the same vessel.

[0094] In some embodiments, the step of providing an intercalating dye or a second probe is not included in the method of the present invention, wherein the second probe (selected from a probe complementary to a mutant sequence of a wild-type target sequence, or a universal probe capable of detecting both wild-type and mutant target sequences) is not included in the method of the present invention.

[0095] definition

[0096] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art in connection with the described methods and compositions.As used herein, the following terms and phrases have the meanings ascribed to them unless otherwise indicated.

[0097] The terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0098] Unless otherwise indicated, the term "nucleic acid" refers to a nucleotide polymer. Nucleic acids include RNA, DNA or chimeric DNA-RNA polymers or oligonucleotides, and their analogs.

[0099] As used herein, the term "nucleotide" refers to a nucleic acid subunit consisting of a phosphate group, a 5-carbon sugar, and a nitrogenous base. The 5-carbon sugar found in RNA is ribose. In DNA, the 5-carbon sugar is 2'-deoxyribose.

[0100] As used herein, the term "target sequence" refers to a specific nucleotide sequence of a target nucleic acid to be detected. A "target sequence" comprises a composite sequence with which an oligonucleotide complexes during the detection process. A target sequence may form a portion of a larger nucleic acid sequence.

[0101] The interchangeable terms "oligomer," "oligonucleotide," and "oligonucleotide" refer to nucleic acids typically having less than 1,000 nucleotide residues, including nucleic acids ranging from about 5, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 and / or 60 nucleotide residues and from about 200 or 500 to about 900 residues.

[0102] The term "probe" refers to a nucleic acid oligonucleotide that can specifically hybridize to a target sequence in a nucleic acid or an amplified nucleic acid under conditions that promote hybridization to allow detection of the target sequence or the amplified nucleic acid.

[0103] The term "blank oligonucleotide" refers to a nucleic acid oligonucleotide that can specifically hybridize to a target sequence in a nucleic acid or amplified nucleic acid under conditions that promote hybridization but do not allow detection of the target sequence or amplified nucleic acid.

[0104] The terms "label" and "fluorescent label," "fluorophore" and "fluorophore label" interchangeably refer to a moiety or compound that is detected or results in a detectable signal.

[0105] The term "amplification" refers to any known procedure for obtaining multiple copies of a target nucleic acid sequence or its complementary sequence or a fragment thereof. The multiple copies may be referred to as amplicons or amplification products.

[0106] The term "amplicon" is used interchangeably with "amplification product" and refers to a nucleic acid molecule produced during the amplification process that is complementary or homologous to a sequence contained within the target sequence. These terms can be used to refer to a single-stranded amplification product, a double-stranded amplification product, or one strand of a double-stranded amplification product.

[0107] The interchangeable terms "single nucleotide polymorphism", "SNP" and "point mutation" refer to a nucleotide substitution at a single position in a nucleic acid sequence. As used herein, it may refer to one or more single nucleotide polymorphisms, and / or double point polymorphisms or triple point polymorphisms.

[0108] The term "wild type" or "WT" as used herein refers to a starting nucleic acid sequence. It is not limited to naturally occurring sequences, and may refer to any starting nucleic acid sequence derived from any source, including animals, plants, microorganisms, fungi, viruses and / or artificial starting strains.

[0109] As used herein, the term "probing" refers to detecting a nucleic acid sequence using a probe.

[0110] Furthermore, it should be understood that in the figures, 1 cycle corresponds to one minute. The term "Rn" corresponds to the normalized reported value. The term "ΔRn" corresponds to the Rn signal value minus the baseline Rn signal generated by the instrument.

[0111] Fluorescent probes

[0112] The probes used in the methods and kits of the present invention include an oligonucleotide probe sequence complementary to a region of a target nucleic acid sequence, wherein the oligonucleotide probe sequence has only one fluorophore ligand and the ligand binds to an internal cytosine base and wherein the oligonucleotide probe sequence does not have a 3' terminator.

[0113] In some embodiments, the probe sequence is a DNA sequence. In some embodiments, the target nucleic acid sequence is a DNA sequence. Fluorescence increases to indicate the presence of the target nucleic acid in the sample.

[0114] The cytosine bases are preferably arranged substantially along the center of the length of the oligonucleotide. Centered arrangement refers to between the 3' end and the third nucleotide at the 5' end. Internal labeling probes at cytosine bases have particular benefits. The probes are extended and incorporated into nucleic acids, such as DNA products, during isothermal amplification such as LAMP, which allows for melting curve analysis of the products produced. In the probe, a fluorophore is coupled to an internal cytosine complementary to guanine in the antisense strand. Guanine affects the excited state of many fluorophores, resulting in the formation of unique melting curve features and allowing for the differentiation of specific and nonspecific products produced under isothermal conditions.

[0115] The arrangement of a fluorophore ligand on an internal cytosine base of the probe sequence, which is excited when paired with a guanine base on the target sequence, has particular advantages because a complex two-part reaction setup including a fluorophore binding sequence and a complementary quencher binding sequence is not required. Such a setup requires laborious design schemes and optimizations, such as designing alternative complementary regions of the fluorophore labeling sequence and the quencher labeling sequence. In the present disclosure, fluorescence will increase as the amplicon grows because the fluorophore is arranged on the probe, which becomes incorporated into the exponentially growing amplicon.

[0116] The oligonucleotide probe does not contain a ddNTP at its 3' end. This allows the labeled oligonucleotide to be incorporated into the amplicon. Therefore, the 3' end of the probe is not "blocked".

[0117] The fluorophore may include any one or more selected from the group consisting of FAM, JOE, TET, HEX, TAMRA, ROX, ALEXA, and ATTO, or any other suitable fluorophore.

[0118] Probes may include the following sequences:

[0119] 5′Xn C*Xm 3′

[0120] Wherein n>1, m>3, X is a nucleotide base; and * is a fluorophore. Preferably, the nucleotide base can be selected from A, T, C and G, preferably, n is greater than 1 to 20 or less, more preferably greater than 1 to 10 or less. Preferably, m is greater than 3 to 20 or less, more preferably greater than 3 to 10 or less. It is contemplated that all combinations of probe lengths covered by the possible number of nucleotides where n or m occupies the aforementioned ranges are disclosed. For example, n can be greater than 1 to 20 or less, greater than 2 to 19 or less, greater than 3 to 18 or less, greater than 4 to 17 or less, greater than 5 to 16 or less, greater than 6 to 15 or less, greater than 7 to 14 or less, greater than 8 to 13 or less, greater than 9 to 12 or less, greater than 10 to 11 or less, or any combination thereof, and can be combined with m, m is greater than 3 to 20 or less, greater than 4 to 19 or less, greater than 5 to 18 or less, greater than 6 to 17 or less, greater than 7 to 16 or less, greater than 8 to 15 or less, greater than 9 to 14 or less, greater than 10 to 13 or less, greater than 11 to 12 or less, or any combination thereof.

[0121] When the oligonucleotide probe is incorporated into the target nucleic acid sequence, fluorescence increases, which causes a conformational change in the amplicon-probe complex, resulting in a change in the excited state of the fluorophore.

[0122] The cytosine bound to the fluorophore ligand is not located at or near the 5' or 3' end. More preferably, it is not located in the first 3 bases of the 5' end or the 3' end. Preferably, the cytosine bound to the fluorophore is located at least 3 bases from the 3' end. Particularly preferably, the cytosine bound to the fluorophore is located at the middle base of the probe.

[0123] Target nucleic acid

[0124] The target nucleic acid can be a sequence obtained from a microorganism, fungus, yeast, virus, human, animal or plant or any part or variant thereof. The target nucleic acid of known LAMP is capable of synthesizing LAMP primers and appropriate specific probes. Therefore, the presence or absence of the microorganism, fungus, yeast, virus, human, animal or plant sequence in the sample can be determined.

[0125] An increase in fluorescence indicates the presence of the target nucleic acid in the sample.

[0126] Buffer

[0127] The reaction can be carried out using a buffer system such as 0.1M Tris pH 7-9 (e.g., RB or RB Tris buffer); 0.25M CHES / CAPSO (95 / 5) pH 7-9 and 0.01M Tris pH 7-9 with 0.1% Tween 20 (MELT). Other similar buffers, or TE buffer at about pH 8, can also be used.

[0128] Example 1

[0129] method

[0130] The detection of wild-type (WT) and mutant (SNP) sequences in a single reaction tube using two fluorescent probes was performed as follows. The first probe was complementary to the WT sequence, while the second probe was directed against the mutant sequence containing the SNP (SNP end sequence). The probes were labeled with different fluorophores: the WT probe was labeled with TAMRA (WT-TAMRA) and the second probe was labeled with Cy5 (SNP end Cy5). The probes were designed based on one of the LAMP loop primer sequences (LF or LB), and the point mutation was located at the 3′ end of one of the probes. The reaction was performed using standard RB (0.1M Tris buffer, pH 8) buffer.

[0131] Assay setup

[0132] The experiment used artificial DNA sequences (gBlock TM WT) and previously validated IC (internal control) LAMP primer sets (DNA sequences are listed below). TM (IDT) ordered an artificial DNA sequence with a single point mutation located at the 3′ end of the LB primer (gBlock TM ). An IC primer mix without a loop primer was prepared (Table 1). The assay was set up using standard LAMP duplex particles containing 16 units of BST DNA polymerase, dNTPs and buffer per reaction.

[0133] Measurement process

[0134] The reaction premix was prepared by reconstituting 10× LAMP duplex pellet in 20 μl 5× buffer (0.5 M Tris, pH 8); 38 μl primer probe mix and 32 μl H2O.

[0135] Each reaction used 9 μl of master mix and 1 μl of WT or SNP-end DNA (1 pg / μl). For NTC (no template control) reactions, the reaction mixture was topped up with 1 μl of molecular grade water. WT and SNP-end DNA samples were tested in duplicate in separate reactions or in the same tube using an ABI7500 instrument at a constant temperature of 63°C for 60 minutes.

[0136] Table 1: Preparation of primer mix for SNP studies

[0137]

[0138]

[0139] Table 2: Preparation of primer-probe mix duplex particles for LAMP SNP studies using competing WT and SNP-terminated fluorescent probes labeled with different fluorophores.

[0140] Components (10 reactions) Volume for 10 reactions (1 particle) [μl] IC Primer Mix 0.356 IC-TAMRA probe (1 μM) (WT-TAMRA probe) 12.6 IC SNP2-CY5 probe (1μM) 25.2

[0141] The LAMP master mix used for the assay was:

[0142] 1 doublet pellet (enough for 10 reactions)

[0143] ·38μl primer + probe

[0144] 20 μl of 5×RB buffer (0.5 M Tris, pH 8)

[0145] 32 μl of HO

[0146] result

[0147] Using WT-TAMRA and SNP-Cy5 probes in the same reaction enables differentiation of WT and SNP sequences that differ by a single nucleotide. When experiments are performed in the same vessel, using their corresponding WT or SNP end probes (multiplex), WT and SNP end sequences can be differentiated.

[0148] Figure 1a It is an amplification curve showing the fluorescence change in the Cy5 channel in the LAMP reaction, each LAMP reaction includes a DNA sample, which is a SNP-end sequence (SNP-end) complementary to the SNP-end probe, a WT sample (which differs from the SNP-end sample by a single nucleotide) and is complementary to the WT probe, a sample including both WT and SNP-end sequences, or an NTC reaction.

[0149] like Figure 1a As shown, when DNA including the SNP end sequence is present in the sample, a significant increase in fluorescence is detected during the LAMP reaction. In contrast, when only the WT sequence is present, no significant increase in fluorescence is observed. Therefore, the DNA sequence including the SNP can be distinguished from the WT DNA sequence.

[0150] Figure 1b Fluorescence changes in the TAMRA channel in LAMP reactions are shown, with each reaction including a DNA sample that was a wild-type sequence (WT) complementary to a WT probe, a SNP-end sequence complementary to a SNP probe (differing from the wild-type sequence by a single nucleotide), a sample that included both WT and SNP-end sequences, or an NTC reaction.

[0151] like Figure 1bAs shown, when there is a DNA sample including a WT sequence in the sample, fluorescence is significantly enhanced during the LAMP reaction. On the contrary, when only the SNP end sequence is present, no significant enhancement of fluorescence is observed. Therefore, the DNA sequence including the SNP can be distinguished from the WT DNA sequence. Table 3 shows the amplification time or CT value (cycle threshold), which is defined as the number of cycles required for the fluorescence signal to exceed the threshold value (i.e., exceed the background level) for each experiment performed.

[0152] Table 3: Amplification times (CT values) generated using WT-TAMRA and SNP-Cy5 probes in the presence of WT and SNP-DNA.

[0153] Tube Sample / gBlock DNA WT-TAMRA probe CT value CT value of CY5 probe at SNP end 1 WT 15.98 - 2 WT 16.58 - 3 SNP end - 16.61 4 SNP end - 16.73 5 WT+SNP end 17 17.13 6 WT+SNP end 17.54 17.92 7 NTC - - 8 NTC - -

[0154] sequence:

[0155] - Location of the fluorophore

[0156] ——3′ end

[0157] SEQ ID NO:4: WT sequence:

[0158]

[0159] SEQ ID NO:5: WT probe marker:

[0160]

[0161] SEQ ID NO:44: TAMRA-labeled WT probe:

[0162]

[0163] SEQ ID NO:6: SNP end (end A to C) sequence:

[0164]

[0165] SEQ ID NO:7: SNP end (A to C) probe labeling:

[0166]

[0167] SEQ ID NO:45: Cy5-labeled SNP end (A to C) probe:

[0168]

[0169] Wild-type IC LAMP primers:

[0170]

[0171] Example 2

[0172] method

[0173] The method of distinguishing WT and SNP sequences using the first fluorescent probe and a blank oligonucleotide in a single reaction tube was performed as follows:

[0174] The probes used are as described in Example 1. Three different types of experiments (experiments 2a, 2b and 2c) were performed. Each experiment used a probe complementary to the WT DNA sequence labeled with a fluorophore (WT-TAMRA), and an intercalating dye (SybrGreen) for detecting WT and SNP sequences. The WT-TAMRA probe only produces a fluorescent signal when the WT sequence is present in the sample, and the intercalating dye (SybrGreen) is used as a control for detecting WT and SNP sequences. The WT probe is designed based on the sequence of one of the loops (LF or LB), and the position of the point mutation is relative to the following positions:

[0175] a) 3′ end of the probe (experiment 2a)— SNP end (A to C) probe

[0176] b) The second base at the 3′ end of the probe (Experiment 2b) - BO S1T Probe (G to T)

[0177] c) For double mutations: one at the 3′ end of the probe and the other at the second base from the 3′ end of the probe (experiment 2c) - BO S1 SNP2C Blank Oligonucleotide

[0178] A DNA blank oligonucleotide is also present in the reaction. The blank oligonucleotide has the same sequence as the fluorescent probe, but is not labeled with a fluorophore and includes one or more SNP mutations. During the LAMP reaction, the blank oligonucleotide competes with the fluorescent probe for binding sites on the amplified nucleic acid, which increases the specificity of the detection.

[0179] Assay setup:

[0180] The LAMP primer mix was prepared as described in Example 1, as described in Tables 1 and 2, and diluted 1: 10. The composition of the LAMP premix was as follows:

[0181] 1 doublet pellet (enough for 10 reactions)

[0182] 20 μl 5× RB Tris buffer

[0183] 12.6 μl of WT-TAMRA probe (1 μM)

[0184] 12.6 μl of blank oligonucleotide (1 μM)

[0185] oSNP-end (A to C) blank oligonucleotide;

[0186] οBO S1 T (G to T) blank oligonucleotide; or

[0187] οBO S1 SNP2 C blank oligonucleotide;

[0188] 3.56 μl IC primer mix (1:10);

[0189] 1 μl SybrGreen (1:200);

[0190] 40.24 μl of H2O.

[0191] Determination process:

[0192] The test samples for each experiment were prepared by adding 1 μl of template DNA (WT, SNP end, S1T or SNP2C) to 9 μl LAMP master mix at 1 pg / μl. Each reaction was performed three times at 63°C for 60 minutes using an ABI7500 instrument. TAMRA and SybrGreen signals were detected in a single tube reaction.

[0193] result

[0194] Control - No Blank Oligonucleotide

[0195] Figures 2a to 2c Amplification curves of the LAMP assay including WT fluorescent probe (WT-TAMRA), SybrGreen intercalating dye, and WT sample ( Figure 2a ), or NTC (no template control) reaction ( Figure 2b ). The reactions did not include blank oligonucleotide or mutant DNA. Figures 2a to 2c It means that both the WT probe and SybrGreen show an increase in fluorescence signal as the amplification reaction proceeds in the presence of the WT DNA sample, but do not show any signal increase in the absence of the sample. Figure 2a The output of the SybrGreen and TAMRA channels for the positive control sample (WT DNA) is shown in the same figure. Figure 2c Output of the TAMRA channel for positive control and NTC only is shown.

[0196] Table 4: Results of control assay using WT-TAMRA; no blank oligonucleotide.

[0197] WT DNA <![CDATA[Template-free control (H2O)]]> WT-TAMRA Checkout Not detected SybrGreen control Checkout Not detected

[0198] Experiment 2a == SNP end (A to C) blank oligonucleotide

[0199] Figures 3a to 3d 1 shows a LAMP experiment performed according to the method of the present invention in the presence of a fluorescent WT probe, an intercalating dye and a SNP-terminated blank oligonucleotide (with a SNP at the 3′ end) as described above. Figure 3a As shown, in the presence of samples including the WT sequence, both the probe and the intercalating dye show increased signal as the LAMP reaction proceeds because both fluorescent components are able to bind to the amplified DNA.

[0200] However, if Figure 3b As shown, in the presence of samples comprising only the SNP-end sequence (which differs from the WT sequence by a single nucleotide), only the intercalating dye shows any significant increase in signal. Thus, the combination of probe and blank oligonucleotide is able to distinguish and detect WT and SNP-containing sequences. Figure 3c is a no template control (NTC) experiment, which shows no significant increase in fluorescence when no sample is present. Figure 3d Comparison of the output signal in the TAMRA channel in the presence of WT and SNP-containing sequences is shown.

[0201] Table 5: shows the results of Experiment 2a using the WT-TAMRA probe and SNP-end (A to C) blank oligonucleotides.

[0202] IC WT DNA IC SNP end (A to C) DNA <![CDATA[Template-free control (H2O)]]> WT-TAMRA Checkout Not detected Not detected SybrGreen control Checkout Checkout Not detected

[0203] Experiment 2b ==S1T (G to T) blank oligonucleotide

[0204] Figures 4a to 4d Shown is a LAMP experiment performed according to the method of the present invention in the presence of a fluorescent WT probe, an intercalating dye and a S1T (G to T) blank oligonucleotide (which has a SNP at the second nucleotide from the 3′ end) as described above. Figure 4a As shown, when the WT sequence is present in the sample, both the probe and the intercalating dye show an increase in signal as the LAMP reaction proceeds because both fluorescent components are able to bind to the amplified DNA.

[0205] However, if Figure 4b As shown, in the presence of a sample comprising only the S1T (G to T) sequence (which differs from the WT sequence by a single nucleotide), only the intercalating dye shows any significant increase in signal. Thus, the combination of the probe and blank oligonucleotide is able to distinguish and detect WT and SNP-containing sequences, regardless of whether the SNP is at the 3′ nucleotide or the second nucleotide from the 3′ end. Figure 4c is a no template control (NTC) experiment, which shows no significant increase in fluorescence when no sample is present. Figure 4d Comparison of the output signal in the TAMRA channel in the presence of WT and SNP-containing sequences is shown.

[0206] Table 6: Shows the results of Experiment 2b using the WT-TAMRA probe and the S1 T (G to T) blank oligonucleotide.

[0207]

[0208]

[0209] Experiment 2C == S1 SNP2 C blank oligonucleotide

[0210] Figures 5a to 5d A LAMP experiment according to the method of the present invention is shown in the presence of a fluorescent WT probe, an intercalating dye and a S1 SNP2 blank oligonucleotide (which includes a double point mutation at the first and second nucleotides at the 3' end) as described above. Figure 5a As shown, when the WT sequence is present in the sample, both the probe and the intercalating dye show an increase in signal as the LAMP reaction proceeds because both fluorescent components are able to bind to the amplified DNA.

[0211] However, if Figure 5b As shown, in the presence of a sample comprising only the S1 SNP2 C sequence (which differs from the WT sequence by two consecutive nucleotides), only the intercalating dye shows any significant increase in signal. Thus, the combination of the probe and blank oligonucleotide is able to distinguish and detect WT and SNP-containing sequences, regardless of whether the mutation comprises one or two nucleotides in the sequence. Figure 5c is a no template control (NTC) experiment, which shows no significant increase in fluorescence when no sample is present. Figure 5d Comparison of the output signal in the TAMRA channel in the presence of WT and SNP-containing sequences is shown.

[0212] Table 7: Shows the results of Experiment 2 using the WT-TAMRA probe and the S1 SNP2 C blank oligonucleotide.

[0213] IC WT DNA S1 SNP2 C DNA <![CDATA[Template-free control (H2O)]]> WT-TAMRA Checkout Not detected Not detected SybrGreen control Checkout Checkout Not detected

[0214] Control == No blank oligonucleotide

[0215] Example 2d

[0216] Artificial DNA sequences (SNP-end DNA, S1 T DNA, and S1 SNP2 C DNA) without blank oligonucleotides were used ( Figure 6a 6C) Repeat experiments 2a–2c. These experiments revealed that not adding a blank oligonucleotide to the reaction had a negative impact on the specificity of the reaction. For example, Figures 6a to 6cshowed that the fluorescent WT probe was able to detect the SNP sequence in the absence of a blank oligonucleotide. This is in contrast to the results obtained from experiments 2a–2c. In experiments 2a–2c, where a blank oligonucleotide was part of the assay, the fluorescent WT probe produced an increase in signal only in the presence of WT DNA and not the SNP-containing variant. These results suggest that incorporating one or more blank oligonucleotides into the reaction allows for specific detection of point mutations using fluorescent probe technology.

[0217] sequence:

[0218] - Position of the fluorophore

[0219] -—SNP mutation at or near the 3′ end

[0220] SEQ ID NO:14: WT sequence:

[0221]

[0222] SEQ ID NO: 15: WT probe:

[0223]

[0224] Experiment 1

[0225] SEQ ID NO: 16: SNP end (A to C) sequence:

[0226]

[0227] SEQ ID NO: 17: SNP end (A to C) blank oligonucleotide:

[0228]

[0229] Experiment 2

[0230] SEQ ID NO: 18: S1 T (control)

[0231]

[0232]

[0233] SEQ ID NO: 19: BO S1T (G to T) blank oligonucleotide:

[0234]

[0235] Experiment 3

[0236] SEQ ID NO:20:S1 SNP2 C

[0237]

[0238] SEQ ID NO:21: BO S1 SNP2 C blank oligonucleotide

[0239]

[0240] Example 3

[0241] method

[0242] A method to distinguish WT and SNP sequences in a single reaction tube using fluorescent probes and blank oligonucleotides, where the probes and blank oligonucleotides are designed so that the SNP is in the middle of the sequence, is performed as follows:

[0243] LAMP master mix and reaction conditions are used as described in Example 2. Two groups of DNA, samples, probes and blank oligomers including SNPs in the middle of the probe and blank oligomer sequences were used to perform experiments. The SNP internal A to T group and the SNP internal C to T group were used in experiments using RB (Tris) buffer (experiments 3a and 3b) and CHES CAPSO buffer (experiments 3c and 3d). The difference between these two groups is that the SNP mutation on the SNP internal C to T group is located on a nucleotide complementary to the cytosine residue labeled with the TAMRA fluorophore on the fluorescent probe, while the SNPs in the SNP internal A to T are located at different positions.

[0244] Assay setup and workflow

[0245] LAMP primer mix and master mix were prepared and assays were performed as described above for Example 2.

[0246] result

[0247] Experiment 3a

[0248] RB (tris) buffer (SNP internal C to T)

[0249] Figure 7a Amplification curves for LAMP reactions using a WT fluorescent probe, a SNP internal C to T blank oligonucleotide, SybrGreen intercalating dye, and a WT DNA sample are shown. Both the probe and the dye show a significant increase in signal as the reaction proceeds. Figure 7b The corresponding curves of the C to T DNA samples within the SNP are shown. Although the WT probe signal is not as strong as the WT sample signal, Figure 7bA significant increase in signal was shown for the WT probe and the intercalating dye, indicating a significant level of binding between the WT probe and the binding site present in the C to T DNA sample amplification within the SNP. Figure 7c NTC experiments consistent with previous experiments are shown, showing no significant increase in signal for either fluorophore. Figure 7d Comparison of the output signal in the TAMRA channel in the presence of WT and SNP-containing sequences is shown.

[0250] Table 8: Results of SNP internal C to T under RB (tris) buffer conditions

[0251] IC WT DNA IC SNP Internal C to T DNA <![CDATA[Template-free control (H2O)]]> WT–TAMRA Checkout Checkout Not detected SybrGreen control Checkout Checkout Not detected

[0252] Experiment 3b

[0253] RB (tris) buffer (SNP internal A to T)

[0254] Figure 8a Amplification curves of LAMP reactions using WT fluorescent probe, SNP internal A to T blank oligonucleotide, SybrGreen intercalating dye, and WT DNA samples are shown. Both the probe and the dye show a significant increase in signal as the reaction proceeds. Figure 8b The corresponding curves of the A to T DNA samples within the SNP are shown. Although the WT probe signal is not as strong as the WT sample signal, Figure 8b A significant increase in signal was shown for the WT probe and the intercalating dye, indicating a significant level of binding between the WT probe and the binding site present in the A to T DNA sample amplification within the SNP. Figure 8c NTC experiments consistent with previous experiments are shown, showing no significant increase in signal for either fluorophore. Figure 8d Comparison of the output signal in the TAMRA channel in the presence of WT and SNP-containing sequences is shown.

[0255] Table 9: Results of A to T within SNP under RB (tris) buffer conditions

[0256] IC WT DNA IC SNP Internal A to T DNA <![CDATA[Template-free control (H2O)]]> WT–TAMRA Checkout Checkout Not detected SybrGreen control Checkout Checkout Not detected

[0257] Experiment 3c == CHES CAPSO buffer (SNP internal C to T)

[0258] Although the specificity of SNP detection is reduced if the SNP is located in the middle part of the blank oligonucleotide in the RB (tris) buffer environment (see Experiments 3a and 3b), the inventors unexpectedly found that the specificity can be improved by changing the buffer conditions.

[0259] Specifically, the same conditions as Experiment 3a were used, and the experiments using SNP internal C to T and SNP internal A to T samples and blank oligonucleotide sets were performed in the presence of CHES CAPSO buffer, which has been previously shown to improve assay specificity.

[0260] Figures 9a to 9d Shown is a LAMP experiment performed according to the method of the present invention in the presence of a fluorescent WT probe, an intercalating dye, and a SNP internal C to T blank oligonucleotide. Figure 9a As shown, when the WT sequence is present in the sample, the fluorescence of both the probe and the insert sequence show an increase in signal as the LAMP reaction proceeds because both fluorescent components are able to bind to the amplified DNA. Figure 9b As shown, in the presence of samples that only include the SNP internal C to T (which differs from the WT sequence by a single nucleotide), only the intercalating dye shows any significant signal increase. Therefore, by combining the probe and a blank oligonucleotide with a single point mutation in the middle of the sequence, WT and SNP-containing sequences can be recognized and detected with high specificity in the CHES CAPSO buffer environment. Fig.9c It is a NTC control experiment and shows no significant increase in fluorescence. Figure 9d Shown is a comparison of the output signal in the TAMRA channel in the presence of WT or SNP-containing sequences.

[0261] Table 9: Results for SNP internal C to T under CHES CAPSO buffer conditions.

[0262] WT DNA SNP internal C to T DNA <![CDATA[Template-free control (H2O)]]> WT-TAMRA Checkout Not detected Not detected SybrGreen control Checkout Checkout Not detected

[0263] Experiment 3d == CHES CAPSO buffer (SNP internal A to T)

[0264] Experiment 3b was repeated with SNP internal A to T samples, WT-TAMRA probe, and SNP internal A to T blank oligonucleotide using CHES CAPSO instead of RB (Tris) buffer. Figures 10a to 10d The curves of the fluorescence signals of LAMP amplification performed according to the method of the present invention in the presence of fluorescent WT probe, intercalating dye and SNP internal A to T blank oligonucleotide are shown. Fig.10a As shown, in the presence of the WT sample sequence, the fluorescence signals of both the probe and the intercalating dye increased as the LAMP reaction proceeded, indicating that both fluorescent components were able to bind to the amplified DNA.

[0265] When amplifying the A to T sample within the mutant SNP, Fig.10b As shown, only the intercalating dye showed any significant increase in signal. Thus, changing the buffer from RB (tris) to CHESCAPSO increased the specificity of the assay when the SNP was located in the middle of the blank oligonucleotide. Figure 7c A control NTC reaction showing no signal is shown. Fig.10d Shown is a comparison of the output signal in the TAMRA channel in the presence of WT or SNP-containing sequences.

[0266] The amplification times obtained using CHES CAPSO buffer were slower than those obtained using RB buffer. However, these experiments demonstrated that point mutations located in the middle of the blank oligonucleotide sequence can be detected with high specificity in the CHES CAPSO buffer environment. Therefore, this method may provide a feasible approach to detect SNPs located in the middle of the blank oligonucleotide sequence, especially when a large amount of DNA is present in the sample (e.g., in confirmation experiments in culture).

[0267] sequence:

[0268] - Position of the fluorophore

[0269] -—SNP mutation at or near the 3′ end

[0270] SEQ ID NO:22: WT sample:

[0271]

[0272] SEQ ID NO:23: WT probe:

[0273] TGTACGCTATTCAGGGATTG A

[0274]

[0275] SEQ ID NO:24: SNP internal A to T sample:

[0276]

[0277]

[0278] SEQ ID NO:25: SNP internal C to T blank oligonucleotide:

[0279]

[0280] SEQ ID NO:26: IC SNP internal A to T sample:

[0281]

[0282] SEQ ID NO:27: SNP internal A to T blank oligonucleotide:

[0283]

[0284] Example 4

[0285] Examples 1-3 using probes and artificial DNA sequences with point mutations demonstrate that detection of SNPs using LAMP can be achieved using competitive probes and / or blank oligonucleotides covering sequences with point mutations and SNPs located at the 3′ end or middle portion of each probe (one WT probe and one mutant SNP probe or blank oligonucleotide).

[0286] However, SNPs can be detected without using a competing probe or blank oligonucleotide under conditions where the probe itself generates a sufficiently specific signal.

[0287] method

[0288] This method is used to detect the A23063T (N501Y) mutation in the B1.1.7 SARS-CoV-2 variant. The A23063T (N501Y) mutation occurs in the S gene of the B1.1.7 variant of the SARS-CoV-2 virus, but not in the wild-type virus. In the assay, two sets of DNA primers and probes are used: an S gene primer set that covers the region with the A23063T (N501Y) mutation and the RdRp gene, which does not have any mutations in the B1.1.7 variant. The assay also contains two probes labeled with two different fluorophores: a WT-FAM probe that matches the S gene primer set and a RdRp-TAMRA probe that matches the RdRp primer set. The WT-FAM probe is based on the wild-type SARS-CoV-2 sequence (without mutations), however it was designed in such a way that the 3′ end of one of the loop primers is located at the position where A23063T (N501Y) occurs in the B1.1.7 SARS-CoV-2 variant, while the RdRp-TAMRA probe is used as a universal probe to generate fluorescent signals for both the wild-type and B1.1.7 variants. The test was performed using 10×RT particles containing BST polymerase and RTX reverse transcriptase and 5×MELT buffer (0.01M tris buffer pH 8, containing 0.1M Tween 20). The WT-FAM probe (for the S gene) and the RdRp-TAMRA probe were tested in combination at the same concentrations: WT ( Fig.11a ) or B1.1.7 RNA (from two different suppliers – ATCC (Figure 11B) or VIRCELL ( Fig.11c )) or with molecular water – NTC ( Fig.11d ) per reaction, 2.4 μl 10 μM probe per 1 10×RT particle. No blank oligonucleotide was used in this assay setup.

[0289] result

[0290] The universal RdRp-TAMRA control probe produced fluorescent signals in all tested RNA samples ( Fig.11a , b, c), but no signal was detected in the no-template control ( Fig.11d ); while the wild-type FAM probe only produces a fluorescent signal in the presence of wild-type SARS-CoV-2 RNA ( Fig.11a ), but no signal was shown in the B.1.1.7 variant RNA sample ( Fig.11b ,c).

[0291] These results indicate that SNPs can be detected in the absence of blank oligonucleotides or competitor probes as long as the first probe generates a sufficiently specific signal.

[0292] sequence:

[0293] -- Location of the fluorophore

[0294] --SNP mutation site at or near the 3′ end

[0295] SEQ ID NO:28: WT S gene sequence:

[0296]

[0297]

[0298] WT-FAM probe design:

[0299] Reverse complement (SEQ ID NO: 29) 5′GTATGGTTGGTAACCAACACCATT 3′ (SEQ ID NO: 30) SEQ ID NO: 31: WT-FAM probe:

[0300]

[0301] SEQ ID NO:32: RdRp-TAMRA probe:

[0302]

[0303] Primer sequences:

[0304] S gene primer sequence matching the WT-FAM probe

[0305] SEQ ID NO:33: S group 4F3 CTGTATAGATTGTTTAGGAAGTCT SEQ ID NO:34: S group 4B3 GCTGGTGCATGTAGAAGT SEQ ID NO:35: S group 4FIP TCAACACCATTACAAGGTGTGCTAAATCTCAAACCTTTTGAGAGAG SEQ ID NO:36: S group 4BIP TACAATCATATGGTTTCCAACCCACTCAAAAGAAAGTACTACTACTCTGT SEQ ID NO:37: S group 4LF CGGCCTGATAGATTTCAGTTGAAA

[0306] RdRp primer sequences compatible with RdRp-TAMRA probes

[0307] SEQ ID NO:38: nCoVr-ID01-F3 AAAACCCAGATATATTACGCG SEQ ID NO:39: nCoVr-ID01-B3 CTACAACAGGAACTCCACT SEQ ID NO:40: nCoVr-ID01-FIP CGCATGGCATCACAGAATTGTCGCCAACTTAGGTGAACG SEQ ID NO:41: nCoVr-ID01-BIP TGCTGGTATTGTTGGTGTACTGGGTTTGTATGAAATCACCGAA SEQ ID NO:42: nCoVr-ID01-LF TGTTTTTAACAAAGCTTGGCGT SEQ ID NO:43: nCoVr-ID01-LB TCAAGATCTCAATGGTAACTGGT

[0308] item

[0309] 1. A method for detecting a single nucleotide polymorphism (SNP) in a target nucleic acid sequence in a sample, the method comprising:

[0310] a) providing a first oligonucleotide probe complementary to a wild-type target sequence, wherein the first oligonucleotide probe comprises a fluorescent label bound to an internal cytosine base, and wherein the oligonucleotide probe does not have a 3′ terminator;

[0311] b) amplifying the target nucleic acid sequence in the sample by loop-mediated isothermal amplification using the first oligonucleotide probe and the second probe or the intercalating dye in a reaction container to provide an amplified nucleic acid, and detecting the amplified nucleic acid sequence;

[0312] c) detecting the presence of target wild-type and / or mutant nucleic acid sequences; and

[0313] d) distinguishing said presence of said target wild-type and / or mutant nucleic acid sequences based on fluorescent labels.

[0314] 2. The method according to claim 1, further comprising:

[0315] Providing an intercalating dye or providing a second probe, wherein the second probe is selected from a probe complementary to the mutant sequence of the wild-type target sequence or a universal probe capable of detecting both the wild-type target sequence and the mutant sequence of the wild-type target sequence;

[0316] wherein the second probe and / or intercalating dye comprises an additional fluorescent label distinguishable from the first probe; and

[0317] The target nucleic acid sequence is amplified using the second probe or intercalating dye in a reaction vessel.

[0318] 3. A method as described in any one of items 1 and 2, wherein at least one probe comprises a single point or double point mutation.

[0319] 4. A method according to any of the preceding items, wherein the method provides a second probe, wherein the second probe is complementary to a mutant sequence of the wild-type target sequence, and:

[0320] i) further comprises a fluorescent label bound to an internal cytosine base and has no 3' terminator; and

[0321] ii) wherein at least one of the first and second probes contains a single or double point mutation at or near the 3' end.

[0322] 5. A method according to any one of items 1 to 3, wherein the method provides an intercalating dye or a universal probe, and wherein:

[0323] a) the method further provides a blank oligonucleotide having the same sequence as the first probe but without the fluorescent label and comprising one or more SNP mutations at or near the 3′ end; or

[0324] b) the method further provides a blank oligonucleotide having the same sequence as the first probe but without the fluorescent label and including one or more SNPs in the middle of the sequence, optionally wherein the method uses CHES CAPSO buffer; or

[0325] c) wherein the method omits a blank oligonucleotide and wherein the first probe is specific for a wild-type DNA or RNA sequence having a single point mutation relative to the nucleotide at or near the 3' end of the probe.

[0326] 6. A method as described in any of the preceding items, wherein the fluorescent markers and / or intercalating dyes include one or more of the following: TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO and v13, or any other dye suitable for nucleic acid detection.

[0327] 7. A method as described in any of the preceding items, wherein:

[0328] a) the first probe and / or the second probe is configured to act as a loop-mediated isothermal amplification primer, optionally a LF or LB loop primer; and / or

[0329] b) The first probe, the second probe and / or the target nucleic acid sequence are:

[0330] i) a DNA sequence; or

[0331] ii) RNA sequence.

[0332] 8. The method according to any one of the preceding items, wherein the loop-mediated isothermal amplification is performed using RB (tris) buffer.

[0333] 9. A method as described in any of the preceding items, wherein the first or second probe comprises one or more of the following sequences:

[0334] SEQ ID NO: 1: 5′GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3′ (SARS-CoV-2 WT probe S gene, used to distinguish A23063T N501Y point mutation);

[0335] SEQ ID NO: 2: 5′AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3′ (SARS-CoV-2 WT probe S gene, used to distinguish the E484K point mutation); or

[0336] SEQ ID NO:3: 5′AAAGGAAAGTAACAATTAAAACCTTT 3′ (SARS-CoV-2 mutant blank oligonucleotide, used to distinguish the E484K point mutation).

[0337] 10. A method as described in any of the preceding items, wherein the presence of the target wild-type and / or mutant nucleic acid sequence can be detected under the following conditions:

[0338] i) during loop-mediated isothermal amplification, and / or

[0339] ii) Without any post-amplification manipulation.

[0340] 11. A method as described in any of the preceding items, wherein the target nucleic acid is from a virus, optionally wherein the virus is SARS-CoV-2 or a variant thereof.

[0341] 12. A method as described in any of the preceding items, wherein the loop-mediated isothermal amplification uses FIP, BIP, F3 and B3 primers, optionally wherein the amplification also uses loop F and / or loop B primers.

[0342] 13. A method as described in any of the preceding items, wherein the LAMP reaction and the detection of the amplified nucleic acid sequence are performed in the same container

[0343] 14. A kit for detecting nucleotide polymorphism in a target nucleic acid sequence in a sample, the kit comprising:

[0344] a) a first oligonucleotide probe complementary to a wild-type target sequence, wherein the first oligonucleotide probe comprises a fluorescent label bound to an internal cytosine base, and wherein the oligonucleotide probe sequence does not have a 3′ terminator; and

[0345] b) loop-mediated isothermal amplification reagent buffer, enzyme, dNTP and loop-mediated isothermal amplification primer; and

[0346] Wherein the first probe is configured for use in a single reaction vessel.

[0347] 15. The kit of claim 14, further comprising:

[0348] an intercalating dye or a second oligonucleotide probe, wherein the second oligonucleotide probe is selected from a probe complementary to a mutant sequence of the wild-type target sequence, or a universal probe capable of detecting both wild-type and mutant target sequences;

[0349] wherein the second oligonucleotide probe and / or intercalating dye comprises an additional fluorescent label distinguishable from the first probe; and

[0350] The first probe, the second probe and / or the intercalating dye are configured to be used in a single reaction vessel.

[0351] 16. A kit as described in any of items 14 and 15, wherein at least one probe comprises a single point or double point mutation.

[0352] 17. A kit according to any one of items 15 and 16, wherein the kit provides a second probe, wherein the second probe is complementary to the mutant sequence of the wild-type target sequence, and:

[0353] i) further comprises a fluorescent label bound to an internal cytosine base and has no 3' terminator; and

[0354] ii) wherein at least one of the first and second probes contains a single or double point mutation at or near the 3' end.

[0355] 18. A kit according to any one of items 15 or 16, wherein the kit provides an intercalating dye or a universal probe, and wherein:

[0356] a) the kit further comprises a blank oligonucleotide having the same sequence as the first probe but without the fluorescent label and comprising one or more SNP mutations at or near the 3′ end; or

[0357] b) the kit further comprises a blank oligonucleotide having the same sequence as the first probe but without the fluorescent label and comprising one or more SNPs in the middle of the sequence, optionally wherein the method uses CHES CAPSO buffer; or

[0358] c) wherein the kit omits a blank oligonucleotide and wherein the first probe is specific for a wild-type DNA or RNA sequence having a single point mutation relative to the nucleotide at or near the 3' end of the probe.

[0359] 19. A kit as described in any of items 14-18, wherein the fluorescent markers and / or intercalating dyes include one or more of the following: TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO and v13, or any other dye suitable for nucleic acid detection.

[0360] 20. A kit according to any one of items 14-19, wherein:

[0361] a) the first probe and / or the second probe is configured to act as a loop-mediated isothermal amplification primer; and / or

[0362] b) The first probe, the second probe and / or the target nucleic acid sequence are:

[0363] i) a DNA sequence; or

[0364] ii) RNA sequence.

[0365] 21. A kit as described in any one of items 14-20, wherein the buffer is RB (tris) buffer.

[0366] 22. A kit as described in any one of items 14-21, wherein the first or second probe comprises one or more of the following sequences:

[0367] SEQ ID NO: 1: 5′GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3′ (SARS-CoV-2 WT probe S gene, used to distinguish A23063T N501Y point mutation),

[0368] SEQ ID NO: 2: 5′AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3′ (SARS-CoV-2 WT probe S gene, used to distinguish the E484K point mutation); and

[0369] SEQ ID NO:3: 5′AAAGGAAAGTAACAATTAAAACCTTT 3′ (SARS-CoV-2 mutant blank oligonucleotide, used to distinguish the E484K point mutation).

[0370] 23. A kit according to any one of items 14-22, wherein the kit is configured to allow detection of the presence of a target wild-type and / or mutant nucleic acid sequence:

[0371] i) during loop-mediated isothermal amplification, and / or

[0372] ii) Without any post-amplification manipulation.

[0373] 24. A kit as described in any of items 14-23, wherein the target nucleic acid is from a virus, optionally wherein the virus is SARS-CoV-2 or a variant thereof.

[0374] 25. A kit as described in any one of items 14-24, wherein the loop-mediated isothermal amplification uses FIP, BIP, F3 and B3 primers, optionally wherein the amplification also uses loop F and / or loop B primers.

Claims

1. A method for detecting and / or distinguishing single nucleotide polymorphisms (SNPs) in a target nucleic acid sequence in a sample, the method comprising: a) providing a first oligonucleotide probe complementary to a wild-type target sequence, wherein the first oligonucleotide probe comprises a fluorescent label bound to an internal cytosine base, and wherein the oligonucleotide probe does not have a 3′ terminator; and Providing a second oligonucleotide probe comprising an additional fluorescent label that can be distinguished from the first probe or a blank oligonucleotide without a fluorescent label, wherein the second oligonucleotide probe or the blank oligonucleotide is complementary to the mutant sequence of the wild-type target sequence and contains a single or double point mutation that distinguishes the mutation; b) amplifying a target nucleic acid sequence in the sample to provide an amplified nucleic acid by loop-mediated isothermal amplification in a reaction vessel using the first oligonucleotide probe and: i) a second oligonucleotide probe, or ii) blank oligonucleotide and intercalating dye or universal probe, and detecting the amplified nucleic acid sequence; c) detecting the presence of target wild-type and / or mutant nucleic acid sequences; and d) distinguishing said presence of said target wild-type and / or mutant nucleic acid sequences based on fluorescent labels.

2. The method of claim 1, wherein: The universal probe is capable of detecting both the wild-type target sequence and a mutant sequence of the wild-type target sequence; wherein the universal probe or intercalating dye comprises an additional fluorescent label distinguishable from the first probe; and The target nucleic acid sequence is amplified in a reaction vessel using a universal probe or an intercalating dye.

3. The method of any one of the preceding claims, wherein the method provides the second probe, and: i) the second probe further comprises a fluorescent label bound to a cytosine base and does not have a 3′ terminator; and ii) wherein the first and second probes contain a single or double point mutation at or near the 3' end.

4. The method of any one of claims 1-2, wherein the method provides an intercalating dye or a universal probe, and wherein: a) the blank oligonucleotide comprises one or more SNP mutations at or near the 3′ end; or b) the blank oligonucleotide comprises one or more SNP mutations in the middle of the sequence, optionally wherein the method uses CHES CAPSO buffer.

5. A method as described in any of the preceding claims, wherein the fluorescent markers and / or intercalating dyes include one or more of the following: TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO and v13, or any other dye suitable for nucleic acid detection.

6. A method as claimed in any preceding claim, wherein: a) the first probe and / or the second probe or the blank oligonucleotide is configured to act as a loop-mediated isothermal amplification primer, optionally a LF or LB loop primer; and / or b) the first probe, the second probe, the blank oligonucleotide and / or the target nucleic acid sequence is: i) a DNA sequence; or ii) RNA sequence.

7. The method according to any one of the preceding claims, wherein the loop-mediated isothermal amplification is performed using RB (tris) buffer.

8. A method as claimed in any preceding claim, wherein the first or second probe comprises one or more of the following sequences: SEQ ID NO: 1: 5′GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3′ (SARS-CoV-2 WT probe S gene, used to distinguish A23063T N501Y point mutation); SEQ ID NO: 2: 5′AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3′ (SARS-CoV-2 WT probe S gene, used to distinguish the E484K point mutation); or SEQ ID NO:3: 5′AAAGGAAAGTAACAATTAAAACCTTT 3′ (SARS-CoV-2 mutant blank oligonucleotide, used to distinguish the E484K point mutation).

9. The method of any of the preceding claims, wherein the presence of the target wild-type and / or mutant nucleic acid sequence can be detected under the following conditions: i) during loop-mediated isothermal amplification, and / or ii) Without any post-amplification manipulation.

10. The method of any of the preceding claims, wherein the target nucleic acid is from a virus, optionally wherein the virus is SARS-CoV-2 or a variant thereof.

11. A method according to any preceding claim, wherein the loop-mediated isothermal amplification uses FIP, BIP, F3 and B3 primers, optionally wherein the amplification also uses loop F and / or loop B primers.

12. The method of any preceding claim, wherein the LAMP reaction and the detection of the amplified nucleic acid sequence are performed in the same vessel.

13. A method as claimed in any preceding claim, wherein a blank oligonucleotide is provided at a concentration equal to or exceeding that of the first oligonucleotide probe.

14. The method of claim 13, wherein the blank oligonucleotide is provided at a concentration of two or more times the concentration of the first oligonucleotide probe, optionally wherein the blank oligonucleotide is provided at a concentration of four or more times the concentration of the first oligonucleotide probe.

15. A kit for distinguishing nucleotide polymorphisms in a target nucleic acid sequence in a sample, the kit comprising: a) a first oligonucleotide probe complementary to a wild-type target sequence, wherein the first oligonucleotide probe comprises a fluorescent label bound to an internal cytosine base, and wherein the oligonucleotide probe sequence does not have a 3′ terminator; and i) a second oligonucleotide probe comprising an additional fluorescent label distinguishable from the first probe, wherein the second oligonucleotide probe is complementary to the mutant sequence of the wild-type target sequence and contains a single or double point mutation at or near the 3′ end that distinguishes the mutation; or ii) a blank oligonucleotide complementary to the mutant sequence of the wild-type target sequence and containing a single or double point mutation that distinguishes the mutation, and an intercalating dye or a universal probe; and b) loop-mediated isothermal amplification reagent buffer, enzyme, dNTP and loop-mediated isothermal amplification primer; and The first probe and the second probe or blank oligonucleotide are configured to be used in a single reaction vessel.

16. The kit of claim 15, wherein: The universal probe is capable of detecting both wild-type and mutant target sequences; wherein the universal probe or intercalating dye comprises an additional fluorescent label distinguishable from the first probe; and The first probe and the universal probe or the intercalating dye are configured to be used in a single reaction vessel.

17. The kit of claim 15, wherein the kit provides the second probe, and: i) the second probe further comprises a fluorescent label bound to a cytosine base and does not have a 3′ terminator; and ii) wherein the first probe contains a single or double point mutation at or near the 3' end.

18. The kit of claim 16, wherein the kit provides an intercalating dye or a universal probe, and wherein: a) the blank oligonucleotide comprises one or more SNP mutations at or near the 3′ end; or b) the blank oligonucleotide comprises one or more SNP mutations in the middle of the sequence, optionally wherein the method uses CHES CAPSO buffer.

19. The kit of any one of claims 15-18, wherein the fluorescent markers and / or intercalating dyes comprise one or more of the following: TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO and v13, or any other dye suitable for nucleic acid detection.

20. The kit according to any one of claims 15 to 19, wherein: a) the first probe, the blank oligonucleotide and / or the second probe are configured to act as loop-mediated isothermal amplification primers, optionally wherein; and / or b) the first probe, the blank oligonucleotide, the second probe and / or the target nucleic acid sequence is: i) a DNA sequence; or ii) RNA sequence.

21. The kit according to any one of claims 15 to 20, wherein the buffer is RB (tris) buffer.

22. The kit of any one of claims 15-21, wherein the first or second probe comprises one or more of the following sequences: SEQ ID NO: 1: 5′GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3′ (SARS-CoV-2 WT probe S gene, used to distinguish A23063T N501Y point mutation), SEQ ID NO: 2: 5′AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3′ (SARS-CoV-2 WT probe S gene, used to distinguish the E484K point mutation); and SEQ ID NO:3: 5′AAAGGAAAGTAACAATTAAAACCTTT 3′ (SARS-CoV-2 mutant blank oligonucleotide, used to distinguish the E484K point mutation).

23. A kit according to any one of claims 15 to 22, wherein the kit is configured to allow detection of target wild-type and / or mutant nucleic acid sequences: i) during loop-mediated isothermal amplification, and / or ii) Without any post-amplification manipulation.

24. A kit as described in any one of claims 15-23, wherein the target nucleic acid is from a virus, optionally wherein the virus is SARS-CoV-2 or a variant thereof.

25. The kit of any one of claims 15-24, wherein the loop-mediated isothermal amplification uses FIP, BIP, F3 and B3 primers, optionally wherein the amplification also uses loop F and / or loop B primers.

26. The kit of any one of claims 15-25, wherein the blank oligonucleotide is provided at a concentration equal to or greater than that of the first oligonucleotide probe.

27. A kit as claimed in claim 26, wherein the blank oligonucleotide is provided at a concentration of two or more times the concentration of the first oligonucleotide probe, optionally wherein the blank oligonucleotide is provided at a concentration of four or more times the concentration of the first oligonucleotide probe.

Images