Oligonucleotides with nucleotide analogues

By modifying gemcitabine nucleotides in the sense strand of siRNA and using a targeted delivery system, the problems of gemcitabine's distributive toxicity and limited therapeutic index in cancer treatment were solved, achieving highly efficient killing and low-toxicity treatment in tumor cells.

CN115315514BActive Publication Date: 2025-11-21SIRNAOMICS INC
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
CN202080081757.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-02-17
Filing Date
2020-10-02
Publication Date
2025-11-21
Estimated Expiration
2040-10-02

AI Technical Summary

Technical Problem

Existing gemcitabine treatments for cancer have significant toxicity issues due to its distribution in normal cells and limited therapeutic index, and require high doses to show efficacy in tumor cells.

Method used

By modifying gemcitabine nucleotides into the sense strand of siRNA to form an siRNA composition containing a PolyGEM sequence, and then targeting and delivering it to tumor cells using a histidine-lysine peptide nanoparticle system, the effect of gemcitabine in tumor cells is enhanced.

Benefits of technology

It achieves highly efficient killing of tumor cells at lower doses, reduces toxicity to normal cells, and improves the therapeutic index.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115315514B_ABST
    Figure CN115315514B_ABST
Patent Text Reader

Abstract

Provided are siRNA compositions comprising gemcitabine (GEM) substituted for cytosine moieties in siRNAs. Provided are pharmaceutical compositions containing these siRNA molecules, and methods of using these compositions to treat diseases, such as cancer.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application claims priority to the following U.S. provisional applications: 62 / 909526, filed October 2, 2019; 62 / 927500, filed October 29, 2019; and 62 / 977630, filed February 17, 2020, the contents of which are incorporated herein by reference in their entirety. Technical Field

[0002] This invention belongs to the field of biomedical technology, specifically relating to oligonucleotides having nucleoside analogues. Background Technology

[0003] siRNA is a double-stranded RNA molecule composed of a sense strand and a complementary antisense strand. These molecules may be blunt-ended molecules with 19-29 bases long on each strand, or they may exhibit two base overhangs (usually dTdT).

[0004] Each strand of siRNA is typically prepared on a synthesizer by coupling the next base in the desired sequence to the base of the preceding oligonucleotide linked to it. Imidacrylamide chemistry or other synthetic methods are well known in the art. Once synthesis is complete, the two strands are then annealed to form a doublet.

[0005] It has been demonstrated that siRNAs targeting specific genes within cancer cells can reduce the expression of proteins encoded by the silenced gene targets. Therefore, silencing these genes can inhibit cell growth. If the cells are specifically diseased cells (e.g., cancer cells) that siRNAs can access, then siRNAs can function as therapeutic agents. Furthermore, in some cases, it has been found that silencing genes in selected pathways can enhance the effectiveness of selective therapies (small molecule inhibitors, monoclonal antibodies, etc.), currently considered the "gold standard" for treatment.

[0006] Gemcitabine (2',2'-difluoro2'-deoxycytidine) is a pyrimidine-based nucleoside analogue that is taken up by nucleoside transporters upon systemic administration and activated by triphosphorylation via deoxycytidine kinase, after which it can be incorporated into RNA or DNA. It can inhibit tumor growth by replacing cytosine nucleic acids during DNA replication (during cell division) because new nucleosides cannot attach to this nucleoside mimic, leading to apoptosis (Damaraju et al., Oncogene 22:7524–7536 (2003)).

[0007] Gemcitabine is a primary treatment for pancreatic cancer (Burris et al., J Clin Oncol 15: 2403–2413 (1997)), but it is also used to treat many other cancers, including cholangiocarcinoma (Jo and Song, “Chemotherapy of Cholangiocarcinoma: Current Management and Future Directions. Topics in the Surgery of the Biliary Tree,” Chapter 3; pp. 35–52. http: / / dx.doi.org / 10.5772 / intechopen.76134, SY (2018)), non-small cell lung cancer (Muggia et al., Expert Opinion on Investigational Drugs, 21:4, 403-408 (2012)), ovarian cancer (Le et al., Gynaecol. Oncol. Res. Pract. 4:16 (2017) and breast cancer (Xie et al., Oncotarget, 9:7148-7161 (2018)). Gemcitabine is taken up by nucleoside transporters, activated by deoxycytidine kinase, and then incorporated into RNA and DNA. Inhibition of ribonucleotide reductase and dCMP deaminase enhances its activation, while cytidine deaminase converts gemcitabine into its potentially inactive metabolite 2',2'-difluorodeoxyuridine, which can inhibit thymidylate synthase in nucleotide form. Gemcitabine is administered systemically to patients via intravenous infusion. The standard administration of gemcitabine is 1000 mg / m². 2 It is administered via 30-minute infusions weekly, but its efficacy is limited because it is distributed not only to tumor cells but also to normal cells, thus exhibiting significant toxicity. Furthermore, to see efficacy in certain tumor types, very high doses are required, and the therapeutic index of the drug may be quite limited.

[0008] Gemcitabine is widely used in combination therapy, primarily with platinum analogs. Other alternative combinations of gemcitabine in ovarian cancer include the use of triapine or hydroxyurea to increase ribonucleotide reductase inhibition.

[0009] Various approaches have been explored to overcome gemcitabine toxicity. One of the most promising approaches is the use of targeted delivery agents that selectively and extensively deliver to tumor cells while reducing delivery to normal cells.

[0010] Examples of genes that enhance the effects of the compound gemcitabine include siRNAs targeting RAD17, CHK1, CHK2, ATR, and ATM, to name just a few (see: Azorsa, J. Transl. Med. 7: 43 (2009); Fredebohm (Journal of Cell Science 126: 3380–3389, 2013) and Plunkett et al., Semin Oncol 23: 3–15 (1996)).

[0011] As described above, the research attempts to find other intracellular targets that, when inhibited (by antagonists such as small molecules or antibodies) or silenced (using siRNA or miRNA), result in a beneficial shift in the dose-response curve for the drug, moving towards the drug to exhibit the same efficacy at lower doses / concentrations.

[0012] This shift in dose response can be observed using siRNA targeting RAD17 or CHK1 (as illustrated in the examples).

[0013] Using a variety of targeted or non-targeted delivery agents, these siRNAs can be delivered to the tumor environment within animals / humans exhibiting disease. These delivery agents can consist of lipids, modified lipids, peptide delivery agents, etc., or even have a modified backbone to directly link the targeting ligand to the modified (chemically stable) siRNA molecule to prevent degradation of the siRNA by nucleases and other enzymes encountered in circulation.

[0014] Recently, GalNAc-modified siRNAs have been used to facilitate the specific delivery of these siRNAs to hepatocytes within the liver. The GalNac moiety binds with very high affinity to the specific and abundant desialyl glycoprotein receptor (ASGPR) on hepatocytes. ASGPRs are thought to be internalized into the cell after binding, thus carrying the linked siRNA into cells containing it.

[0015] Other targeting ligands that can deliver payloads to specific cell types include GLP1 peptides (which bind to the GLP1 receptor on pancreatic β cells), RGD motifs (e.g., cRGD or iRGD that bind to the α5β3 integrin receptor, or peptides derived from foot-and-mouth disease virus that bind to the α5β6 integrin receptor with an affinity of nM, compared to approximately micromolar affinity for the α5β3 receptor), folic acid ligands (which bind to the folic acid receptor), transferrin ligands that bind to the transferrin receptor, and EGFR that targets the EGF receptor. Examples of many other targeting motifs demonstrate specificity for delivery to different cell types.

[0016] This article describes compositions and methods that provide co-delivery of siRNA (which will silence genes) with a drug (e.g., gemcitabine) to produce greater therapeutic benefits than administration of siRNA or the drug alone.

[0017] Gemcitabine (such as 5-FU and other nucleoside analogs) can be chemically synthesized using conventional synthetic methods (manual or with automated instruments) in a manner that allows direct coupling of DNA or RNA bases. Summary of the Invention

[0018] A siRNA composition comprising a cytosine moiety within the siRNA sequence replaced by gemcitabine (GEM) is provided. A pharmaceutical composition comprising these siRNA molecules is provided, along with a method of treating a disease (e.g., cancer) using the composition.

[0019] definition

[0020] Small interfering RNA (siRNA) siRNAs are short, double-stranded oligonucleotides of double-stranded RNA that, upon introduction into a cell, interfere with gene expression within that cell. For example, they target and bind to complementary nucleotide sequences in single-stranded target RNA molecules. siRNA molecules are constructed chemically or otherwise using techniques known to those skilled in the art. Such techniques are described in U.S. Patent Nos. 5,898,031, 6,107,094, 6,506,559, 7,056,704, RE46,873E, and 9,642,873B2, and European Patent Nos. 1214945 and 1230375, all of which are incorporated herein by reference in their entirety. As is customary in the art, when an siRNA molecule is identified by a specific nucleotide sequence, that sequence refers to the sense strand of the double-stranded molecule. One or more ribonucleotides constituting the molecule can be chemically modified using techniques known in the art. In addition to modification at the level of one or more individual nucleotides, the backbone of the oligonucleotide can also be modified. Other modifications include coupling small molecules (e.g., sugar molecules), amino acids, peptides, cholesterol, and other macromolecules to the siRNA molecule.

[0021] MicroRNA (miRNA): Small, non-coding RNA molecules play a role in the posttranscriptional regulation of RNA silencing and gene expression by targeting and binding complementary nucleotide sequences in single-stranded target RNA molecules.

[0022] Antisense oligonucleotides (ASO) Short, single-stranded RNA or DNA (typically 11-27 bases) that can reduce gene expression in mammalian cells by targeting and binding to complementary nucleotide sequences in single-stranded target RNA molecules.

[0023] DNA or RNA aptamersAptamers are single-stranded DNA or RNA oligonucleotides that bind to specific target molecules. These targets include small molecules, proteins, and nucleic acids. These aptamers are typically created from a large pool of random sequences through repeated rounds of in vitro selection or through phylogenetic analysis of ligands using exponential enrichment (SELEX).

[0024] PolyGEM sequence : A sequence containing multiple gemcitabine nucleotides in a row.

[0025] OligoGEM Oligonucleotides containing multiple gemcitabine nucleosides. Nucleosides can be continuous at either end of the oligonucleotide or within the oligonucleotide, or nucleosides can be dispersed within the oligonucleotide, including single nucleosides at one or both ends.

[0026] Histidine-Lysine copolymer : A peptide or polypeptide composed of the amino acids histidine and lysine. Such copolymers are described in U.S. Patent Nos. 7,070,807B2, 7,163,695B2 and 7,772,201B2, which are incorporated herein by reference in their entirety.

[0027] Cancer is any malignant tumor.

[0028] Malignant tumors It is a cluster of supernumerary cells.

[0029] liver cancer Liver cancer refers to any primary cancer originating in the liver, or any secondary cancer that has metastasized to the liver from another tissue in a mammal. An example of primary liver cancer is hepatocellular carcinoma. An example of secondary liver cancer is colon cancer.

[0030] Treatment / Therapy It can kill some or all cancer cells, reduce the size of the cancer, inhibit its growth, or slow down its growth rate.

[0031] Enhance anti-tumor efficacy This refers to providing a greater reduction in the growth rate of tumor cells, providing better effects in killing tumor cells and / or reducing tumor quality, and ultimately producing better treatment outcomes by extending the lifespan of cancer patients.

[0032] Target selection for enhancing GEM activity

[0033] Constructs containing GEM

[0034] Azorsa et al. (J. Transl. Med. 7: 43 (2009)) identified siRNAs targeting the CHK1 gene, which showed enhanced gemcitabine activity against pancreatic cancer cells in cultures. Subsequently, Fredebohm (Journal of Cell Science 126: 3380–3389, 2013) validated CHK1 as a potentiator of gemcitabine in pancreatic tumor cells, but also identified several other potential targets that enhance gemcitabine activity when silenced. RAD17 was identified as one of these targets and showed a significant enhancement of gemcitabine's effect in reducing cell viability.

[0035] RAD17 is considered a better target than CHK1 because silencing the gene alone has little effect on cell viability, but the synergistic effect of reducing cancer cell viability is also evident when gemcitabine is included. However, even in the absence of gemcitabine, CHK1 silencing itself has been shown to exhibit some toxicity in cells—this requires the use of CHK1-targeting siRNA, which needs to be administered in a manner that preferentially takes up into tumor cells rather than into normally dividing cells.

[0036] It has been demonstrated that RAD17 inhibition can synergize with checkpoint kinase inhibition (Shen et al., Oncotarget 6: 35755-35769 (2015)). Therefore, it is possible to co-deliver siRNAs targeting two targets—RAD17 and CHK1—to further enhance activity against pancreatic cancer. As described herein, siRNAs targeting both RAD17 and CHK1 can be modified with gemcitabine nucleotides within the sense strand or have gemcitabine nucleotides attached to the terminus of the sense strand, and the two gem-modified siRNAs can be combined in a single peptide nanoparticle, thereby improving transfection efficacy. Furthermore, peptide nanoparticles (“PNPs”) prepared using histidine-lysine branched copolymers can simultaneously deliver multiple siRNAs to the same cell. These PNPs can also be used to deliver siRNAs to various tumor cell types used as xenografts in animal models.

[0037] As described below, siRNA molecules containing a GEM portion attached to the end of the siRNA sequence and / or within the sequence can be prepared. These GEM-containing siRNAs retain the function of silencing target genes and produce enhanced tumor-killing efficacy by releasing the GEM into cells, wherein a synergistic effect is observed between gene silencing activity and drug action, i.e., the observed results are superior to those achieved by administering siRNA and GEM as separate components individually.

[0038] To determine whether GEM could be better processed if isolated from natural nucleotides, we utilized the fact that gemcitabine is a nucleotide cytosine analog and can therefore be directly incorporated into the siRNA sequence to replace cytosine (C). Gemcitabine imide derivatives can be used to form polymers composed entirely of GEM moieties (Ma et al., Chem. Commun., 55: 6603-6606 (2019)). These polymers form nanogels, and they have shown some activity in in vitro and in vivo cancer cell models. Modified nucleosides incorporating amidite functional groups can be used to introduce modified nucleosides, such as GEM, into one strand during the synthesis of the duplex. Since the antisense strand from the siRNA duplex must anneal to the appropriate sequence in the sense strand within the siRNA region, and the antisense strand is incorporated into the RISC complex and used to monitor mRNA sequence matching, the modified nucleosides are first attached to the sense strand of the siRNA to form a length extension of the sense strand relative to the antisense strand. Multiple (n) non-natural nucleoside bases can be incorporated at the end of the chain, so that the delivery of a single siRNA molecule results in the co-delivery of multiple (n) non-natural nucleosides.

[0039] Once inside the cytoplasm, the antisense strand is incorporated into the RISC complex. If a matching mRNA sequence is recognized, the mRNA is cleaved by the DICER enzyme. During this process, the sense strand is removed and then cleaved in the cytoplasm. The non-natural nucleoside analog incorporated to the terminus of the sense strand is then cleaved by endogenous nucleases. The free gemcitabine molecule (or a structure similar to the non-natural nucleoside analog used in anticancer drugs) then inhibits tumor cell replication mechanisms and, in conjunction with the reduced expression of genes targeted by siRNA, exhibits a better effect in reducing tumor cell growth than when these agents are not used.

[0040] Unmodified siRNA molecules incorporating GEM residues can be delivered in suitable nanoparticle formulations to protect them from degradation in the bloodstream or in tissues, tumor microenvironments, etc. Once inside the tumor or target tissue, the siRNA is released into tumor cells to exert its cytotoxic effect.

[0041] siRNA molecules synthesized using GEM amidates can be delivered via a histidine-lysine peptide nanoparticle (HKPPNP) nanoparticle system. GEM can be contained within the siRNA duplex sequence of a target gene, which then enhances the effect of gemcitabine in killing tumor cells—reducing the dosage required to observe therapeutic effects and decreasing the likelihood of toxic effects observed when gemcitabine is administered to patients alone. As described below, a previously published siRNA sequence targeting CHK1 (Azorsa, see above) has been selected, demonstrating its enhancing effect on gemcitabine when administered separately from it (i.e., as a separate component).

[0042] siRNA can be stabilized against nuclease degradation through chemical modification (e.g., by using 2'-OMe and / or 2'-F and / or phosphate thiocyanate modification) using methods known in the art. siRNA can optionally be chemically linked (via the ends of SS or AS, or even by adding a GEM to the end of the molecule) to a targeting moiety (e.g., GalNac, RGD, folic acid, TFR, EGFR, peptide-targeting ligands, aptamers, or other carbohydrates, or even small molecules, antibodies, or nanobodies). The targeting moiety has an affinity for receptors or other targets on the cell surface, thereby being enriched and taken up into these cells. With unmodified siRNA, the SS and AS chains will separate in the cell; the AS chain will cause the target gene to be silenced, while the released SS-polyGEM structure will be degraded to release the GEM, which, in combination with the silenced gene, will exhibit a stronger effect than when used alone. Attached Figure Description

[0043] Figure 1 The basic structure of oligonucleotides with GEM is shown;

[0044] Figure 2a The ASO sequence with a polyGEM tail is shown;

[0045] Figure 2b Targeted ASO delivery via a targeted ligand is demonstrated;

[0046] Figure 3 Targeted oligonucleotide delivery was demonstrated;

[0047] Figure 4 The text shows meaningful and antisense sequences of equal length with Gem rings.

[0048] Figure 5 The meaningful and antisense sequences with Gem rings of non-uniform length are shown;

[0049] Figure 6 The targeted delivery of an equal-length sequence with a Gem ring is shown;

[0050] Figure 7 This demonstrates targeted delivery of non-equidistant sequences with Gem loops;

[0051] Figure 8 The study demonstrated the response of the pancreatic cancer cell line BxPC3 to non-silenced siRNA (NS / lipo).

[0052] Figure 9 The study demonstrated the sensitivity of pancreatic cancer cell line viability to transfection with eight siRNA sequences designed to target CHK1;

[0053] Figure 10 The structural formulas of gemcitabine and some nucleoside anticancer agents that can replace gemcitabine are shown.

[0054] Figure 11 The graph shows the results of the detection of the activity of pancreatic cancer cells by siRNA targeting CHK1 and RAD17 individually.

[0055] Figures 12a to 12d The effect of adding two gemcitabine nucleotides to the 3' end of the sense strand of each siRNA on titer strength and potency was shown.

[0056] Figure 13 The effect of adding an additional GEM at the 3' end of the sense chain on efficacy and valence strength is shown;

[0057] Figure 14 The effects of gemcitabine insertion into the sense / antisense strand and its effect on gene silencing were shown (qPCR results);

[0058] Figure 15 The time-dependent efficacy of siRNA and siRNA-GEM constructs in cell viability was demonstrated;

[0059] Figure 16 The effect of including C-substituted GEM in the AS chain is shown;

[0060] Figure 17 The effect of the location and amount of GEM in the SS of siRNA on the potency and titer of siRNA / Gem combination was shown.

[0061] Figure 18 This demonstrates the role of the construct in another pancreatic tumor cell line—MiaPaca;

[0062] Figure 19 The effects of GEM-modified siRNA on MiaPaca cells were shown. Detailed Implementation

[0063] Basic structure as follows Figure 1 As shown. Figure 2a Showing the sequence of antisense oligonucleotides (“ASO”) with a polyGEM tail. Figure 2b Targeted ASO delivery via a targeted ligand is demonstrated. Figure 3 Targeted oligonucleotide delivery is shown: 3a shows a targeting ligand linked to the sense strand, while 3b shows a targeting ligand linked to the antisense strand.

[0064] pegicilb can also be coupled to a single oligonucleotide with equal-length sense and antisense strands (see...). Figure 4 After annealing, it forms a "polygemcitabine loop" linking the two strands of the double-stranded RNA. Compared to two strands, a single oligonucleotide sequence offers reduced manufacturing costs and the potential to improve product stability, as well as the ability to deliver a much larger amount of GEM molecules to cells via each siRNA, thereby enhancing anti-cancer efficacy. Furthermore, in some cases, the two strands of RNA do not need to be of the same length, provided there are enough bases on the short strand to hybridize with relevant homologous sequences on the long strand (see...). Figure 5 In these cases, the gemcitabine ring may be asymmetrical between the two chains.

[0065] In another implementation, these constructs are targeted to specific cell types by linking a targeting ligand that binds to a target with high affinity, the target being present at a higher level on target cells compared to non-target cells. For targeted delivery, multiple ligands can be linked to the gemcitabine ring region (see...). Figure 6 — This provides the advantage of multivalent targeting by allowing multiple ligands to bind simultaneously to their targets (increasing binding affinity and potentially improving cell specificity). The targeting ligand is coupled to gemcitabine in the loop region via a linker. This allows for the specific delivery of oligonucleotides and gemcitabine conjugates to target cells or tissues, where the conjugates can induce additive, synergistic, or broader therapeutic effects. The ligand can also be added to the GEM loop in the asymmetric chain construct. Figure 7 ).

[0066] A specific example of a CHK1 siRNA molecule containing the GEM motif is shown below. In the absence of GEM, the SS and AS chains anneal to form a CHK1-targeting siRNA. This specific sequence is engineered to be identical between the human and mouse CHK1 gene and, as described below, is more effective at silencing the gene than the CHK1_AZ sequence (see [link to documentation]). Figure 8 and Figure 9 ).

[0067] SS=5'-CCU GUG GAA UAG UA[GEM]UUA[GEM]UG[GEM]AA U-3' ([GEM] replaces "C")

[0068] AS = 5'-A UUG CAG UAA GUA CUA UUC CAC AGG-3' (No GEM on the AS chain)

[0069] In other molecules, the added GEM is linked to the end of the SS:

[0070] SS=5'-CCU GUG GAA UAG UA[GEM]UUA[GEM]UG[GEM]AA U-[GEM][GEM]…[GEM}3'([GEM] replaces "C" and GEM is added at the end of 3')

[0071] AS = 5'-A UUG CAG UAA GUA CUA UUC CAC AGG-3' (No GEM on the AS chain)

[0072] Because gemcitabine is a cytosine analog, it can be used to partially replace the cytosine portion of an RNA oligonucleotide sequence or the deoxycytidine portion of a DNA oligonucleotide. These GEMs will still hybridize with their counterparts on the second strand of the oligonucleotide; that is, the GEM will hybridize with the "G" (guanosine / deoxyguanosine) on the opposite strand. Therefore, siRNA sequences targeting genes that, when silenced, produce inhibition of cell growth and can kill tumor cells can be enhanced by including GEMs that replace one of the sense or antisense strands of the siRNA or miRNA, or even in single-stranded sequences (such as antisense oligonucleotides (ASO)). For example, in the CHK1_AZ sequence of the siRNA silencing the CHK1 gene, replacing two cytosine portions with GEMs enhances the repressive activity of the individual siRNA (see experiments below).

[0073] SS=5'-CCU GUG GAA UAG UA[GEM]UUA[GEM]UG[GEM]AA U-3' ([GEM] replaces "C")

[0074] AS = 5'-A UUG CAG UAA GUA CUA UUC CAC AGG-3' (No GEM on the AS chain)

[0075] GEM additions can also be located at the 3' or 5' end of the sense chain. They can also be added to the AS chain in the same way. An addition can independently contain 1, 2, 3, 4 or more GEM parts.

[0076] Other nucleoside anticancer agents can replace gemcitabine in linking to the oligonucleotide backbone. Such analogues may include cytarabine (ara-C), 5-FU, 5-deoxy-5-fluorouridine, fludarabine, capecitabine, cladribine, trisatatabine or clofarabine, azacytidine, and 5-deoxyazacytidine, to name just a few (see Damaraju, ibid.).

[0077] Many siRNA sequences can be attached to a polynucleotide analog chain on either the sense or antisense strand. Examples of such siRNA sequences are siRNAs that silence genes encoding proteins that act in opposition to the inhibitory mechanisms of nucleoside analogs. For instance, siRNAs can be used to silence enzymes responsible for gemcitabine deamination and inactivation (cytidine deaminases or 5'-nucleotidases) or enzymes responsible for enhancing the release of nucleosides from cells, such as nucleoside transporters (see Damaraju ibid. and references therein).

[0078] Other potential targets for siRNA sequences (linked to nucleoside analogue chains) in these constructs include multidrug resistance (MDR) proteins, such as the P-glycoprotein (P-gp) and multidrug resistance-associated protein-1 (MRP1), encoded by the MDR1 and MRP1 genes, respectively. Expression of these proteins confers a phenotype of resistance to broad-spectrum drugs used in cancer chemotherapy. These transporters are broadly classified as ATP-binding expression cassette proteins (ABC) and constitute a superfamily of proteins. Silencing the MDR1 and MRP1 genes using siRNA has been described. See also And Gündüz, Biomed Pharmacother. 65(2): 85-9 (2011). Other examples of genes that can be silenced include methyltransferases, organic anion and cation transporters (OAT and OCT), oxidoreductase flavoproteins, and nucleoside transporters (NT), all of which are involved in drug transport and metabolism in cells and may confer drug-resistant phenotypes to cancer cells.

[0079] Other gene targets of siRNA are those that have been shown to enhance the effects of gemcitabine or other nucleoside analogs when silenced themselves. Besides CHK1 and RAD17, such gene targets include ATR and WEE1. Since other targets are silenced and have been shown to enhance nucleoside activity, these targets can also have siRNAs targeting them and conjugated with appropriate nucleoside analogs.

[0080] When using the Azorsa sequence, two C atoms can be substituted on both the SS and AS strands. Therefore, we prepared constructs in which only the SS strand was modified by incorporating two substituted C atoms with GEM, and we prepared the AS strand in the same manner. We then annealed the SS strand containing the two GEM atoms with the unmodified AS strand, and we annealed the GEM-modified AS strand with the unmodified SS strand. We further annealed the GEM-modified SS strand with the GEM-modified AS strand. The dose-response of all these constructs was compared with that of siRNA with both strands unmodified and with gemcitabine alone.

[0081] The siRNA sequence (CHK1_AZ) identified by Azorsa et al. is an example of siRNA that can be used to prepare molecules containing the GEM moiety. Using an oligonucleotide synthesizer, the following siRNA chains were fabricated, some containing GEM residues and some not, to replace the native cytosine (“C”) groups present in the sequence.

[0082] C1D-2A–(sequence AUUGAUACAGAUCUCUUUCUU) refers to the antisense (ANTISENSE) strand of CHK1 siRNA, which contains two GEM residues that replace cytosine residues and has dTdT at the 3' end; it anneals with the sense strand (SS) (sequence AAGAAAGAGAUCUGUAUCAAU) that does not contain any GEM.

[0083] C1D-2S – refers to the sense strand of CHK1 siRNA, which contains two GEM residues that replace cytosine and has dTdT at the 3' end; it anneals with the antisense strand (AS) that does not contain any GEM.

[0084] C1D-4 refers to the antisense strand of the CHK1 siRNA containing 2 GEM residues, which anneals to the sense strand (SS) that also contains 2 GEM residues—that is, 4 gems per siRNA. As mentioned above, both strands have dTdT at the 3' end.

[0085] Analogs of this siRNA were synthesized, with 2, 4, or 6 GEMs appended to the 3' end of the SS. Several different siRNAs were also designed, where the C in the sequence could be modified by inserting GEMs at its position. GEMs replacing C were inserted alone or in combination into the sense and antisense strands to explore whether increasing GEM content improved potency or titer. Unmodified CHK1 siRNA, C1D-2A, C1D-2S, and C1D-4 were transfected into the pancreatic cancer cell line BxPC3 (Azorsa, ibid.) which had shown sensitivity to CHK1+Gem. Dosage-response comparisons of gemcitabine alone and transfection with non-silenced siRNAs were performed (as a control).

[0086] Observations showed that adding an extra GEM at the 3' end of the SS (before the usual dTdT terminal group) did not have a greater additive effect than adding two GEMs, and adding four or six did not increase potency or potency. Unbound by theory, it is suspected that intracellular nucleases cannot cleave the polyGEM sequence between GEM moieties, but only cleave the GEM from the unmodified nucleotide preceding it—releasing only one GEM from the polyGEM sequence, regardless of the number of GEMs in the sequence. Therefore, constructs with four or six GEMs at the 3' end of the SS have the same or slightly lower potency than constructs with two GEMs at that position.

[0087] Unmodified siRNA (IC) incubated for the same time 50 Compared to 3nM, inserting GEM to replace C in SS results in a product with improved IC. 50 and performance (IC) 50 =0.38 nM). Adding GEM to the antisense strand to replace C residues may interfere with siRNA loading into the RISC complex or subsequent recognition of homologous mRNAs and cleavage by Dicer. However, by selecting specific CHK1 siRNA sequences, it was found that adding GEM to the AS strand improved potency and efficacy (IC). 50 The valence intensity was 1.8 nM, but not to the extent observed by SS. Furthermore, combining the two chains (now containing a total of four GEMs) did not further increase the valence intensity (1.98 nM), whereas a further increase in valence intensity could be expected if the main contribution came from the release of GEMs from both chains. This IC 50 Similar to the situation where there are only two GEMs in the AS strand. It is well known that during the loading of siRNA into the RISC complex, the two strands are separated, and the sense strand is released into the cytoplasm, where it is degraded. The AS strand is retained in the RISC for a period of time and therefore may not contribute GEMs to the mixture—therefore, all GEMs originate from the SS.

[0088] This was also confirmed in qPCR analysis of silencing induced by various constructs. Figure 4 The results showed that regardless of the number of GEMs on the SS, AS strands, or both strands, equivalent gene silencing by siRNA was achieved.

[0089] When siRNA is processed intracellularly, the antisense strand unwinds from the sense strand and is loaded into the RISC complex, where it monitors the cell's homologous mRNA sequence. When the mRNA is recognized and bound by the antisense strand, it is cleaved by the enzyme DICER, the antisense strand is loaded into the RISC, and the sense strand is released into the cytoplasm and degraded. In a previous publication (Ma et al., 2019), polygemcitabine nanogels composed of 10 gemcitabine repeat sequences were synthesized. These structures self-annealed to form nanogels and then showed enhanced potency in pancreatic tumor cells. Adding repeat sequences of GEM to the ends of the sense strand was expected to produce similar enhancements in gemcitabine delivery while simultaneously delivering siRNA to cells. However, it was found that adding 2, 4, or 6 GEMs to the [3'] ends of the sense strand, followed by annealing with the unmodified antisense strand, did not produce the expected increase in potency. Instead, 2, 4, and 6 GEM sequences showed only the same potency, as if one GEM was released from each sequence. This could be due to the inability of exonucleases or endonucleases to cleave the polyGEM sequence, or it could be due to very slow release and subsequent phosphorylation to activate the gem. The efficacy of each of these structures in cell viability assays showed no improvement with increasing incubation time (from 72 hours to 96 hours).

[0090] siRNA synthesized using GEM

[0091] CHK-Az siRNA is a 19-mer siRNA with a 2-base (dTdT) overhang at the 3' end of each strand. When there are modifications containing gemcitabine moieties in the sense strand, these gemcitabine moieties are inserted between the ends of the sense strand and before the dTdT end groups. The dTdT ends may help stabilize the siRNA sequence to prevent degradation by nucleases, which may in turn affect the rate at which Gem is released from the sense strand during the AS chain's monitoring of homologous mRNA sequences to be cleaved and silenced.

[0092] The fundamental principle of improving CHK1_AZ using GEM compared to 25mer containing GEM.

[0093] Our designed 25-mer siRNA is a blunt-ended siRNA, while the siRNA sequence used by Azorsa is a 19-mer siRNA with a two-base (dTdT) overhang at the 3' end. When two GEM portions were added between the last nucleotide of the siRNA SS and the dTdT overhang, we observed that this sequence showed significantly higher potency in MiaPaca cells than in BxPC3 cells. The inclusion of dTdT at the end of the sequence reduced the rate of GEM release from the SS in this construct as the SS unwinds from the AS strand and is released into the cytoplasm. This may allow the AS sequence to induce gene silencing before GEM is released from the SS, potentially increasing the potency of this combination in MiaPaca cells compared to BxPC3 cells.

[0094] Improving treatment options for pancreatic cancer

[0095] Based on the data provided, it appears we can demonstrate a significant enhancement of gemcitabine's efficacy in pancreatic cancer cells by incorporating it. Incorporating multiple GEMs into the sense strand of siRNA allows for GEM delivery to the same cell where the siRNA exerts its effect. Previous studies (Azorsa, 2009) have shown that silencing CHK1 enhances gemcitabine's efficacy. Therefore, by adding GEMs to siRNA sequences capable of silencing CHK1, we anticipate some additive / synergistic interactions. Using histidine-lysine peptide nanoparticles (PNPs), we have demonstrated the ability to deliver siRNA to many different tumor types in vitro and in vivo. Therefore, we are investigating the delivery of GEM CHK1 siRNA as a novel therapeutic approach for cancer treatment. Furthermore, peptide nanoparticles can simultaneously deliver siRNAs targeting more than one target to the same cell, thus allowing us to silence secondary gene targets that can synergize with the first siRNA. Publications (Paul et al., 2015) have demonstrated a synergistic effect between CHK1 and RAD17 inhibition in pancreatic cancer, thus it is feasible that we can benefit from silencing RAD17 in combination with GEM-CHK1 siRNA. If the amount of gemcitabine delivered by GEM-Chk1 siRNA is insufficient to produce a potent effect in vitro and / or in vivo, then we can further modify the RAD17 SS to introduce GEM to replace the “C” in that sequence.

[0096] Giscitabine Selection

[0097] Gemcitabine activity can be enhanced by inhibiting ribonucleotide reductase and dCMP deaminase.

[0098] Gemcitabine is widely used in combination, primarily with platinum analogs; other combinations are less common or currently under investigation. The standard administration of gemcitabine is a weekly infusion of 1000 mg / m² over 30 minutes, but alternative routes are being explored, such as prodrugs (e.g., CO-1.01, which can bypass transport defects), fixed-dose infusions (10 mg / m² / min), and local administration via 24-hour hepatic artery infusion, intravesical drip, or intraperitoneal administration for the treatment of advanced ovarian cancer. Other alternatives to gemcitabine in ovarian cancer include using triapine or hydroxyurea to increase ribonucleotide reductase inhibition. Gemcitabine's effects on signal transduction also provide a reasonable framework for combination with signal transduction pathways.

[0099] in conclusion

[0100] Gemcitabine, as an amidation compound, can be incorporated into the nucleotide sequence during oligonucleotide synthesis. We have demonstrated that adding GEM to siRNA allows for the co-delivery of siRNA and gemcitabine to the same cell. By selecting siRNAs that target molecular targets, we anticipate enhanced efficacy of gemcitabine in reducing tumor cell viability; we have observed a significant increase in potency not seen when using each agent alone.

[0101] While we chose to use siRNAs targeting CHK1 and RAD17 as examples, gemcitabine can be incorporated into any other oligonucleotide with similar results. Examples of siRNAs enhancing gemcitabine activity have also been described using cMyc as a suitable gene target (Zhang et al., Cancer Metastasis Rev 26: 85–110 (2013)). Therefore, siRNAs targeting cMyc could also be directly incorporated into GEMs and used to treat cancers, such as NSCLC. In fact, oligonucleotides may not need to have a silencing effect at all, but can be used solely for gemcitabine delivery to enhance disease efficacy.

[0102] It is well known that chemically modifying the bases within the oligonucleotide siRNA structure (e.g., 2'-OMe, 2'-fluorine, thiophosphate modification, etc.) can stabilize the oligonucleotide during in vivo administration to protect it from nuclease attack. Feasibly, such chemically modified oligonucleotides can be directly coupled to targeting ligands, thereby enabling direct delivery via binding to receptors on cancer cells.

[0103] In addition, antisense oligonucleotides have been used to alter the expression of selected genes within cells, and these single-stranded oligonucleotides can also be modified via gemimum receptors (GERs). These modifications, either at the end of the sequence (at the C base) or by addition, can help alter hybridization efficiency with specific targets and change co-delivery with gemcitabine.

[0104] Similarly, miRNAs (mimics or inhibitors) with anticancer effects have been described, and these can be modified by inserting gemcitabine into their sequences for do-delivery to the same cells. In particular, miRNAs that can enhance the effects of gemcitabine are of particular interest.

[0105] Finally, aptamers are RNA or DNA oligonucleotides that can be engineered and fabricated to bind with high affinity to selected targets. In some cases, these can be receptors on cells, or receptors that are upregulated, particularly in cancer cells. Gem nucleotides can be appended to or inserted into these sequences (replacing C) to allow high affinity binding to target receptors on the surface of cancer cells, thus allowing the oligonucleotides to be taken up into the cells, where gemcitabine is released to exert its therapeutic effect.

[0106] Gemcitabine-modified oligonucleotides (DNA or RNA) can be used to improve cancer treatment options in a variety of cancer types.

[0107] Gemcitabine can also act as a radiosensitizer (enhancing the efficacy of tumor radiotherapy). Therefore, it is feasible to deliver gemcitabine to specific cancer cells via the aforementioned oligonucleotide modification. Once gemcitabine has been delivered, the tumor is exposed to radiation, which kills the tumor cells. Sometimes, this radiation exposure further generates an immune response against tumor-specific antigens released during the process.

[0108] Therefore, oligonucleotides containing gemcitabine or other non-nucleoside analogs can be a viable treatment for cancer and other diseases, where non-nucleoside (or nucleotide) analogs can be effective. Another example of using non-nucleoside or nucleotide analogs is the treatment of viral diseases. For example, in viral diseases, oligonucleotides containing non-nucleoside (or nucleotide) analogs may be administered co-administered. These can include nucleoside and nucleotide reverse transcriptase inhibitors (NRTIs), such as zidovudine, norinosine, zalcitabine, stavudine, lamivudine, abacavir, emtricitabine, and tenofovir, or non-nucleoside reverse transcriptase inhibitors (NNRTIs), such as nevirapine, deraviridine, efavirenz, and ectrevirine.

[0109] Example

[0110] Example 1

[0111] method

[0112] BxPC3 cells were seeded at 500 cells / well in two 384-well plates. The next day, cells were treated for 72 hours with various concentrations of CID2A, CID2S, CID4 siRNA (prepared with Lipofectamine RNAiMAX), or gemcitabine (0.1–1000 nM). After incubation at 37°C for 72 hours, the number of viable cells was assessed using the CTG2 reagent. Untreated cells were set as 100%.

[0113] siRNA design

[0114] The siRNA targeting the Azorsa chk1 sequence is from the paper (Azorsa, ibid.). This is a 19-mer with 2 dTdT base protrusions at the 3' end of each strand. To examine the ability to silence RAD17 and CHK1 using additional siRNA, a 25-mer blunt-ended siRNA sequence was designed, which is identical between mouse and human genes.

[0115] Validation of siRNA silencing targets (qRTPCR)

[0116] The data showed the relative effectiveness of several siRNAs designed for RAD17 or CHK1 in silencing their respective target genes. These experiments were performed using the siRNAs shown below. The degree of gene target silencing was measured in cells transfected with (50 nM) siRNA, and the degree of gene silencing was measured using qRTPCR (with β-actin as a control housekeeping gene for data normalization).

[0117] result

[0118] Figure 8The pancreatic cancer cell line BxPC3 showed no response to non-silencing siRNA (NS / lipo) administered using Lipofectamine as a delivery agent. However, when CHK1 siRNA (Chk_Az / Lipo) was administered using the same reagent, cell viability decreased to approximately 50% after 72 hours of exposure with increasing dose. siRNA oligonucleotides were prepared in which two cytosine residues in the sense strand of the CHK_Az siRNA sequence were replaced by GEM (2S / lipo), or two cytosine residues in the antisense strand were replaced by GEM (2A / lipo). Annealing the GEM-containing sense strand with the unlabeled antisense strand forms 2S, or annealing the GEM-containing antisense strand with the unlabeled sense strand forms 2A, or annealing the sense strand containing two GEM residues with the antisense strand containing two GEM residues forms compound 4. Silencing activity against the CHK1 gene was observed only in the 2S product among the selected sequences. Gemcitabine-representing activity was observed only in the 2A product. Furthermore, when GEM-SS was annealed with GEM-AS to obtain cpd4, no silencing effect of the siRNA sequence was observed, but a dose-response shift to the left was observed due to the presence of 4 GEMs per siRNA. Figure 8 The graph below the figure shows the data present in the table. The table represents the percentage of viable cells present at each treatment at the concentration (nM) shown in the top row of the table.

[0119] The results of this study confirm that adding GEM to the SS of siRNA enhances the activity of siRNA silencing in killing tumor cells, particularly the pancreatic tumor line BxPC3. See [link to study]. Figure 8 .

[0120] Non-silencing siRNA (NS) had no effect on cell viability during a 72-hour incubation period. Gemcitabine exposure (without Lipofectamine-gem) showed a dose-dependent reduction in cell viability (IC50 of approximately 7 nM). Unmodified CHK1 siRNA (Chk-Az) showed a dose-dependent effect of up to 0.1 nM, but this effect subsequently plateaued at a maximum inhibition of 50% of cell viability.

[0121] Effect of internal GEM on CHK1 siRNA efficacy

[0122] If the AS strand contains two GEMs (2A), the dose-response curve looks very similar to that of GEM alone. If the SS strand contains two GEMs (2S), the initial portion of the dose-response curve looks more like the silencing effect produced by CHK1 siRNA (0–0.1 nM). However, unlike the CHK1 siRNA effect which plateaus at 50% cell viability, 2S continues to inhibit cell viability at concentrations above 1 nM, reaching its maximum at 50 nM with a cell viability of 14%. This effect looks more like the response seen when GEM is used alone (maximum at the same concentration (50 nM) with a cell viability of 26%). Annealing of both strands (each containing two GEMs) provides four GEMs per siRNA molecule (C1D-4). Compared to 2A, the dose-response curve shifts to the left (reflecting the increased potency from the increased GEMs). However, no initial decrease in cell viability was observed compared to CHK1 siRNA alone, but the curve was parallel to that of GEM alone, indicating that the only effect of introducing twice the GEM for each siRNA was to achieve this.

[0123] siRNA sequences with inhibitory potency against pancreatic tumor cells were screened and identified.

[0124] Figure 9 The pancreatic cancer cell line viability is shown to be sensitive to transfection with eight siRNA sequences designed to target CHK1. The percentage of viable cells 72 hours after transfection with the siRNA sequences is shown (top panel - BxPC3 cells; bottom panel - CFPAC cells). 100% viability is defined as viability in the presence of a non-silencing control siRNA (NS). CHK1_AZ (AZ) was tested as a control. CD = cell death siRNA—known to produce maximum killing effect against many cell types when transfected into cells.

[0125] The Chk4 sequence provided the strongest effect in BxPC3 cells. When the Chk4 sequence was transfected into another pancreatic cancer cell line, CFPAC, it also had a very significant effect on cell viability.

[0126] The test sequence is:

[0127] 1.GGGAGAAGGTGCCTATGGAGAAGTT

[0128] 2.GGAGAAGTTCAACTTGCTGTGAATA

[0129] 3.CCAGTTGATGTTTGGTCCTGTGGAA

[0130] 4.CCTGTGGAATAGTACTTACTGCAAT

[0131] 5.GGAATAACTCACAGGGATA

[0132] 6.GGGATATTAAACCAGAAAA

[0133] 7.GCAGAACCAGTTGATGTTT

[0134] 8.GGAATAGTACTTACTGCAA

[0135] Chk4 exhibited greater potency in BxPC3 cells than CHK-AZ (CHK1 siRNA sequence from the Azorsa paper). Furthermore, compared to the two cytosines in CHK1_AZ, this sequence can have three cytosines replaced by GEM. Compared to the modified CHK1_AZ, it delivers more GEM per molecule, providing the potential for greater potency in silencing the CHK1 gene, further enhancing this activity and improving potency and efficacy.

[0136] These data indicate that:

[0137] 1. Placing two GEMs on the SS of CHK1 siRNA improves efficacy compared to siRNA alone.

[0138] 2. Placing two GEMs on the AS strand—we did not see the effect of siRNA silencing, but we did see the effect of GEMs on cell viability.

[0139] 3. Annealing the AS and SS (each containing 2 GEMs) resulted in each molecule with 4 GEMs. However, as with #2, the 2 GEMs on the AS strand prevented the AS strand from producing a gene silencing effect; we only saw an increased titer intensity due to the delivery of 4 GEMs per siRNA.

[0140] 4. Adding a dTdT moiety to the 3' end of each strand can slow down the release of GEM, thus allowing for differentiation between the effect and the gene silencing effect.

[0141] 5. If GEMs in the AS strand disrupt the AS strand's ability to bind to the RISC complex and induce target gene silencing, they can inhibit the efficacy of siRNA. However, GEMs at the 3' end of the AS strand have been shown to exhibit additive activity with AS strand-induced silencing. One or two GEMs can be added for this additive activity. Additional GEMs may also be added.

[0142] 6. GEM on SS enhances efficacy by exhibiting siRNA-mediated silencing combined with the inhibitory effect of GEM on cell viability.

[0143] Combining the SS strand with 2×GEM and the AS strand with 2×GEM produces better efficacy due to having 4 GEMs, but does not have the silencing effect of siRNA on the target gene.

[0144] The improved CHK1 siRNA (CHK_DE4) showed better silencing compared to the Azorsa sequence in previous studies.

[0145] The test sequences are as follows: (These represent sense sequences) CHK_X

[0146]

[0147] The sequence #4, CCTGTGGAATAGTACTTACTGCAAT, appears to be optimal.

[0148] Therefore, SS =

[0149] SS=5'-CCU GUG GAA UAG UA[GEM]UUA[GEM]UG[GEM]AA U-3' ([GEM] replaces "C")

[0150] AS = 5'-A UUG CAG UAA GUA CUA UUC CAC AGG-3' (No GEM on the AS chain)

[0151] Prepare AS with all base modifications. Prepare SS with all modifications (2'-O-Me) and prepare unmodified SS as a comparison.

[0152] Other target sequences:

[0153] CHK1A: Target sequence: CHK1-A: AAGAAAGAGAUCUGUAUCAAU; 2 GEM sequences replace "C".

[0154] CHK1B: Target sequence: Chk1-B: UUGGAAUAACUCCACGGGAUA. GEMs are placed in 4 locations within this sequence.

[0155] We expect CHK1-B_AZ with 4 GEMs in SS (CHK1-B_AZ WITH 4GEM SS) to show better activity than CHK1A with 2 GEMs.

[0156] Gemcitabine is used to treat a variety of cancers, including bladder cancer, pancreatic cancer, ovarian cancer, breast cancer, and non-small cell lung cancer. These other cancer types can be treated using the methods described herein, optionally with the addition of additional siRNA molecules to enhance activity.

[0157] Example 2

[0158] Pancreatic cancer BxPC3 cells were seeded at 1000 cells / ml in 384-well plates and grown as a monolayer. Cells were transfected with siRNA targeting CHK1 or Rad17 using Lipofectamine (ThermoFisher), or treated with gemcitabine at the concentration shown on the X-axis. After incubation at 37°C and 5% CO2 for 96 hours, cell viability was determined using a Cell Titer Glo (Perkin Elmer) microplate reader, monitoring the luminescence signal generated by the reagents using a Perkin Elmer Envision microplate reader equipped with ultrasensitive luminescence detection optics. The figures show that gemcitabine (GEM) produced a dose-dependent inhibition of cell viability, with an IC50 of approximately 6 nM and a maximum efficacy of >80% cell killing. A 25-mer blunt-terminated siRNA targeting RAD17 produced a dose-dependent inhibition of cell viability, with a maximum efficacy of only 60% reduction in cell viability and an IC50 of approximately 5 nM. Using the previously published 19-mer siRNA sequence targeting CHK1 (from Azorsa, ibid.), we observed that its maximum potency in cell viability was similar to that of Rad17 siRNA. The blunt-terminated 25-mer siRNA targeting CHK1 showed greater potency than the Azorsa CHK1 siRNA sequence, inhibiting approximately 90% of cell viability at 100 nM. The IC50 of the latter siRNA was similar to that of the Azorsa sequence (approximately 0.3 nM). Figure 11 The results show that siRNA targeting CHK1 and RAD17 alone can inhibit the viability of pancreatic cancer cells.

[0159] Example 3

[0160] Synthesize siRNA, wherein a gemcitabine nucleotide amidate is added to the 3' end of each sense strand of the siRNA sequence shown. Transfect the siRNA into cells and proceed as follows: Figure 1The incubation process was detailed. The maximum potency of all sequences was now increased to >95% inhibition of cell viability at concentrations above 10 nM. At very low concentrations (0.1 nM), gemcitabine-modified RAD17 siRNA itself had no effect on cell viability, while gemcitabine-modified CHK1 siRNA at the same concentration produced 31% (25 mere) or 56% (19 mere) inhibition of cell viability. Gemcitabine nucleotides were examined to see if they could replace cytosine nucleotides in the siRNA sequence. The AZ CHk1 sequence has two GEM-substituted "C" groups, and we can see that this siRNA (CHK1-AZ-2S) behaves almost identically to the siRNA (CHK-AZ-Poly2) with two GEMs at the 3' end. Figures 12a to 12d The effect of adding two gemcitabine nucleotides to the 3' end of the sense strand of each siRNA on titer strength and potency was shown.

[0161] Example 4

[0162] BxPC3 cells were transfected with siRNA constructs at 1000 cells / well in 384-well plates, or BxPC3 cells were exposed to gemcitabine at concentrations shown in the figure. Test samples were gemcitabine alone (GEM), unmodified 19mer siRNA targeting CHK1 (CHK-AZ), and siRNAs of the same sequence but with 2 (poly-2), 4 (poly-4), or 6 (poly-6) gemcitabine nucleotides added to the 3' end of the sense strand before annealing with the same antisense strand. Cell viability was determined 120 hours after exposure to the various reagents by adding CellTiter Glo (PE), shaking the plate for 10–20 minutes, and then measuring the luminescent signal associated with cell viability in a PE Envision microplate reader. Figure 13 The effect of adding an additional GEM at the 3' end of the sense chain on efficacy and valence intensity is shown.

[0163] Therefore, it can be inferred that since adding two GEM nucleotides to the SS of siRNA can achieve this improvement in efficacy against pancreatic cancer cells, adding additional GEM will further enhance the efficacy and / or potency of siRNA. To this end, unmodified 19mer siRNA (CHK-AZ) was compared with the same sequence having two GEM nucleotides added to the 3' end of SS (poly-2), four GEM nucleotides added (poly-4), or six GEM nucleotides added (poly-6). These sequences were compared with those using gemcitabine (GEM) alone. This experiment was performed by transfecting siRNA into BxPC3 cells (e.g., Figure 1(As shown), however, the exposure time before measuring cell viability was 120 hours. Due to the longer incubation time, the dose-response of siRNA could be explored at much lower concentrations. This enabled the determination of the true IC50. 50 Value. GEM itself produced a complete dose response in this cell line and generated an IC50 of 3 nM during this incubation time. 50 Cell viability decreased by 100% at concentrations above 50 nM. The IC50 of unmodified 19mer siRNA (CHK-AZ) was... 50 The concentration was 0.16 nM. However, even with this prolonged exposure time, the maximum potency was only about 70% inhibition of cell viability. Adding 2, 4, or 6 GEMs to the 3' end of the siRNA increased the maximum potency of the product, resulting in cell viability below 10% at concentrations above 10 nM. However, the expected increase in siRNA potency with more GEMs did not materialize; sequences with 2 GEMs were more effective than constructs with 4 or 6 GEMs. The IC50 of the 2 GEM construct was... 50 (0.026 nM) was 115-fold higher than gemcitabine alone (3 nM). These data indicate that having more than two GEMs at the 3' end of the SS of siRNA does not have an additional effect on the potency or potency of the construct in cell viability assays.

[0164] Example 4

[0165] BxPC3 cells (2.5 × 10⁻⁶ cells) were transfected with different variants of Chk1 / Gem siRNA (50 nM). 5 (Cells / wells of a 12-well plate). Relative levels of Chk1 RNA were determined by Sybr Green RT-PCR 24 hours after transfection. B-actin expression levels were used for normalization. mRNA levels in all samples were calculated relative to mRNA levels in untreated cells using the ΔΔCt method.

[0166] 2AGem / Chk – Two gemcitabines replace the C on the antisense strand of the CHK1 siRNA.

[0167] 2AGem / NS – Two gemcitabine molecules replace the C-terminal on the antisense strand of the non-silencing siRNA.

[0168] 2SGem / Chk – Two gemcitabines replace the C on the sense strand of the CHK1 siRNA.

[0169] 2SGem / NS – Two gemcitabine molecules replace the C-terminus on the sense strand of the non-silencing siRNA.

[0170] 4Gem / CHK – Two gemcitabine molecules replace the C on the sense strand of CHK1 siRNA, and two gemcitabine molecules replace the C on the antisense strand of CHK1 siRNA.

[0171] 4Gem / NS – Two gemcitabines replace the C on the sense strand of the non-silencing siRNA, and two gemcitabines replace the C on the antisense strand of the non-silencing siRNA.

[0172] Blnk – Untreated sample

[0173] Chk_Az(a) – Unmodified CHK1 siRNA

[0174] NC-non-silencing siRNA alone.

[0175] Figure 14 The effects of gemcitabine insertion into the sense / antisense strand and its effect on gene silencing were shown (qPCR results).

[0176] Example 5

[0177] The results observed with GEM-modified siRNA in BxPC3 cells depend on the duration of exposure to these reagents. Figure 15The time-dependent efficacy of siRNA and siRNA-GEM constructs in cell viability was shown. Cell viability was examined at 48 hours (left panel), 72 hours (middle panel), and 120 hours (right panel) after exposure to different concentrations of the compound. It can be seen that at each time point, at the highest concentration (100 nM), unlabeled siRNA (CHK-Az) showed a weaker effect than GEM-modified siRNAs (poly-2, poly-4, or poly-6 – containing 2, 4, or 6 gemcitabine moieties at the 3' end). siRNAs containing 2 GEMs (poly-2) did not show a significant difference in potency or efficacy compared to siRNAs containing 4 (poly-4) or 6 (poly-6) GEMs; the cytotoxicity of each polyGEM construct increased with increasing exposure time (from approximately 40% at 48 hours, to approximately 70% at 72 hours, and 100% at 120 hours). This data suggests that each siRNA entering the cell releases only 1 or 2 gemcitabine molecules. Furthermore, the time dependence may reflect the time required to achieve potent gene silencing to enhance the effect of GEM itself, or it may indicate that the process required to activate the released GEM also takes time. This is the time required for the release of the gemcitabine moiety, followed by the time required for the triphosphorylation of the nucleotide to produce the active moiety, which can block the replication fork by incorporating a nuclease-stabilized GEM nucleotide into the extended sequence. It can also depend on the cell cycle and division (replication) time for a specific cell type—for BxPC3, this is approximately 48 to 60 hours, so at 120 hours we will experience 2 to 3 division cycles, while at 72 hours we will experience only 1 division cycle.

[0178] Example 6

[0179] We further determined whether GEM nucleotides could be used to replace cytosine nucleotides within the siRNA in the antisense (AS) strand. To investigate this, we again used the 19-mer siRNA sequence targeting CHK1 from Azorsa et al. See [link to siRNA sequence]. Figure 16 :

[0180] 2A-CHK1 refers to the C12C1 in the AS strand of the siRNA that silences CHK1, where two GEM molecules replace the C12C1 molecules.

[0181] 2A / NS refers to two GEMs replacing the C in the non-silenced (NS) siRNA sequence.

[0182] 2S / Chk1 refers to the substitution of C in the sense strand of the siRNA targeting CHK1 by two GEM molecules.

[0183] 2S / NS refers to the substitution of the C in the sense strand of a non-silent (NS) siRNA by two GEMs.

[0184] CID4 / Chk1 refers to CHK1 siRNA, where the SS and AS strands each contain 2 GEMs, making a single siRNA have 4 present GEMs.

[0185] CID4 / NS refers to non-silenced (NS) siRNA, where the SS and AS strands each contain 2 GEMs, so that the annealed single siRNA has 4 present GEMs.

[0186] Each of these constructs was transfected into BxPC3 cells in 384-well plates at a density of 1000 cells per well. Subsequently, the cells were incubated at 37°C for 120 hours at 5% CO2 and 95% humidity after transfection, and cell viability was then measured using CellTiter Glo (PE) as previously described.

[0187] This experiment demonstrates that incorporating two GEMs into the SS (2S / Chk1) siRNA targeting CHK1 produces a combined effect of silencing the gene and releasing gemcitabine intracellularly—resulting in movement at IC50 (0.35 nM) while maintaining full potency. In contrast, incorporating two GEMs into the SS of non-silencing (NS) siRNA did not yield the benefit of CHK1 silencing in synergistic effect with GEM release; we only observed a significant effect of GEM release on IC50 (5.4 nM). Therefore, adding just two GEMs to the Chk1 siRNA resulted in an approximately 15-fold improvement compared to the SS of NS siRNA with two GEMs.

[0188] Adding two GEMs to the AS strand of CHK1 and NS siRNAs resulted in a decrease in CHK1-GEMIC50 (2A-Chk1) to 1.975 nM, compared to 6.68 nM for NS siRNA (2A / Ns). This indicates that GEMs in the AS sequence of CHK1 still produce some potency compared to NS-GEMs, but the difference is only 3-fold, and the insertion of GEMs in the AS strand of CHK1 leads to an approximately 6-fold reduction in potency compared to the insertion of two GEMs in the SS strand. This suggests that GEMs in the AS strand interfere with the silencing ability of the AS strand—therefore we did not obtain the enhancement induced by silencing the CHK1 gene. The IC50 of the combination of siRNA strands with two GEMs incorporated in both the CHK1 AS and SS strands (CID4 / Chk1; 1.8 nM) is very close to the IC50 of siRNA with only two GEMs incorporated in the AS strand (2A-Chk1; 1.98 nM). This indicates that adding 4 Gem is almost pointless, and the potency we observed is the same as when we had 2 Gem in the SS. This is consistent with the expectation that the AS strand remains intact in the RISC complex for gene silencing (but the Gem on that strand prevents effective silencing), while the 2 Gem on the sense strand (i.e., when the AS is incorporated into the RISC, the sense strand unwinds from the AS strand and is then cleaved by nucleases in the cytoplasm) are released and contribute to the observed maximum activity. This is even consistent for NS siRNA, as 2S / NSIC50 (5.4 nM) is very similar to CID4 / NSIC50 (5.19 nM).

[0189] The curves for 2S / NS, 2A / NS, and CID4 / NS all overlapped and had much lower IC50 values ​​than those for CHK1 silencing. The former siRNAs do not have gene silencing effects; therefore, their effects are solely due to the release of the two GEMs present on the SS during cleavage—providing a dose-response comparable to gemcitabine alone. 50 Values ​​and effects (see) Figure 13 and Figure 14 ). Figure 16 The effect of including GEM, which replaces C, in the AS chain is shown.

[0190] Example 7.

[0191] Table 1: Structure of polyGEMChk1-AzsiRNA sequence

[0192] The table below shows the sense strand sequences of the polyGEM constructs used with Azorsa 19mer siRNA. Two, four, or six GEM nucleotides are inserted before the dTdT 2-base overhang at the 3' end of the siRNA's SS. Upon synthesis, due to the release of two GEMs, the purity of each oligonucleotide was individually assessed by HPLC, and we observed a purity of 75–82% for each of the three oligonucleotides (right column). Each of these sequences (or the same SS without any added GEM) was then annealed with the corresponding base-matched AS strand to form the siRNA duplex. The concentration of each duplex was determined by A260 / A280 measurements and is shown in column 3.

[0193]

[0194] Table 2. Potency and titer of the sense and antisense sequences of the tested siRNAs

[0195]

[0196] The sequences described above were used for annealing to generate double-stranded 25-mer blunt-ended siRNAs. Sequence 1 is a 25-mer blunt-ended siRNA with no GEM incorporated into the SS sequence. Sequence 2 has two GEMs attached to the 3' end of the sense strand, and is then annealed to the same AS strand as in sequence #1. Sequences 5 and 6 are the same AS strand, but the first two bases of the SS are removed to shorten the sequence (this was to attempt to force the use of a different strand as the AS strand). The difference between sequences 5 and 6 is that sequence 6 does not contain a GEM that replaces the cytosine group at position 13 of seq5 (or position 15 in the original SS sequence). The principle behind this process of elimination is to determine whether inserting a GEM at this position would block SS cleavage, which might be necessary for loading the AS strand into the RISC complex during the silencing process. Sequence 7 is identical to sequence 6, but includes two GEMs replacing the two cytosines present at the 5' end of the sense strand (to see if adding more GEM to each siRNA would increase the potency or potency of the final construct). Sequence 3 is an unlabeled 25mer blunt-ended siRNA targeting RAD17, while sequence 4 is the same siRNA, but with two additional GEMs linked to the 3' end of SS.

[0197] The efficacy and titer of the siRNA sequences shown in Table 2 against BxPC3 pancreatic cancer cell viability were tested after 120 hours of exposure. The figure above shows the effect of gemcitabine (GEM) alone on the measured BxPC3 cell viability after 120 hours of exposure. The IC50 was approximately 5 nM, but the maximum efficacy was only about 85% inhibition of cell viability (even at 100 nM).

[0198] Unmodified siRNA targeting RAD17 (SL-P49-3) showed a dose-dependent decrease in cell viability, with an IC50 of approximately 4 nM and a maximum potency of only 60% inhibition of cell viability. When this siRNA had two gemcitabine moieties added to the 3' end of the sense strand, we observed a significant increase in potency (100% cell killing at 30 nM) without any change in titer (IC50 of approximately 4 nM).

[0199] The 25-mer blunt-terminated siRNA sequence has been shown to be highly effective in killing cells without the use of GEM modification (SL-P49-1; 90% efficacy at IC50 of 0.25 nM and 100 nM).

[0200] Similar to RAD17, adding two GEMs to the 3' end of SS produces a product (SL-P49-2) with a similar IC50 value but higher efficacy (approximately 100% inhibition at 30 nM).

[0201] Figure 17 The effects of the location and amount of GEM in the SS of siRNA on the potency and potency of siRNA / Gem combination were shown.

[0202] Shortening the 5' end of either the CHk1 siRNA containing 2 Gem (SL-P49-6) or the CHk1 siRNA containing 3 Gem (SL-P49-5) produces the same effect (IC50 of approximately 3 nM; maximum potency of 83–97% at 30 nM). This indicates a moderate silencing effect enhanced by releasing a single GEM from either siRNA.

[0203] Compared to a sequence containing only 2 GEMs (SL-49P-2), the same SS sequence (SL-P49-7) containing 4 substituted C GEMs gave similar IC50 and potency values. This result indicates that this siRNA antisense strand sequence provides the maximum amount of gene silencing, but the GEMs released from SS sequences containing 2 or 4 GEMs produced the same potency increase—meaning that releasing 4 GEMs does not improve potency compared to releasing 2, so this must be a saturation effect of the GEMs. When each molecule has more than one GEM, it is possible that the GEMs are not further cleaved to produce an additive effect. We suggest that when a second GEM is directly attached to another GEM in the same order (e.g., in SL-P49-2 in Table 2 and the above figure), the exonuclease may not be able to cleave and release it. However, even when we separated the GEMs by nuclease-sensitive nucleotides (e.g., in SL-49P-5 or SL-49P-7), we did not see any further improvement in potency or potency. The results indicate that only one Gem can provide the desired effect. This could be due to the time required for the release of SS from the AS chain during siRNA RISC loading, which degrades in the cytoplasm and releases GEM, which then needs phosphorylation to insert into the DNA replication fork structure. Alternatively, the amount of GEM released may be related to the cell replication cycle, thus limiting the rate at which GEM is incorporated into the replication fork.

[0204] Example 8

[0205] Gemcitabine or the same unmodified siRNA used for BxPC3 cells and exposure time (96 hours) were used. Figure 1 In our study, we investigated the effects on another pancreatic cancer cell line, MiaPaca-2. Similar to BxPC3 cells, gemcitabine alone produced a dose-dependent decrease in cell viability, with similar IC50 values ​​and maximal efficacy. While both the 19-mer siRNA (CHK-Az) and the 25-mer blunt-terminated siRNA designed for CHK1 showed similar efficacy (maximum inhibition of approximately 80%), this was significantly greater than the 60% inhibition observed in BxPC3 cells against the 19-mer, but similar to that observed in the 25-mer in these cells. However, when RAD17 siRNA was used alone against MiaPaca cells (maximum inhibition of only approximately 30%), it showed a significantly reduced efficacy compared to BxPC3 cells (maximum inhibition of approximately 60%). Figure 18 This demonstrates the role of the construct in another pancreatic tumor cell line—MiaPaca.

[0206] Example 9

[0207] In MiaPaca cells, both unmodified siRNAs (Chk1_de (a 25-mer blunt-ended sequence) or Chk-Az (a 19-mer with two dTdT protrusions)) exhibited similar 80% inhibitory maximal efficacy. Adding two GEMs to the CHK1-Az sequence (either at the 3' end of the SS (Chk-az-poly2) or by substituting the C within the SS (Chk1-AZ-2S)) resulted in a significant increase in siRNA efficacy against MiaPaca cells (maximum inhibition of approximately 100% at 10 nM). The same was true for adding two GEMs to the 3' end of the SS of the 25-mer siRNA (Chkde_2Gem), which also resulted in approximately 100% maximal efficacy for MiaPaca cells at 10 nM. While the unmodified 25-mer siRNA targeting RAD17 showed almost no potency in MiaPaca cell viability (at most approximately 25%), the addition of two GEMs to the 3' end of the SS of the siRNA significantly improved the potency of the construct (93% inhibition at 30 nM). All modified siRNAs now exhibited potency exceeding that achievable with gemcitabine alone (90% maximum inhibition at 100 nM). Figure 19 The effects of GEM-modified siRNA on MiaPaca cells were shown.

[0208] Although the invention has been described in conjunction with certain embodiments thereof, and many details have been set forth for illustrative purposes, it will be apparent to those skilled in the art that the invention may have other embodiments, and that some details described herein may be changed without departing from the basic principles of the invention.

Claims

1. An oligonucleotide, characterized in that, The oligonucleotide comprises siRNA that targets and silences CHK1 and gemcitabine, and the sequence of the oligonucleotide is as follows: Significant chain: 5'-AAGAAAGAGAU[GEM]UGUAU[GEM]AAU-dTdT-3' Antonym: 5'-AUUGAUACAGAUCUCUUUCUU-dTdT-3', or, Significant chain: 5'-CCUGUGGAAUAGUA[GEM]UUA[GEM]UG[GEM]AAU-3' Antonym: 5'-AUUGCAGUAAGUACUAUUCCACAGG-3', or, Significant chain: 5'-AAGAAAGAGAUCUGUAUCAAU[GEM][GEM]-dTdT-3' Antonym chain: 5'-AUUGAUACAGAUCUCUUUCUU-dTdT-3'.

2. The oligonucleotide according to claim 1, characterized in that, Some or all of the nucleotides of the siRNA contain chemical modifications.

3. The oligonucleotide according to claim 2, wherein the chemical modification is a 2'-O-methyl, 2'-fluoro, or thiophosphate analog.

4. An oligonucleotide composition, characterized in that, The oligonucleotide composition comprises the oligonucleotide of any one of claims 1 to 3 and siRNA targeting RAD7.

5. The oligonucleotide composition according to claim 4, characterized in that, The cytosine in the sense strand of the RAD7-targeting siRNA is replaced by gemcitabine, or one or two gemcitabine molecules are attached to the 3' end of the sense strand of the RAD7-targeting siRNA.

6. The oligonucleotide composition according to claim 4, characterized in that, The sequence of the siRNA targeting RAD7 is as follows: Significant chain: 5'-CCAACAAUUAUGAUGAAAUUUCUUA-3' Antonym chain: 5'-UAAGAAAUUUCAUCAUAAUUGUUGG-3'.

7. The oligonucleotide composition according to claim 5, characterized in that, The sequence of the siRNA targeting RAD7 is as follows: Significant chain: 5'-CCAA[GEM]AAUUAUGAUGAAAUUU[GEM]UUA-3' Antonym chain: 5'-UAAGAAAUUUCAUCAUAAUUGUUGG-3'.

8. The oligonucleotide according to any one of claims 1 to 3 or the oligonucleotide composition according to any one of claims 4 to 7, characterized in that, The oligonucleotide or the oligonucleotide composition further comprises a targeting ligand linked to the siRNA, the targeting ligand being able to target and deliver the siRNA to a specific receptor.

9. The oligonucleotide or oligonucleotide composition according to claim 8, characterized in that, The targeting ligands are selected from small molecules, proteins, aptamers, and carbohydrates.

10. The oligonucleotide or oligonucleotide composition according to claim 9, characterized in that, The carbohydrates contain GalNac.

11. The oligonucleotide or oligonucleotide composition according to claim 8, characterized in that, The targeting ligand contains a peptide that targets a specific receptor that is upregulated on tumor cells.

12. The oligonucleotide or oligonucleotide composition according to claim 8, characterized in that, The receptor includes an integrase receptor.

13. The oligonucleotide or oligonucleotide composition according to claim 12, characterized in that, The integrative protein receptor comprises α5β3 or α5β6, and the targeting ligand exhibits different affinities between the two receptors.

14. The oligonucleotide or oligonucleotide composition according to claim 13, characterized in that, The targeting ligand is derived from foot-and-mouth disease virus binding peptide.

15. The oligonucleotide or oligonucleotide composition according to claim 14, characterized in that, The targeting ligand contains 10 to 20 amino acids of the FMDV20 peptide sequence.

16. The oligonucleotide or oligonucleotide composition according to claim 15, characterized in that, The FMDV20 peptide sequence is modified at the first and last positions to include D-amino acids, and the modified peptide sequence is: {D-ASN}AVPNLRGDLQVLAQKVAR{D-THR}.

17. The oligonucleotide or oligonucleotide composition according to claim 16, characterized in that, The modified peptide was PEGylated, and the PEGylated sequence was: PEG-{D-ASN}AVPNLRGDLQVLAQKVAR{D-THR}.

18. A composition, characterized in that, It comprises an oligonucleotide according to any one of claims 1 to 3 or an oligonucleotide composition according to any one of claims 4 to 7 and a pharmaceutically acceptable carrier.

19. The composition according to claim 18, characterized in that, The pharmaceutically acceptable carrier comprises water and one or more of the following salts or buffers: anhydrous potassium dihydrogen phosphate (NF), sodium chloride (USP), disodium hydrogen phosphate heptahydrate (USP), and phosphate-buffered saline.

20. The composition according to claim 19, characterized in that, The pharmaceutically acceptable carrier comprises one or more components selected from biodegradable histidine-lysine polymers and biodegradable polyesters.

21. The composition according to claim 19, characterized in that, The pharmaceutically acceptable carriers include poly(lactic acid), poly(glycolic acid), poly(lactic acid-co-glycolic acid), polyamide amine dendrimers, cationic lipids, polyethylene glycolated PEI, and lipids.

22. The composition according to claim 21, characterized in that, The pharmaceutically acceptable carriers include DOTAP, DOPE, DC-Chol / DOPE, DOTMA, DOTMA / DOPE, or Lipofectamine.

23. The composition according to claim 21, characterized in that, The pharmaceutically acceptable carrier comprises a histidine-lysine copolymer.

24. The composition according to claim 23, characterized in that, The histidine-lysine copolymer comprises the structure (R)K(R)-K(R)-(R)K(X), where R = KHHHKHHHKHHHKHHHK, K = lysine, and H = histidine.

25. The composition according to claim 23, characterized in that, The pharmaceutically acceptable carrier comprises a branched histidine-lysine copolymer.

26. The composition according to claim 25, characterized in that, The branched histidine-lysine polymer has the formula (R)K(R)-K(R)-(R)K(X), where R = KHHHKHHHKHHHKHHHK or R = KHHHKHHHNHHHNHHN, X = C(O)NH2, K = lysine, H = histidine, and N = asparagine.

27. The composition according to claim 18, characterized in that, The pharmaceutically acceptable carrier comprises liposomes containing spermine-liposome conjugates and cholesterol.

28. The composition according to claim 18, characterized in that, The pharmaceutically acceptable carrier comprises a peptide having the following formula: Kp{[(H)n(K)m]}y or Kp{[(H)n(K)m]}yCxZ or Kp{[(H)a(K)m(H)b(K)m(H)c(K)m(H)d(K)m]}y or Kp{[(H)a(K)m(H)b(K)m(H)c(K)m(H)d(K)m]}yCxZ, where K is lysine, H is histidine, C is cysteine, x is a linker, Z is a ligand targeting mammalian cells, p is 0 or 1, n is an integer from 1 to 5, m is an integer from 0 to 3, a, b, c and d are 3 or 4 and y is an integer from 3 to 10.

29. The composition according to any one of claims 18 to 28, characterized in that, The composition contains nanoparticles.

Citation Information

Patent Citations

  • Method and medicament for inhibiting the expression of a defined gene

    EP1214945A2

  • Inhibiting gene expression with dsrna

    EP1230375A1

  • Oligoribonucleotides for cleaving RNA

    US5898031A

  • Oligoribonucleotides and ribonucleases for cleaving RNA

    US6107094A

  • Genetic inhibition by double-stranded RNA

    US6506559B1