Effects of 4-HIL in promoting hair follicle health and inhibiting androgenetic alopecia and scurf generation and application of 4-HIL

Abstract

The invention discloses an effect of 4-HIL in promoting hair follicle health and inhibiting androgenetic alopecia and scurf generation and application of the 4-HIL, and belongs to the technical field of application of non-protein amino acid. It is found for the first time that 4-HIL has the effects of promoting hair follicle proliferation, reducing hair follicle apoptosis and increasing the number and the total number of hair follicles in the growing period; the growth speed of androgen alopecia scalp hair is promoted, and the hair length and the hair weight are improved; the 4-HIL has the effect of inhibiting keratinocyte apoptosis caused by malassezia, and the 4-HIL can be used for preparing medicaments and / or hair washing and caring products for inhibiting androgenetic alopecia, inhibiting dandruff generation and maintaining a stratum corneum protection function. The traditional Chinese medicine composition is good in effect, high in safety, good in biological activity, wide in application range and low in price, and has a huge application prospect when being used for preparing products for promoting hair follicle health and inhibiting androgenetic alopecia and scurf generation.

Description

Technical Field

[0001] The invention relates to the technical field of application of non-protein amino acids, and in particular to the role of 4-HIL in promoting hair follicle health and inhibiting androgenic alopecia and dandruff generation and its application. Background Art

[0002] In the context of increasing competition in modern society, national health is troubled by many factors, among which hair loss is one of the primary daily concerns of the domestic people. Nearly 90% of hair loss types in my country belong to androgenic alopecia, of which the prevalence rate in men is about 21.3%, and its incidence rate increases with age. The prevalence rate in women is about 6.0%, which is a progressive hair follicle miniaturization hair loss disease that starts in adolescence or late adolescence. Androgenic alopecia is mainly manifested by a layer of oily secretions covering the hair loss area on the head, redness of the scalp, and even dermatitis in severe cases. There is often white dandruff at the root of the hair, and the hair follicles are miniaturized. Hair loss starts from the top of the head or forehead, gradually spreads to the surrounding area, and eventually all the hair on the head falls out.

[0003] The healthy growth of hair is closely related to a healthy hair follicle environment. The human hair follicle is a tiny and complex organ, which consists of the hair shaft, inner root sheath, outer root sheath and pedicle tissue from the inside to the outside. The hair follicle is located in the epidermis and dermis of the human skin. The hair follicle is divided into the upper part (sebaceous glands, follicle bulge, follicle pore) and the lower part (follicle handle and hair bulb) by the arrector pili muscle. The hair bulb includes hair matrix cells and hair papilla cells. Among them, the surface of sebaceous gland cells and hair papilla cells is rich in androgen receptors.

[0004] The human hair cycle is generally divided into the growth phase, the regression phase, and the resting phase. The growth phase is usually 2-6 years. During this period, the hair matrix cells at the base of the hair follicles continue to divide to form new hair; the regression phase usually lasts for several weeks. During this period, the hair follicles begin to degenerate, the hair stops growing, the proliferation of hair matrix cells decreases, and the hair follicles shrink; the resting phase lasts for several months. The hair is in a dormant state. The old hair will fall off during this period, and new hair will enter the growth phase after the resting phase ends.

[0005] The causes of androgenic alopecia are relatively complex and the mechanism is not fully understood. Modern medical research also calls it seborrheic alopecia. It is believed that a Western diet high in sugar and cholesterol, a low-mineral diet, genetic factors, stress and anxiety, etc. cause abnormal androgen secretion, and an increase in fungal infections caused by excessive sebum secretion are possible causes of androgenic alopecia.

[0006] Testosterone acting on the skin comes from the androgen precursors or free androgens synthesized by sebaceous gland cells themselves, secreted by gonads and adrenaline, and exogenous androgens. When the testosterone content in the skin is too high, under the catalysis of 5a-reductase, testosterone can produce dihydrotestosterone, which competes with testosterone for androgen receptors in hair follicle target cells. Since the activity of dihydrotestosterone is significantly higher than that of testosterone, its ability to bind to androgen receptors is stronger than that of testosterone. Once dihydrotestosterone enters the cell nucleus, on the one hand, it can promote the transcription of some paracrine factors in the hair follicles that are not conducive to hair growth, such as TGF-β, IL-6, etc., inhibit the growth of hair follicle cells, and cause the hair follicles to enter the resting phase prematurely, resulting in hair loss. On the other hand, androgens can also act on sebaceous glands, activate the SREBP pathway in sebaceous gland cells, promote the development and differentiation of immature cells in the outer layer of sebaceous gland cells into mature secretory cells, make the sebaceous glands hypertrophy, enhance the secretory function, and produce excessive sebum. Testing of the secreted oil revealed an increase in the secretion of triglycerides, squalene, and cholesterol, and the expression of enzymes that synthesize these fatty acids, such as FASN and SCD, also increased accordingly.

[0007] When the sebaceous glands are over-secreting, the excess sebum will clog or compress the pores, hindering the normal growth of hair. Excessive sebum secretion can also cause bacteria, fungi or yeast to grow on the scalp, leading to an imbalance of some normal flora on the body surface. In particular, Malassezia induces an allergic reaction in the body at the sebaceous glands of the scalp, breaking down the triglycerides in the sebum into free fatty acids, such as palmitic acid and oleic acid, which stimulate the hair follicles and cause inflammation. A study on androgenic alopecia showed that 50% of scalp samples had inflammatory infiltration of monocytes and lymphocytes. Another recent study confirmed that there was inflammatory infiltration of activated T cells and macrophages in the upper third of the hair follicles in the transitional area of ​​baldness.

[0008] The current treatment with Western medicine has a long treatment cycle, and there are individual differences in the treatment process, which can cause varying degrees of side effects such as decreased libido, allergic dermatitis, and anorexia. Plant and Chinese herbal extracts are rich in active ingredients and pharmacological effects, which can play an anti-androgen role in multiple pathways and targets, promote hair growth, and have prospective and potential value as a drug alternative therapy. Summary of the invention

[0009] The purpose of the present invention is to provide the role and application of 4-HIL in promoting hair follicle health, inhibiting androgenic alopecia and dandruff formation, so as to solve the problems of unsatisfactory treatment effect, large individual differences, significant side effects, etc. of current androgenic alopecia treatment, and provide a biologically active ingredient.

[0010] To achieve the above objectives, the present invention provides the role of 4-HIL in inhibiting androgenic alopecia, and the administration of 4-HIL promotes hair growth on the scalp after androgenic alopecia, increases the hair growth rate, increases hair length, hair weight, the number of hair follicles in the growth phase and the total number of hair follicles, promotes hair follicle proliferation in skin tissue, and reduces hair follicle apoptosis.

[0011] Preferably, the administration of 4-HIL reduces the expression of androgen receptors in the scalp, reduces the expression of fatty acid synthase genes in the scalp, and reduces lipid secretion.

[0012] Preferably, 4-HIL is applied to the scalp surface, and the application concentration of 4-HIL is 20-40 mg / mL, and it is applied once a day.

[0013] The effect of 4-HIL in inhibiting the growth of Malassezia, the effective concentration of 4-HIL is greater than 5 mg / mL.

[0014] The role of 4-HIL in inhibiting keratinocyte apoptosis induced by Malassezia, including early apoptosis and late apoptosis, with the lowest effective concentration being 50 μM.

[0015] The role of 4-HIL in inhibiting the proliferation of sebaceous gland cells. The effective concentration of 4-HIL is 2-4mM.

[0016] Application of 4-HIL in the preparation of a dandruff generation inhibiting agent and / or a shampoo and / or hair care product, wherein the product contains 4-HIL.

[0017] Application of 4-HIL in the preparation of a medicament for inhibiting androgenic alopecia and / or a shampoo and / or hair care product, wherein the product contains 4-HIL.

[0018] Application of 4-HIL in the preparation of a hair follicle health promoting agent and / or a hair shampoo and / or hair care product, wherein the product contains 4-HIL.

[0019] Preferably, the promoting of hair follicle health includes promoting hair follicle proliferation, reducing hair follicle apoptosis, and increasing the number of hair follicles in the growth phase and the total number of hair follicles.

[0020] Therefore, the effects and applications of 4-HIL provided by the present invention in promoting hair follicle health and inhibiting androgenic alopecia and dandruff formation are as follows:

[0021] (1) The present invention first discovered that 4-HIL has the ability to promote hair follicle proliferation, reduce hair follicle apoptosis, increase the number of hair follicles in the growth phase and the total number of hair follicles; by reducing the expression of scalp androgen receptors and fatty acid synthase genes in the scalp, it promotes the growth rate of scalp hair in androgenic alopecia and increases hair length and weight; 4-HIL can be used to prepare drugs and / or hair care products that inhibit androgenic alopecia;

[0022] (2) The present invention first discovered that 4-HIL has the effect of inhibiting keratinocyte apoptosis caused by Malassezia. Keratinocyte apoptosis is the main cause of dandruff. 4-HIL can be used to prepare a medicament and / or hair care product that inhibits dandruff generation and maintains the protective function of the stratum corneum;

[0023] (3) 4-HIL is a non-protein amino acid isolated from fenugreek seeds. It has good efficacy, high safety, good biological activity, wide application range and low price. It has great application prospects in the preparation of products that promote hair follicle health and inhibit androgenic alopecia and dandruff formation. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0025] Figure 1 The results of the effect of 4-HIL on the growth of Malassezia in Example 1; Part A is the results of the investigation of the effect on the growth of Malassezia; Part B is the statistical results of the inhibition rate of the growth of Malassezia;

[0026] Figure 2 The statistical results of the effects of 4-HIL on the pro-inflammatory factors (A) and apoptotic factors (B) of HACAT cells caused by Malassezia in Example 2 are shown;

[0027] Figure 3 The flow cytometer detection results (A) and apoptosis rate statistical results (B) in Example 2;

[0028] Figure 4 The OD values ​​of different groups at different times in Example 3 490nm Statistical results; Part A is the results of the investigation of the effects of LA (10 μM), DHT (100 nM) and different concentrations (2 mM, 4 mM) of 4-HIL on the proliferation of sebaceous gland cells at 24 h, 48 h, and 72 h; Part B is the results of the investigation of the effects of different concentrations (2 mM, 4 mM) of 4-HIL on the proliferation of sebaceous gland cells induced by androgen at 24 h, 48 h, and 72 h;

[0029] Figure 5It is the result of the fluorescence quantitative detection of fatty acid synthase and androgen receptor in Example 3; wherein Part A is the expression result of FASN fatty acid synthase; Part B is the expression result of SREBP-1C steroid regulatory element binding protein 1C; Part C is the expression result of SCD fatty acid desaturase; Part D is the expression result of AR androgen receptor;

[0030] Figure 6 The results of Oil Red O staining of different groups in Example 3;

[0031] Figure 7 The Western Blot experimental results (A) and quantitative results (B) of different groups in Example 3;

[0032] Figure 8 These are photos of mice during the process of constructing the androgenic alopecia model in Example 4; Part A is a whole-body photo, and Part B is an enlarged photo of a randomly selected mouse;

[0033] Fig. 9 The statistical results of hair weight (A), hair length (B), number of hair follicles (C), and number of hair follicles in growth phase and resting phase (D) of different groups in Example 4;

[0034] Fig.10 HE pathological sections of different groups in the process of constructing the androgenic alopecia model in Example 4;

[0035] Fig.11 The following are photos of mice in each group when investigating the effect of 4-HIL on mice with androgenic alopecia in Example 4 (A), the total number of hair follicles (B), hair length (C), the number of hair follicles in the growth phase and the resting phase (D), and hair weight (E);

[0036] Fig.12 The HE pathological sections of the skin of different groups when investigating the effect of 4-HIL on androgenic alopecia mice in Example 4;

[0037] Fig.13 The results of skin androgen receptor immunohistochemistry when investigating the effect of 4-HIL on androgenic alopecia mice in Example 4;

[0038] Fig.14 The results of skin Oil Red O staining (A), triglyceride expression (B), SCD mRNA expression (C), FASN mRNA expression (D), and SRBP-1C mRNA expression (E) when investigating the effect of 4-HIL on androgenic alopecia mice in Example 4;

[0039] Fig.15 The statistical results of the gene expression of skin inflammatory factors when investigating the effect of 4-HIL on androgenic alopecia mice in Example 4;

[0040] Fig.16 This is the expression result of the key enzyme protein level of skin fatty acid synthesis when investigating the effect of 4-HIL on androgenic alopecia mice in Example 4;

[0041] Fig.17 The immunohistochemical detection results of skin inflammatory factors when investigating the effect of 4-HIL on androgenic alopecia mice in Example 4;

[0042] Fig.18 The expression of pro-apoptotic factor mRNA in mouse skin when investigating the effect of 4-HIL on androgenic alopecia mice in Example 4 (A); TUNEL staining results (B); Ki67 proliferation marker expression detection results (C); DETAILED DESCRIPTION

[0043] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0044] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0045] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels; 4-HIL is 4-hydroxyisoleucine, purchased from Henan Julong Bioengineering Co., Ltd., with a purity of >98%; Malassezia furfur was purchased from Shanghai Collection Biotechnology Center, with the strain number SHMCC (SHBCC) D10558; HACAT (human immortalized keratinocytes) was purchased from Wuhan Sewell Biotechnology Co., Ltd.; SZ95 cells were purchased from Beijing Yunclone Biotechnology Co., Ltd.; SPF-level C57BL / 6 mice were purchased from Henan Sikebes Biotechnology Co., Ltd. and raised in the SPF-level animal experimental center of Zhengzhou University, strictly following the SPF-level standards.

[0046] Embodiment 1

[0047] The effect of 4-HIL on the growth of Malassezia was investigated, and the purchased Malassezia furfur was used as the test bacteria. The specific steps are as follows:

[0048] The purchased Malassezia furfur was activated and expanded for culture. Malassezia furfur in the logarithmic growth phase was taken and prepared into a bacterial strain with a concentration of 1×10 7 CFUs / mL, add 4-HIL solution with final concentrations of 0, 5, 10, 20, and 40 mg / mL, mix well, and detect the OD of the bacterial solution at different times 600The inhibitory effect of 4-HIL on the growth of Malassezia was investigated by measuring the absorbance of 4-HIL. The inhibition rate of 4-HIL on Malassezia was calculated using the following formula:

[0049]

[0050] A blank is: OD of Malassezia culture without drug added 600 Absorbance represents the maximum growth of bacterial solution; Sample A is: OD of bacterial solution after adding different concentrations of 4-HIL 600 The absorbance reflects the inhibitory effect of 4-HIL on the growth of Malassezia.

[0051] The results are as follows Figure 1 As shown, part A shows the effect of 0-40 mg / mL 4-HIL on the growth of Malassezia; part B shows the inhibition rate of 4-HIL on the growth of Malassezia. It can be seen from the figure that the inhibition rate of 5 mg / mL 4-HIL on Malassezia is 13%, the inhibition rate of 10 mg / mL 4-HIL on Malassezia is 22%, the inhibition rate of 20 mg / mL 4-HIL on Malassezia is 36%, and the inhibition rate of 40 mg / mL 4-HIL on Malassezia is 56%.

[0052] Embodiment 2

[0053] To investigate the effect of 4-HIL on HACAT cells, the purchased Malassezia furfur was used as the test bacteria. The specific steps are as follows:

[0054] (1) To investigate the effect of 4-HIL on inflammatory factors and apoptotic factors in HACAT cells induced by Malassezia.

[0055] S21, adjust the number of Malassezia furfur in the logarithmic growth phase to 1×10 7 CFUs / mL, cultured at 30℃ for 16h, the bacteria were broken in an ultrasonic crusher in a low-temperature ice-water bath (on for 3s and off for 5s, for a total of 15min), centrifuged at 4℃ and 12000r / min for 10min (repeated 3 times), the supernatant was taken, filtered with a 0.22μM filter to obtain the Malassezia suspension, and stored at -80℃ for later use.

[0056] S22, take HACAT cells in logarithmic growth phase and add 1.5×10 5The cells were inoculated into 6-well plates at a number of 100 U / mL, 2 mL per well, and cultured in DMEM medium supplemented with penicillin (100 U / mL), streptomycin (100 μg / mL), and 10% fetal bovine serum (FBS). After incubation in a cell culture incubator at 5% CO2 and 37°C overnight until the cells adhered to the wall, the original medium was discarded, and only 2 mL of the above DMEM medium was added as the control group (Control group), 2 mL of the Malassezia suspension prepared in step S21 with a final concentration of 1% was added as the Stimuate group, 2 mL of the Malassezia suspension prepared in step S21 with a final concentration of 1% and 4-HIL with a final concentration of 50 μM was added as the Stimuate+50 μM 4-HIL group, and 2 mL of the Malassezia suspension prepared in step S21 with a final concentration of 1% and 4-HIL with a final concentration of 100 μM was added as the Stimuate+100 μM 4-HIL group, adding 2mL of the Malassezia suspension prepared in step S21 with a final concentration of 1% and 4-HIL with a final concentration of 200μM is the Stimuate+200μM 4-HIL group. Each group has 3 replicates. After incubation in a cell culture incubator with 5% CO2 and 37°C for 24h, the RNA of cells in different treatment groups was extracted using a kit, and then the RNA quality was tested, and the RNA with good quality was selected and repeatedly reverse transcribed into cDNA using a reverse transcription kit.

[0057] S23. Using the primers of inflammatory factors and apoptotic factors shown in Table 1, and the obtained cDNA as a template, the LightCycler 480 SYBR Green I Master Kit was used to prepare the reaction system according to the attached instructions for qRT-PCR. The qRT-PCR program was 95°C for 10 min; 95°C for 10 s, 60°C for 20 s, 45 cycles; 95°C for 5 s, 65°C for 1 min; 40°C for 30 s. Then, quantitative detection and melting curve analysis were performed, and 3 replicate wells were set for each sample.

[0058] Table 1

[0059] Primer name Primer sequence (5′-3′) β-actin-F GGCTCTTTTCCAGCCTTCCT(SEQ ID NO.1) β-actin-R AATGCCAGGGTACATGGTGG(SEQ ID NO.2) IL6-F TAGTGAGGAACAAGCCAGAGC(SEQ ID NO.3) IL6-R GTTGGGTCAGGGGTGGTTATT(SEQ ID NO.4) TNFα-F GCTGCACTTTGGAGTGATCG(SEQ ID NO.5) TNFα-R CTTGTCACTCGGGGTTCGAG(SEQ ID NO.6) IL1α-F CTGGGAAACTCACGGCACTA(SEQ ID NO.7) IL1α-R CCAAGCACACCCAGTAGTCT(SEQ ID NO.8) Bax-F TCATGGGCTGGACATTGGAC(SEQ ID NO.9) Bax-R GCGTCCCAAAGTAGGAGAGG(SEQ ID NO.10) Bcl2-F GAACTGGGGGAGGATTGTGG(SEQ ID NO.11) Bcl2-R GCCGGTTCAGGTACTCAGTC(SEQ ID NO.12) Caspase8-F CTCGGACTCTCCAAGAGAACAG(SEQ ID NO.13) Caspase8-R GTCATCGTGGGGCTTGATCT(SEQ ID NO.14)

[0060] The results are as follows Figure 2As shown, 1% Malassezia suspension caused a significant increase in the secretion of proinflammatory factors (IL6, IL-1α, TNFα) and apoptotic factors (Bax, Capase8) in HACAT cells, and 4-HIL inhibited the increase of inflammatory factors (IL6, IL-1α, TNFα) and apoptotic factors (Bax, Capase8) induced by 1% Malassezia solution. *** indicates P<0.001 compared with the Control group; ## indicates P<0.01 compared with Stimulate; ### indicates P<0.001 compared with Stimulate.

[0061] (2) Effect of 4-HIL on Malassezia-induced HACAT cell apoptosis

[0062] S24, operate according to the method of step S21 and step S22, then use pH 7.2 PBS to gently blow down the treated cells in step S22 for 24 hours, transfer to EP tube and centrifuge, discard the supernatant, add 4°C pre-cooled PBS (pH 7.2) and use a vortexer to gently vortex and mix, then add 5μL Annexin V and 10μLPI respectively, and incubate at 4°C in the dark for 10 minutes. After incubation, the apoptosis rate was detected by flow cytometry. The results are as follows Figure 3 As shown, 1% Malassezia solution can cause early and late apoptosis of HACAT cells, and 4-HIL can significantly slow down the early and late apoptosis induced by 1% Malassezia, and the effect is best when the dose is the smallest. *** indicates P<0.001 compared with the Control group; ## indicates P<0.01 compared with Stimulate; ### indicates P<0.001 compared with Stimulate.

[0063] Embodiment 3

[0064] The effect of 4-HIL on SZ95 cells (human sebaceous gland cells) was investigated. The specific steps are as follows:

[0065] (1) Effect of 4-HIL on androgen-induced SZ95 cell growth.

[0066] S31. Take SZ95 cells in the logarithmic growth phase and count them. Then use a cell counting plate to count under a microscope and adjust the number of cells to 2.5×10 4 The single-cell suspension was evenly inoculated into a flat-bottom 96-well plate using a spray gun, 100 μL per well, and incubated in a 5% CO2, 37°C constant temperature incubator overnight.

[0067] S32. Starvation treatment: After observing cell adhesion under a microscope, discard the old culture medium and add 200 μL serum-free DMEM medium to continue culturing for 8 h.

[0068] S33, discard the culture medium, add 200 μL DMEM culture medium containing only 10 μM linoleic acid, record as the normal control group (Control); add 200 μL DMEM culture medium containing only 10 μM linoleic acid, record as the LA group; add 200 μL DMEM culture medium containing only 100 nmM DHT, record as the DHT group; add 200 μL DMEM culture medium containing only 2 mM 4-HILDMEM, record as the 2 mM 4-HIL group; add 200 μL DMEM culture medium containing only 4 mM 4-HILDMEM, record as the 4 mM4-HIL group; add 200 μL DMEM culture medium containing a final concentration of 10 μM linoleic acid and 100 nmM DHT, record as the LA+DHT group; add 200 μL DMEM culture medium containing a final concentration of 10 μM linoleic acid + 100 nM DHT + 2 mM 4-HIL, record as the LA+DHT+2 mM 4-HIL group; add 200 μL DMEM culture medium containing a final concentration of 10 μM linoleic acid + 100 nM The DMEM medium of DHT+4mM 4-HIL was recorded as LA+DHT+4mM 4-HIL group. 200μL PBS (pH 7.2) was added to the blank wells around the cell wells. The cells were cultured in a cell culture incubator at 5% CO2 and 37°C for 24h, 48h, and 72h, respectively. Then, 20μL MTT was added to each well in the dark at 20h, 44h, and 68h, and the culture was continued for 4h. The supernatant was discarded, 150μL DMSO was added to each well, and the mixture was shaken to mix. The absorbance was read at 490nm using an enzyme reader. The results are shown in Figure 4 As shown, there was no difference in cell proliferation among the groups within 24 hours. Within 48 hours, LA and DHT could significantly promote the proliferation of SZ95 cells, and LA+DHT was more significant. The single application of 4-HIL could inhibit the proliferation of SZ95 cells, and the inhibitory effect increased with the increase of dose. The 4-HIL treatment group could significantly inhibit the proliferation of SZ95 cells induced by LA+DHT. The changes in the number of cells within 72 hours were the same as those at 48 hours. * indicates P<0.05 compared with the Control group; ** indicates P<0.01 compared with the Control group; # indicates P<0.05 compared with LA+DHT; ## indicates P<0.01 compared with LA+DHT; ### indicates P<0.001 compared with LA+DH.

[0069] (2) Effects of 4-HIL on androgen-induced fatty acid synthase and androgen receptor in SZ95 cells.

[0070] S34, take SZ95 cells in logarithmic growth phase and add 1×10 5The number of cells / mL was inoculated into 6-well plates, 2 mL per well, and cultured in DMEM medium supplemented with penicillin (100 U / mL), streptomycin (100 μg / mL), and 10% fetal bovine serum (FBS). After overnight culture in a cell culture incubator at 5% CO2 and 37°C until the cells adhered to the wall, the original medium was discarded, and 2 mL of DMEM medium only was added as the normal control group (Control); 2 mL of DMEM medium containing 10 μM linoleic acid was added as the linoleic acid group LA; 2 mL of DMEM medium containing 100 nM DHT was added as DHT; 2 mL of DMEM medium containing a final concentration of 10 μM linoleic acid and 100 nmM DHT was added as the LA+DHT group; 2 mL of DMEM medium containing a final concentration of 10 μM linoleic acid, 100 nM DHT, and 2 mM 4-HIL was added as the LA+DHT+2 mM 4-HIL group; add 2mL of DMEM medium containing final concentration of 10μM linoleic acid, 100nM DHT, and 4mM 4-HIL, recorded as LA+DHT+4mM 4-HIL group. Set up 3 replicates for each group. After incubation in a cell culture incubator with 5% CO2 and 37°C for 24h, use a kit to extract RNA from cells in different treatment groups, then detect the RNA quality, select RNA with good quality and use a reverse transcription kit to reverse transcribe it into cDNA. Use the primers shown in Table 2, and use the obtained cDNA as a template to prepare the reaction system according to the instructions attached to the kit for fluorescent quantitative PCR. The procedure is the same as S23.

[0071] Table 2

[0072] Primer name Primer sequence (5′-3′) SREBP-1C-F TGTGACCTCGCAGATCCAG(SEQ ID NO.15) SREBP-1C-R CAGAGACCAGGGGACTGAGA(SEQ ID NO.16) FASN-F CAGGCACACACGATGGAC(SEQ ID NO.17) FASN-R CGGAGTGAATCTGGGTTGAT(SEQ ID NO.18) SCD-F CTGGCTTGCTGATGATGTGC(SEQ ID NO.19) SCD-R CGCAAGAAAGTGGCAACGAA(SEQ ID NO.20) AR-F GGTGAGCAGAGTGCCCTATC(SEQ ID NO.21) AR-R GCAGTTCCCAAACGCATGTC(SEQ ID NO.22)

[0073] The results are as follows Figure 5 As shown, there was no significant difference in FASN, SCD, SREBP-1c, and AR induced by LA and DHT alone in SZ95 cells compared with the control group. The LA+DHT group was able to significantly induce the expression of FASN, SCD, SREBP-1c, and AR compared with the control group. The 4-HIL treatment group was able to significantly inhibit the expression of FASN, SCD, SREBP-1c, and AR induced by LA+DHT. The effect became more obvious with the increase of the dose. * indicates P<0.05 compared with the Control group; ** indicates P<0.01 compared with the Control group; *** indicates P<0.001 compared with the Control group; # indicates P<0.05 compared with LA+DHT; ## indicates P<0.01 compared with LA+DHT; ### indicates P<0.001 compared with LA+DH.

[0074] For S35 and Oil Red O experiments, SZ95 cells were cultured at 1×10 5 / well density was plated on a 6-well plate, and cultured overnight in a cell culture incubator at 5% CO2 and 37°C until the cells adhered to the wall. The cells were grouped and drug-added in the same manner as S34, and continued to be cultured in a cell culture incubator at 5% CO2 and 37°C for 48 hours. The cells were centrifuged and the supernatant was discarded. The cells were washed once with PBS (pH 7.2), fixed with 4% paraformaldehyde for half an hour, the supernatant was discarded, and washed once with PBS (pH 7.2). The cells were then added with the prepared Oil Red O dye solution to the cell wells, and dyed at room temperature in the dark for 10 minutes. The excess dye solution was discarded, and 60% isopropanol was used for differentiation for a few seconds and then discarded. After adding PBS (pH 7.2), the cells were observed under an inverted microscope and photographed.

[0075] The results are as follows Figure 6 As shown in the figure, LA and DHT groups induced the lipid content of SZ95 cells compared with the Control group, and the induction effect of LA+DH group was more obvious than that of LA and DHT alone. The 4-HIL administration group was able to inhibit the production of lipids induced by the LA+DH group, and the effect of the high-dose group was more obvious.

[0076] S36. Western Blot experiment. According to the method in step S35, cells in the Control group, LA group, DHT group, DHT+LA group, DHT+LA+2mM 4-HIL group, and DHT+LA+4mM 4-HIL group were obtained for Western Blot experiment. The results are as follows: Figure 7 As shown, the LA+DHT group can significantly induce the expression of FASN, SCD, and SREBP-1c protein levels compared with the control group. The 4-HIL treatment group can significantly inhibit the expression of FASN, SCD, and SREBP-1c protein levels induced by the LA+DHT group. * indicates P<0.05 compared with the Control group; ** indicates P<0.01 compared with the Control group; *** indicates P<0.001 compared with the Control group; # indicates P<0.05 compared with LA+DHT; ## indicates P<0.01 compared with LA+DHT; ### indicates P<0.001 compared with LA+DH.

[0077] Embodiment 4

[0078] To investigate the effect of 4-HIL on androgenic alopecia mice, the specific steps are as follows:

[0079] S41. Construction of androgenic alopecia model mice. Male C57BL / 6 mice (SPF level) aged 4-5 weeks and weighing about 18-20 g were used. They were kept in a humidity of about 60%, 25°C, and 12h alternating light and dark conditions with sterile drinking water and sterile feed for one week. The experiment was started after no abnormalities were observed.

[0080] In a clean bench, testosterone propionate injection was diluted to 1 mg / mL using injection-grade soybean oil, ultrasonicated for 10 minutes, and then fully mixed using a vortexer. The mice were then injected into the back of the mice using a multi-point injection method on the back skin. The total dose was 0.1 mL / mouse. The injections were continued for 28 days, once a day, and recorded as the model group (Model). Mice injected with the same amount of injection-grade soybean oil using the same settings were recorded as the model control group (Soybean oil). Mice injected with the same amount of saline using the same settings were recorded as the blank control group (Control). Each group was repeated for 5 mice.

[0081] Each group of mice was observed and photographed every 7 days. Figure 8 As shown in Part A and Part B of the figure, compared with the blank control group, the hair of the model solvent group was shiny and no hair loss occurred. Compared with the mice in the blank control group, the mice in the model group all experienced hair loss, accompanied by fighting and biting each other. Compared with the mice in the model control group, the hair of the mice in the model group appeared greasy. After 3 weeks, the hair on the back of the mice in the model group was greasy, and the hair gradually fell off after 3 weeks, and the hair became sparse.

[0082] After the last administration, three mice in the model group were randomly selected to fast for 12 hours, and blood was taken from the eyeballs and then killed by dislocation of the neck. The blood was left at room temperature for 30 minutes, and after the blood coagulated naturally, it was centrifuged at 3500rpm for 10 minutes, and the supernatant was sent to the hospital to detect the hormone content in the blood. The same method was used to detect the hormone content in the blood of mice in the blank control group and the model control group. The results are shown in Table 3.

[0083] Table 3

[0084] Group T content (ng / mL) E2 content (ng / mL) T / E2 Blank control group 0.74±0.79 32.42±1.60 0.02±0.02 Model control group 0.90±1.17 38.51±5.00 0.03±0.04 Model Group 10.36±1.14*** 40.24±1.37 0.26±0.02***

[0085] Compared with the blank control group and the model control group, the androgen content in the serum of the model group mice increased significantly, and the ratio of estradiol / androgen also increased significantly. *** indicates P<0.001 compared with the model control group.

[0086] At the same time, 15 hairs were randomly plucked from the back of the mice killed after blood was drawn using ophthalmic scissors, and the hair length and weight were counted. Then, after depilating the back of the mice, skin tissue with an area of ​​about 1.5 cm × 1.5 cm was removed, placed in a 15 mL centrifuge tube, and fixed in a 10% formaldehyde solution. The removed tissue was routinely dehydrated, paraffin-embedded, sectioned, and stained with hematoxylin-eosin (HE). The total number of hair follicles and the stage of the hair follicles were counted under an ordinary optical microscope, and the morphology of the hair follicles was observed.

[0087] The results are as follows Fig. 9 and Fig.10As shown, the hair length and weight, the total number of hair follicles, and the number of growth phase / rest phase in the model group were significantly lower than those in the blank control group. Through HE pathological section observation, the hair follicles in the blank control group and the model control group were in the growth phase, while the hair matrix of the hair follicles in the model group was atrophied, the hair papilla was reduced, and the hair bulb was in the regression phase or rest phase.

[0088] The above results prove that the androgenic alopecia model mouse was successfully constructed.

[0089] S42. Investigate the effect of 4-HIL on mice with androgenic alopecia.

[0090] Select the mice that have been successfully modeled in step S41, prepare the central area of ​​the mouse back with a shaver, and then use a depilatory cream to thoroughly depilate the prepared area according to the attached instructions to remove the hair that remains after preparation. Use a 20mg / mL 4-HIL aqueous solution to apply to the back of the mouse that has been completely depilated, 0.2mL each time, once a day, recorded as the 20mg / mL 4-HIL group; use the same setting to apply an equal amount of 40mg / mL 4-HIL aqueous solution to the mouse, recorded as the 40mg / mL 4-HIL group; use the same setting to apply an equal amount of saline to the mouse, recorded as the blank group (Control); use the same setting to apply an equal amount of 1% azone aqueous solution to the mouse, recorded as the model group. During the experiment, each group of mice was routinely raised.

[0091] 1) Observe and photograph the backs of mice in each group every 7 days, and pay attention to monitoring the abnormalities of the skin at the drug administration site, such as whether there are redness, swelling, scars, ulcers, erosions and other contact dermatitis-like symptoms. At the same time, observe whether the mice have any changes in living habits, eating habits, etc., and keep corresponding records.

[0092] Photos such as Fig.11 As shown in part A, the hair of mice in the model group grew slowly, and after 28 days, the hair became sparse, fragile, and dull in color; the hair of mice in the 20 mg / mL 4-HIL group and the 40 mg / mL 4-HIL group grew faster, and after 28 days, the hair became dense, strong, and shiny in color.

[0093] 2) On the second day after the last application of the drug (i.e., the 30th day after hair removal), the mice were killed by cervical depilation, and 15 hairs were randomly plucked from each mouse in the hair removal area, and the length of the new hair of the mice was compared. A 2cm×2cm skin patch was cut with a blade and scissors from the same area in the hair removal area of ​​each mouse, and then all the hair on the skin patch was scraped off with a scalpel and weighed, and the mean gross weight of each group of mice was calculated, and the gross weight of each group was analyzed using the one-way analysis of variance method of Prism8 software.

[0094] The results are as follows Fig.11As shown in Part B, the hair length, hair weight, total number of hair follicles and number of hair follicles in the growth phase in the 4-HIL treatment group were significantly higher than those in the model group. * indicates P<0.05 compared with the Control group; ** indicates P<0.01 compared with the Control group; *** indicates P<0.001 compared with the Control group; # indicates P<0.05 compared with the Model; ## indicates P<0.01 compared with the Model; ### indicates P<0.001 compared with the Model.

[0095] 3) After the last administration, three model group experimental mice were randomly selected and fasted for 12 hours. After anesthesia and cervical dislocation, several pieces of skin tissue with an area of ​​about 1.5 cm × 1.5 cm were removed from the depilatory area on the back of the mouse using ophthalmic scissors. Some of them were treated with liquid nitrogen and frozen in a -80°C refrigerator, and some were placed in a centrifuge tube and fixed in a 10% formaldehyde solution. The removed tissues were routinely dehydrated, paraffin-embedded, sectioned, and HE-stained. The total number of hair follicles and the stage of hair follicles were counted under an ordinary optical microscope, and the morphology of hair follicles was observed.

[0096] The results are as follows Fig.12 As shown, the model group had fewer hair follicles than the control group, with cavitation of the hair follicles, shrinking hair papillae, and hair follicles losing their normal morphology, and most of them were in the resting or regression phase. In the drug-treated group, the hair follicles were closely arranged, with complete structure, and most of them were in the growth phase.

[0097] 4) The skin tissues of mice in each group were sent to the company for androgen receptor immunohistochemistry analysis. Fig.13 As shown, the expression of androgen receptor in the androgen sebaceous glands and hair papilla of the model group was increased compared with that of the control group, while the expression of androgen receptor in the hair follicles of the 4-HIL treatment group was significantly decreased, indicating that 4-HIL can reduce the expression of androgen receptor.

[0098] 5) Take the skin tissue of each group of mice and send it to the company for Oil Red O test of mouse skin tissue. The results are as follows Fig.14 As shown in Part A, the lipid expression in the back skin of mice in the model group was significantly increased compared with that in the control group, while the lipid secretion in the skin of the 4-HIL treatment group was significantly decreased compared with that in the model group, indicating that 4-HIL can reduce the secretion of lipids in the skin. As the dose increases, the effect becomes more obvious, indicating that 4-HIL can reduce the lipid content in the skin.

[0099] 6) Accurately weigh 20g of skin tissue, add 180mL of homogenization medium, mechanically homogenize under ice water bath, centrifuge at 2500r / min for 10min, take 2.5μL of supernatant + 250μL of working solution and add it to a 96-well plate as a sample well, add 2.5μL of calibrant + 250μL of working solution to the well as the standard well, and add 2.5μL of distilled water + 250μL of working solution to the well as the blank well. Oscillate the well plate to mix, then incubate at 37℃ for 10min, and incubate at OD 500nm The absorbance value of each well was measured and the concentration of triglycerides in the skin was calculated using the following formula:

[0100]

[0101] Where W is tissue weight (g), V 提取液 is the total volume of homogenate added.

[0102] Statistical analysis was performed using one-way analysis of variance using Prism8 software.

[0103] like Fig.14 As shown in Part B, the expression of triglycerides in the back skin of mice in the model group was significantly increased compared with that in the control group, while the triglyceride secretion in the skin of the 4-HIL treatment group was significantly decreased compared with that in the model group, indicating that 4-HIL can reduce the secretion of triglycerides in the skin, and the effect becomes more obvious with increasing doses.

[0104] 7) 100 g of dorsal skin of mice in each group was taken, and total RNA was extracted using a kit, which was then reverse transcribed into cDNA. Fluorescence quantitative PCR was performed using the primers shown in Table 4 to examine the expression of fatty acid synthase, inflammatory factors, and apoptotic factors in mouse skin tissue.

[0105] Table 4

[0106]

[0107]

[0108] The results are as follows Fig.14As shown in Part C, the expression of key enzymes FASN, SCD, and SREBP-1c in the back skin of mice in the model group increased significantly compared with the control group, while the expression of key enzymes FASN, SCD, and SREBP-1c in the skin of the 4-HIL treatment group was significantly reduced compared with the model group, indicating that 4-HIL can reduce the expression of fatty acid synthase gene levels in the skin. * indicates P<0.05 compared with the Control group; ** indicates P<0.01 compared with the Control group; *** indicates P<0.001 compared with the Control group; # indicates P<0.05 compared with the Model; ## indicates P<0.01 compared with the Model; ### indicates P<0.001 compared with the Model.

[0109] like Fig.15 As shown, the expression of IL6, IL-1β, TNFα and TLR2 in the back skin of mice in the model group increased significantly compared with the control group, while the expression of IL6, IL-1β, TNFα and TLR2 genes in the skin of the 4-HIL treatment group was significantly reduced compared with the model group, indicating that 4-HIL can reduce the expression of inflammatory factor genes in the skin. * indicates P<0.05 compared with the Control group; ** indicates P<0.01 compared with the Control group; *** indicates P<0.001 compared with the Control group; # indicates P<0.05 compared with the Model; ## indicates P<0.01 compared with the Model; ### indicates P<0.001 compared with the Model.

[0110] 8) Western Blot was used to detect the expression of fatty acid synthase protein in the back skin of mice. Fig.16 As shown, the expression of key enzymes FASN, SCD, and SREBP-1c in the back skin of mice in the model group increased significantly compared with the control group, while the protein expression of key enzymes FASN, SCD, and SREBP-1c in the skin of the 4-HIL treatment group was significantly reduced compared with the model group, indicating that 4-HIL can reduce the expression of fatty acid synthase protein levels in the skin. * indicates P<0.05 compared with the Control group; ** indicates P<0.01 compared with the Control group; *** indicates P<0.001 compared with the Control group; # indicates P<0.05 compared with the Model; ## indicates P<0.01 compared with the Model; ### indicates P<0.001 compared with the Model.

[0111] 9) Tunel staining method was used to detect hair follicle apoptosis in the skin

[0112] like Fig.17As shown, apoptotic cells in the back skin of mice in the model group were mostly concentrated in the epidermis, and their expression was significantly increased compared with that in the control group. The expression of apoptotic cells in the skin of the 4-HIL treatment group was significantly reduced compared with that in the model group, indicating that 4-HIL can reduce the apoptosis of hair follicles in skin tissue.

[0113] 10) Immunofluorescence detection of Ki67 proliferation marker expression in mouse skin

[0114] like Fig.18 The results showed that Ki67 expression was concentrated in the hair bulb of hair follicles. The Ki67 expression in the model group mice was significantly reduced compared with that in the control group. The Ki67 expression in the hair bulb of the 4-HIL treatment group was significantly increased compared with that in the model group, indicating that 4-HIL can promote the expression of the proliferation marker Ki67 in hair follicles.

[0115] Therefore, the present invention discovers for the first time that 4-HIL has the effects of promoting hair follicle proliferation, reducing hair follicle apoptosis, increasing the number of hair follicles in the growth phase and the total number of hair follicles; promoting the growth rate of scalp hair in androgenic alopecia, increasing hair length and weight; and inhibiting keratinocyte apoptosis caused by Malassezia. 4-HIL can be used to prepare agents and / or hair care products that inhibit androgenic alopecia, inhibit dandruff formation, and maintain the protective function of the stratum corneum. It has good effects, high safety, good biological activity, a wide range of applications, and a low price. It has great application prospects for the preparation of products that promote hair follicle health and inhibit androgenic alopecia and dandruff formation.

[0116] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. 4-HIL has the following effects on inhibiting androgenic alopecia: The administration of 4-HIL promotes hair growth on the scalp after androgenic alopecia, increases the hair growth rate, increases hair length, hair weight, the number of hair follicles in the growth phase and the total number of hair follicles, promotes hair follicle proliferation in skin tissue, and reduces hair follicle apoptosis.

2. The effect of 4-HIL in inhibiting androgenic alopecia according to claim 1, characterized in that: Administration of 4-HIL reduced the expression of androgen receptors in the scalp, reduced the expression of fatty acid synthase genes in the scalp, and reduced lipid secretion.

3. The effect of 4-HIL in inhibiting androgenic alopecia according to claim 1, characterized in that: The 4-HIL is applied to the scalp surface at a concentration of 20-40 mg / mL, once a day. 4.4-HIL has the following effects on inhibiting the growth of Malassezia: The effective concentration of 4-HIL is greater than 5 mg / mL. 5.4-HIL plays a role in inhibiting keratinocyte apoptosis caused by Malassezia, characterized by: Keratinocyte apoptosis includes early apoptosis and late apoptosis, and the minimum effective concentration is 50μM. 6.4-HIL has the following effects on inhibiting the proliferation of sebaceous gland cells: The effective concentration of 4-HIL is 2-4 mM.

7. Use of 4-HIL in the preparation of a dandruff inhibiting agent and / or a shampoo and / or hair care product, characterized in that: The product contains 4-HIL.

8. Use of 4-HIL in the preparation of a medicament for inhibiting androgenic alopecia and / or a shampoo and / or a hair care product, characterized in that: The product contains 4-HIL.

9. Use of 4-HIL in the preparation of a hair follicle health promoting agent and / or a shampoo and / or hair care product, characterized in that: The product contains 4-HIL.

10. Use of 4-HIL according to claim 9 in the preparation of a hair follicle health promoting agent and / or a shampoo and / or hair care product, characterized in that: The promotion of hair follicle health includes promoting hair follicle proliferation, reducing hair follicle apoptosis, and increasing the number of hair follicles in the growth phase and the total number of hair follicles.

Images