Novel coronavirus B.1. 1.529 variant oral vaccine with built-in nucleic acid adjuvant and preparation method of novel coronavirus B.1. 1.529 variant oral vaccine

Abstract

The invention provides a novel coronavirus B.1. 1.529 variant oral vaccine with a built-in nucleic acid adjuvant and a preparation method of the novel coronavirus B.1. 1.529 variant oral vaccine, and belongs to the technical field of novel coronavirus oral vaccines. The preparation method provided by the invention comprises the following steps: (1) carrying out homologous recombination on S protein of a new coronavirus B.1. 1.529 variant as a target gene and an adenovirus vector skeleton to obtain a recombinant adenovirus plasmid; (2) transfecting cells after the recombinant adenovirus plasmid is subjected to enzyme digestion linearization, and collecting the cells when more than 90% of the cells have cytopathic effect to obtain a primary virus P0; and (3) continuously inoculating the primary virus P0 into cells, and carrying out multiplication culture to obtain the virus liquid oral vaccine. According to the vaccine provided by the invention, immune response is induced by oral administration, the risk of injection related complications is reduced, and meanwhile, the immune response of the new coronavirus vaccine is enhanced by a nucleic acid adjuvant transcribed by the U6 promoter.

Description

Technical Field

[0001] The present invention relates to the technical field of oral vaccines for the new coronavirus, and in particular to an oral vaccine for the new coronavirus B.1.1.529 variant with a built-in nucleic acid adjuvant and a preparation method thereof. Background Art

[0002] The new coronavirus (Severe acute respiratory syndrome coronavirus 2, SARS-CoV-2) is an enveloped single-stranded positive-sense RNA virus. The Omicron strain was first discovered in Botswana on November 11, 2021, and then quickly replaced other VOCs to become the dominant strain globally, and multiple variants appeared. In the absence of immunity and restrictive measures, the average basic reproduction number (R0) of Omicron is 9.5-10.0. Under the influence of population immunity and restrictive measures, its average effective reproduction number (Re) is still as high as 3.4-4.2, which is 2.7-3.8 times that of the Delta variant. The Omicron variant has obvious genetic differences from the ancestral virus, with higher immune evasion ability and higher transmissibility.

[0003] The spike glycoprotein (S protein) encoded by SARS-CoV-2 serves as the main target of vaccine-induced immune response. The pre-fusion S protein is usually metastable during in vitro preparation and is easily converted to a post-fusion conformation. Mutations of the K986 and V987 sites to proline can form a stable S protein (S2P) to prevent structural changes from pre-fusion to post-fusion. Existing vaccine studies have shown that vaccines expressing S2P as an antigen induce higher neutralizing antibody titers and provide better protection. Therefore, stabilization of the pre-fusion conformation of the S protein is an effective way to improve the antigenicity of the vaccine.

[0004] SARS-CoV-2 infection begins in the upper respiratory tract (URT), which is usually the first line of defense against infection and an important part of the mucosal immune system. Current studies suggest that mucosal immunization can induce an effective immune response at the site of infection, which can better block viral transmission and prevent infection. In addition, mucosal T cell immune responses triggered by mucosal immunization can also induce mucosal immune responses at the distal site, effectively clearing viral infections at the distal mucosa.

[0005] Viruses that infect the intestine are the first choice for oral vaccine antigen carriers. Adenovirus (Ad) can resist the intestinal environment and infect intestinal cells. Adenovirus as a vector has the advantages of a wide host range, stable genome, simple design and high immunogenicity. Therefore, it is widely used in current vaccine research.

[0006] Oral vaccination has the characteristics of high acceptability, lower technical threshold for vaccination, and few side effects, and has always been an important direction for vaccine development. Existing studies have shown that oral adenovirus vector vaccines induce effective immune protection and have the advantages of convenient transportation and storage. It has now become an important technical approach for the development of oral vaccines. In recent years, the epidemic caused by the new coronavirus has had a huge impact on global public health. Although there are currently a variety of COVID-19 vaccines, most of them need to be administered by injection, which is inconvenient to vaccinate and may cause local or systemic adverse reactions. Therefore, it is of great significance to develop safe, effective and convenient new vaccine administration routes. Summary of the invention

[0007] The purpose of the present invention is to provide an oral vaccine against the Omicron B.1.1.529 variant strain that can be quickly prepared and used and a preparation method thereof, aiming to simply induce an immune response through oral administration while reducing the risk of injection-related complications.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a method for preparing an oral vaccine for a novel coronavirus B.1.1.529 variant with a built-in nucleic acid adjuvant, comprising the following steps:

[0010] (1) Using the S protein of the 2019-nCoV B.1.1.529 variant as the target gene, homologous recombination was performed with the adenovirus vector backbone to obtain a recombinant adenovirus plasmid;

[0011] (2) the recombinant adenovirus plasmid is linearized by enzyme digestion and then transfected into cells. When more than 90% of the cells show cytopathic effect, the cells are collected to obtain the primary virus P0;

[0012] (3) The primary virus P0 is continuously inoculated into cells and amplified and cultured until the P3 virus is obtained, the cell precipitate of the P3 virus is collected, and the virus liquid oral vaccine is obtained by repeated freezing and thawing.

[0013] Preferably, the S protein of the novel coronavirus B.1.1.529 variant is Omi-S or Omi-S2P, the nucleotide sequence of Omi-S is shown in SEQ ID NO: 2, and the nucleotide sequence of Omi-S2P is shown in SEQ ID NO: 5.

[0014] Preferably, the Omi-S and Omi-S2P respectively carry CMV promoters and undergo homologous recombination with the adenovirus vector backbone.

[0015] Preferably, the nucleotide sequence of Omi-S carrying the CMV promoter is shown in SEQ ID NO: 1.

[0016] Preferably, the Omi-S and Omi-S2P respectively co-express an adjuvant sequence, and the adjuvant sequence is shown in SEQ ID NO: 6; the adjuvant sequence is co-expressed using U6 promoter.

[0017] Preferably, the nucleotide sequence of the target gene Omi-SL carrying a CMV promoter and co-expressing an adjuvant sequence is shown in SEQ ID NO:3.

[0018] Preferably, the nucleotide sequence of the target gene Omi-S2PL carrying a CMV promoter and co-expressing an adjuvant sequence is shown in SEQ ID NO:4.

[0019] Preferably, the adenovirus vector backbone is pKAd5ES-pmeI.

[0020] The present invention also provides an oral vaccine obtained in the preparation method.

[0021] The present invention also provides a recombinant adenovirus plasmid obtained in the preparation method.

[0022] The oral vaccine for the novel coronavirus B.1.1.529 variant with a built-in nucleic acid adjuvant provided by the present invention induces an immune response through the oral route, reducing the risk of injection-related complications. At the same time, the nucleic acid adjuvant transcribed by the U6 promoter enhances the immune response of the novel coronavirus vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the structure of the recombinant adenovirus expression vector;

[0024] Figure 2 The electrophoresis results of the linearized recombinant adenovirus plasmids, where 1 represents pKAd5ES-pmeI, M represents 1kbmaker, 2 represents pKAd5ES-Omicron-S, 3 represents pKAd5ES--Omicron-SL, and 4 represents pKAd5ES--Omicron-S2PL;

[0025] Figure 3 This is the packaging status of the recombinant adenovirus plasmid after transfection into cells;

[0026] Figure 4 Virus solution purified by cesium chloride density gradient centrifugation (left) and electron microscopy results (right), scale bar = 200 nm;

[0027] Figure 5Neutralizing antibody responses elicited by oral and intramuscular administration of recombinant adenovirus vaccines ADV5-Omicron-S and ADV5-Omicron-SL;

[0028] Figure 6 The mucosal antibody responses elicited by oral and intramuscular administration of recombinant adenovirus vaccines ADV5-Omicron-S and ADV5-Omicron-SL;

[0029] Figure 7 Serum antibody responses induced by oral administration of ADV5-Omicron-SL and ADV5-Omicron-S2PL vaccines;

[0030] Figure 8 The mucosal antibody response induced by oral administration of ADV5-Omicron-SL and ADV5-Omicron-S2PL vaccines was flat;

[0031] Figure 9 T cell antibody responses induced by oral administration of ADV5-Omicron-SL and ADV5-Omicron-S2PL vaccines;

[0032] Figure 10 It is the dose-dependent effect of specific serum IgG after oral administration of AdV5-Omicron-S2PL;

[0033] Figure 11 It is the dose-dependent effect of intestinal SIgA after oral administration of AdV5-Omicron-S2PL;

[0034] Figure 12 Oral administration of AdV5-Omicron-S2PL induced long-lasting serum IgG antibodies;

[0035] Figure 13 Oral administration of AdV5-Omicron-S2PL induced long-lasting serum neutralizing antibodies;

[0036] Figure 14 Oral administration of AdV5-Omicron-S2PL induced long-lasting intestinal SIgA antibodies;

[0037] Figure 15 Oral administration of AdV5-Omicron-S2PL induced cross-reactive SIgA in the lung mucosa. DETAILED DESCRIPTION

[0038] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0039] Example 1

[0040] Construction of recombinant adenovirus plasmid

[0041] Using pUC57-CMV-Omi-S, pUC57-CMV-Omi-SL and pUC57-CMV-Omi-S2PL plasmids (50 ng / μl) as templates (synthesized by GenScript Biotech Co., Ltd.), primers were designed using SnapGene6.0.2 software to amplify the Omi-S, Omi-SL and Omi-S2PL target genes carrying the CMV promoter and purify them.

[0042] The nucleotide sequence of Omi-S carrying the CMV promoter (SEQ ID NO: 1) is as follows. The underlined lowercase letters are the CMV promoter sequence, and the uppercase letters are the kozak motif (underlined GCCACC )'s S gene sequence (SEQ ID NO: 2):

[0043] gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatg gagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaa taatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaac tgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggccc gcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgcta ttaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtct ccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactcc gccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagc tcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccccggctagagcttcccggggtttaaacttcgaa GCCACC

[0044] The nucleotide sequence of Omi-SL carrying CMV promoter and co-expressing adjuvant sequence (SEQ ID NO: 3) is as follows. The underlined lowercase letters in the first paragraph are CMV promoter sequences, and the uppercase letters are those containing kozak motif (underlined GCCACC ), the second paragraph of underlined lowercase letters is the polyA tail sequence, the third paragraph of underlined lowercase letters is the U6 promoter, and gaaacgatatgggctgaatacggatccgtattcagcccatatcgtttc is the adjuvant sequence:

[0045] gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatg gagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaa taatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaac tgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggccc gcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgcta ttaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtct ccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactcc gccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct cgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccccggctagagcttcccggggtttaaacttcgaa GCCACC ctgtgccttctagttgc cagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaat aaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaa gggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg TAACTATAACGGTCCTAAGGGAATTCAAGGTCGGGCAGGAA gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgtta gagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatt tcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttc gatttcttggctttatatatcttgtggaaaggacgaaacacc gaaacgatatgggctgaatacggatccgtattcagcccatatcgtttcTTTTTT.

[0046] The nucleotide sequence of Omi-S2PL carrying CMV promoter and co-expressing adjuvant sequence (SEQ ID NO: 4) is as follows. The underlined lowercase letters in the first paragraph are CMV promoter sequences, and the uppercase letters are those containing kozak motif (underlined GCCACC ) of the S2P gene sequence (SEQ ID NO: 5), the second paragraph of underlined lowercase letters is the polyA tail sequence, the third paragraph of underlined lowercase letters is the U6 promoter, and gaaacgatatgggctgaatacggatccgtattcagcccatatcgtttc is the adjuvant sequence (SEQ ID NO: 6):

[0047] gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatg gagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaa taatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaac tgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggccc gcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgcta ttaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtct ccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactcc gccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct cgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgggaccgatccagcctccccggctagagcttcccggggtttaaacttcgaa GCCACCctgtgccttctagttgc cagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaat aaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaa gggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg TAACTATAACGGTCCTAAGGGAATTCAAGGTCGGGCAGGAA gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgtta gagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatt tcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttc gatttcttggctttatatatcttgtggaaaggacgaaacacc gaaacgatatgggctgaatacggatccgtattcagcccatatcgtttcTTTTTT.

[0048] The vector backbone pKAd5ES-pmeI was linearized using PmeⅠ restriction endonuclease. The purified target gene and linearized vector backbone were homologously recombined using ClonExpressIIOne Step Cloning Kit to obtain three recombinant adenovirus plasmids. The vector linearization and homologous recombination system is as follows:

[0049] Table 1 Vector linearization system

[0050]

[0051] Linearization reaction conditions: 37°C, 2h; 65°C, 20min.

[0052] Table 2 Homologous recombination system

[0053]

[0054]

[0055] Homologous recombination reaction conditions: 37°C, 30 min.

[0056] In this part, we constructed recombinant adenoviral plasmids expressing native conformation S protein (Omi-S) and stable pre-fusion conformation S protein (Omi-S2P). Figure 1As shown in the figure, the expression cassette of the S protein gene containing the human CMV promoter was inserted into the E1 region of the E1 and E3-deficient pKAd5ES-pmeI. First, a replication-deficient type 5 recombinant adenovirus plasmid pKAd5ES-Omicron-S was generated, which can express the native conformation S protein of Omicron BA.1 in HEK293 cells. In order to adapt and enhance mucosal immunity, an endogenous dsRNA adjuvant was co-expressed using the U6 promoter to enhance the immune response. Here, a second recombinant adenovirus plasmid pKAd5ES-Omicron-SL was generated, which also expressed the native conformation S protein. The pKAd5ES-Omicron-S2PL recombinant adenovirus plasmid was further constructed by optimizing codons, deleting the furin enzyme cleavage site, and replacing two prolines at amino acid positions 983 and 984.

[0057] Example 2

[0058] In this example, pKAd5ES-pmeI, which does not contain any exogenous sequence, was used as a control. pKAd5ES-pmeI (1), pKAd5ES-Omicron-S (2), pKAd5ES-Omicron-SL (3) and pKAd5ES-Omicron-S2PL (4) were linearized using PacI. Figure 2 The results showed that the recombinant adenovirus plasmid linearized by PacⅠ was completely linearized by agarose gel electrophoresis and was ready for transfection into cells.

[0059] Table 3 PacⅠ vector linearization system

[0060]

[0061] Each linearized plasmid was transfected into HEK293 cells, and the transfection reagent used was: X-tremeGENE HP DNA Transfection Reagent. Operation steps: Before transfection, place the serum-free culture medium opti-MEM (Gibico) and X-trem transfection reagent at room temperature (25°C) for 15 minutes. Take a 1.5mL centrifuge tube in the safety cabinet and place it on the centrifuge tube rack, mark it, add 180μl opti-MEM, and then add 20μl of the plasmid system linearized by PacⅠ in the previous step, and mix gently. Place the X-trem transfection reagent on an oscillator to shake and mix, add 5μl of transfection reagent to each tube, and incubate at room temperature for 15 minutes. All the transfection complexes (205μl) at the end of incubation are added dropwise to the cells in the six-well plate, mix gently, and place at 37°C, 5% CO 2When more than 90% of the cells showed cytopathic effect (CPE), the cells were collected to obtain the primary virus (P0) (see Figure 3 ).

[0062] The P0 virus seed was inoculated into HEK293 cells in good growth state at a ratio of 1:10 for amplification and incubated at 37°C with 5% CO 2 Culture in an incubator. When more than 90% of cells show cytopathic effect, collect the cell supernatant and precipitate, and continue to inoculate HEK293 cells as P1 virus seed. Follow the above steps for cyclic amplification, and each time the virus liquid is harvested, it needs to be repeatedly frozen and thawed three times between room temperature (25°C) and -80°C until the third generation virus liquid (P3) is cultured, and the cell precipitate is retained by centrifugation at 2500rpm for 30min for purification.

[0063] The cell precipitate of each group of P3 virus solution was collected and repeatedly frozen and thawed three times at room temperature (25°C) to -80°C, centrifuged at 13000rpm for 30min, and the supernatant was collected for cesium chloride density gradient centrifugation (25000rpm, 2.5h). The virus band was carefully aspirated with a syringe and purified by desalting gel. The titer of recombinant adenovirus was determined by limiting dilution method. Electron microscopy results showed that the virus structure of each group was intact and uniform in size after purification, and could be used for subsequent experiments ( Figure 4 ).

[0064] Example 3

[0065] 1 Method

[0066] 1.1 Experimental animals, animal immunization and sample collection methods

[0067] The viruses prepared using pKAd5ES-pmeI (1), pKAd5ES-Omicron-S (2), pKAd5ES-Omicron-SL (3) and pKAd5ES-Omicron-S2PL (4) in Example 2 were named AdV5-empty, AdV5-Omicron-S, AdV5-Omicron-SL, and AdV5-Omicron-S2PL, respectively.

[0068] BALB / c mice were randomly divided into 4 groups: control group (AdV5-empty), S group (AdV5-Omicron-S), SL group (AdV5-Omicron-SL) and S2PL group (AdV5-Omicron-S2PL), with 6 mice in each group. Animal immunization was performed by oral gavage. Before immunization, mice were fasted for 12 hours. Each mouse was given 100 μl of gavage protection solution and then kept calm for 5 minutes before gavage with 100 μl of virus solution. 9 IU / piece.

[0069] Ingredients of intragastric protective solution ( / 100ml): 0.1g citric acid, 9.6g sodium citrate, 3.6g sucrose, 0.1g zinc chloride, and 0.19g sodium chloride.

[0070] Immunization schedule: 2 doses, initial immunization at week 0, and booster immunization 4 weeks later.

[0071] Blood and feces of mice were collected at specific time points (0-20 weeks) for ELISA detection of specific IgG and IgA antibodies and serum neutralization experiments. At the end of the experiment, the mice were euthanized, the spleen was isolated for ELISpot detection, and the alveolar lavage fluid was collected for specific secretory SIgA antibody detection.

[0072] Serum sample collection: Fresh blood was collected from the mandibular venous plexus of living BALB / c mice, mainly for the detection of binding antibodies (IgG) and neutralizing antibodies in serum. According to the sample dosage, the average blood volume per mouse was 100-300μl, and the serum was precipitated at room temperature for 2h. The serum was centrifuged at 2500rpm for 20min at room temperature, and the serum was collected after centrifugation (avoiding the collection of blood cells). The complement was inactivated at 56℃ for 30min. After aliquoting, it was stored at -80℃ to avoid repeated freezing and thawing of serum samples.

[0073] Fecal sample collection: Mainly used for SIgA antibody detection, collect fresh feces from mice in vivo. Add sterile PBS at 10% (mass / volume), vortex and shake, and after the feces are fully dissolved, centrifuge at 13000rpm, 4℃, and take the fecal supernatant. Place the sample in a metal bath at 56℃ for 30 minutes to inactivate complement. Store at -80℃ after aliquoting to avoid repeated freezing and thawing.

[0074] Bronchoalveolar lavage fluid (BALFs) collection: Mice were killed by cervical dislocation and then soaked in a solution containing 75% ethanol for moistening. The mice were fixed and a sterile PBS lavage solution containing 2% FBS was prepared. 800 μl of lavage solution was drawn using a 1 mL syringe and gavage hose to flush the lungs. The operation was repeated 3 times. The operation should be gentle and slow to avoid collecting blood cells. The collected BALFs were centrifuged at 400 × g for 5 min at 4°C, and the supernatant was used for SIgA antibody detection.

[0075] 1.2 Indirect ELISA for detection of serum IgG, fecal supernatant / BALFs SIgA and cross-reactive SIgA antibodies

[0076] 1.2.1 Mouse serum IgG antibody detection: ① Antibody coating: The bottom of the 96-well ELISA plate was coated with specific BA.1S protein, 3μg / mL, 100μl / well, covered with a sealing film, and incubated at 4℃ overnight for 16h. ② Washing: Discard the liquid in the 96-well plate, add 280μl 0.05% PBST to each well for washing, let it stand for 30s, repeat 3 times, discard the washing solution, and spin dry the 96-well plate. ③ Blocking: Add 180μl blocking buffer (5% skim milk + PBS) to each well and incubate in a 37℃ incubator for 2h. Discard the liquid in the well plate, spin dry the 96-well plate for later use. ④ Antibody incubation: Dilute the sample with sample diluent (2% skim milk + PBS), the starting concentration of the first well is 1:300, 3-fold dilution, 7 dilution gradients, and incubate at 37℃ for 1h. ⑤ Wash the plate: Wash the plate with 0.05% PBST for 5 times, 1 min / time, then dilute the HRP-labeled goat anti-mouse IgG antibody with sample diluent, the dilution ratio is 1:10000, and incubate at 37℃ for 1h. ⑥ Wash the plate: Wash the plate with 0.05% PBST for 5 times, 1 min / time, add 100μl / well of fresh TMB solution, color for 10min at room temperature in the dark, and terminate the reaction with 50μl 1M phosphoric acid. ⑦ Measure the absorbance (OD) value at 450nm and 630nm wavelengths with an enzyme marker.

[0077] 1.2.2 Fecal supernatant / BALFs SIgA antibody detection: ①-③ steps are the same as above. ④ Antibody incubation: dilute the sample with sample diluent (2% skim milk + PBS), the starting concentration of the first well is 1:5, 2-fold dilution, 7 dilution gradients, incubate at 37℃ for 1h. ⑤ Washing: Wash the plate with 0.05% PBST, 5 times, 1min / time, then dilute the HRP-labeled goat anti-mouse IgA antibody with sample diluent, the dilution ratio is 1:20000, incubate at 37℃ for 1h. ⑥~⑦ steps are the same as above.

[0078] 1.2.3 Cross-reactive SIgA antibody detection: The antigens coated on the ELISA plate (Delta, BA.1, BA.2, XBB, BA.4 / BA.5 / BA.5.2 and S protein of JN.1) were purchased from Sino Biological Biotech Co., Ltd. and used for cross-reactive SIgA antibody detection.

[0079] 1.3 Pseudovirus Neutralization Experiment Method

[0080] Sample dilution: Initial mouse serum diluted 1:30, 3-fold serial dilution of serum, 100 μl / well. Pseudovirus SARS-CoV-2-Fluc B.1.1.529 diluted to 10000 TCID 50 / mL, take 50 μl and add it to each experimental well and incubate with serum at 37°C, 5% CO 2Incubate in the incubator for 1 hour. After incubation, add 50 μl of 10 5 cells / mL of 293T-ACE2 cells. 37°C, 5% CO 2 Incubate in the incubator for 48 hours, then take out and equilibrate to room temperature, discard 100 μl of the supernatant in the white plate, add 100 μl of Bio-Lite luciferase reporter gene detection reagent equilibrated at room temperature, let it stand for 3 minutes, and then use a multifunctional microplate reader to detect the chemiluminescence value (RLU).

[0081] Negative and positive judgment criteria: Neutralization experiments require the setting of negative and positive controls to determine whether the experiment is successful. The negative control titer is less than 30, and the positive control titer is greater than 30 as the judgment value.

[0082]

[0083] The serum titer (50% serum inhibitory concentration, IC50) was expressed as the reciprocal of the serum dilution corresponding to 50% inhibition and was calculated using the Reed-Muench method.

[0084] 1.4 ELISpot method

[0085] Spleen lymphocyte collection: The mice were killed by cervical dislocation, and then soaked in a solution containing 75% ethanol for moistening. The spleen was removed and a spleen single lymphocyte suspension was prepared. The specific operation was as follows: ① The mouse spleen was placed in a 70μm cell sieve, and 5mL of mouse lymphocyte separation solution was placed in it. The spleen was ground in a 35mm culture dish (restored to room temperature and shaken before use). ② The spleen grinding liquid in the previous step was passed through a 40μm sieve, and the filtered grinding liquid was collected and transferred to a 15mL centrifuge tube. ③ Then 1mL of RPMI 1640 culture medium was slowly added to the upper layer of the liquid (keeping the liquid surface boundary clear). The 15mL centrifuge tube was transferred to a horizontal centrifuge and centrifuged at 800×g for 30min at room temperature, with a slower lifting and lowering speed. ④ After centrifugation, a clear lymphocyte layer interface will be formed at the liquid surface boundary, which will be aspirated out. ⑤ Aspirate the lymphocyte suspension, add 10 mL of RPMI 1640 medium, and gently invert to wash. Centrifuge at room temperature at 250 × g for 10 min to collect the cells. Pour off the supernatant, resuspend the cells in serum-free medium for broad-spectrum ELISpot (Dakoway), count the lymphocytes, and adjust the cell concentration to 4 × 10 6 cells / mL for future use.

[0086] ELISpot was used to detect the expression of IFN-γ cytokines in T cells. The operation steps are as follows: ① Activate the pre-coated PVDF plate: use 300 μl of RPMI 1640 medium, let it stand at room temperature for 10 minutes and then remove it. ② Add cell suspension: add 100 μl / well of cell suspension with adjusted concentration to the experimental well, set up 2 replicate wells; 2×10 5 cells / well, the cell density of the negative control well is consistent with that of the sample well. ③ Add stimuli: add 10μL / well of specific stimulatory peptide to the experimental well, add 10μL / well of positive stimuli (PMA500ng / mL+Ionomycin10μg / mL) to the positive control well, and add 10μL / well of medium for resuspending cells to the negative well. Incubation: 37℃, 5% CO2 incubator for 20 hours. ④ Lyse cells: add 200μl of ice-cold deionized water to each well, and place in a 4℃ refrigerator for 10min to lyse cells hypotonicly. Wash 260μl / well, 6 times, stay for 1min and discard the liquid in the well, and dry each time. ⑤ Detection antibody incubation: add the diluted biotin-labeled antibody working solution to each experimental well, 100μL / well, and incubate at 37℃ for 1 hour. Repeat the plate washing operation. ⑥ Add the diluted HRP-labeled enzyme-labeled avidin working solution to each experimental well, 100μL / well, and incubate at 37℃ for 1 hour. Repeat the plate washing for 5 times, and for the last time, uncover the base of the plate, rinse the bottom surface of the membrane and the base with deionized water, use absorbent paper to dry the remaining water marks on the base and the bottom of the membrane, close the base, add washing solution and stay for 1 minute, discard the liquid in the well, and dry it thoroughly. ⑦ Color development: Add the freshly prepared AEC color development solution to each experimental well, 100μL / well. Let it stand at room temperature and avoid light for 15 minutes, and choose the termination time of color development according to the spot generation situation. ⑧ Pour out the liquid in the well, uncover the base of the plate, wash the front and back sides and the base 3 times with deionized water / tap water, and terminate the color development. Place the plate in a cool place at room temperature (inverted), wait for it to dry naturally, and then close the base. ⑨ Use Bioreader to read the ELISpot plate data information, record various parameters of the spots, and perform statistical analysis.

[0087] 2 Experiments and Results

[0088] 2.1 dsRNA adjuvants enhance neutralizing antibody and mucosal antibody responses induced by recombinant adenovirus in oral immunization

[0089] In order to study the role and necessity of dsRNA sequences in vaccine vectors as TLR3 agonists (hereinafter referred to as "dsRNA adjuvants") for candidate vaccines in oral immunization, AdV5-Omicron-S and AdV5-Omicron-SL were used as candidate vaccines for immunization, and the subjects were randomly divided into an oral immunization group (oral) and an intramuscular immunization group (im). The im group received a single intramuscular injection with a virus injection dose of 5×10 8 IU / 50μl, injection volume 50μl / mouse. Oral group was treated as in part 1.1, and serum, feces, and spleen samples were collected at different time points after inoculation, and various indicators were measured according to methods 1.2 to 1.4.

[0090] 2.1.1 dsRNA adjuvants enhance neutralizing antibodies induced by recombinant adenovirus in oral immunization

[0091] The results of the test on the neutralizing antibody level in mouse serum at week 6 showed that both the oral group AdV5-Omicron-S and AdV5-Omicron-SL candidate vaccines induced specific neutralizing antibody levels. The neutralizing antibody level induced by the AdV5-Omicron-SL vaccine was significantly higher than that in the AdV5-pmeⅠ group (P<0.0001) and AdV5-Omicron-S (P<0.05), and was 2.46 times that of the AdV5-Omicron-S vaccine group. The average level of specific neutralizing antibody induced by the im group AdV5-Omicron-SL candidate vaccine was higher than that of AdV5-Omicron-S, but there was no statistical difference between the two candidate vaccines ( Figure 5 ).

[0092] 2.1.2 dsRNA adjuvants enhance mucosal antibody responses induced by recombinant adenovirus in oral immunization

[0093] This study found that the expression of SIgA in fecal samples reached its peak at the 5th week. To evaluate the expression level of SIgA secreted by the intestinal mucosa, samples at this time point were selected for testing. The results showed that no secretory SIgA expression was detected in the im group. Both the AdV5-Omicron-S and AdV5-Omicron-SL candidate vaccines in the oral group induced specific SIgA antibody expression, with the latter being 10 higher than the former. 1.5008 times, the difference is statistically significant ( Figure 6 ).

[0094] 2.2 Oral administration of AdV5-Omicron-S2PL induces stronger systemic and mucosal immune responses

[0095] Based on the above results, dsRNA adjuvants have beneficial effects in oral immunization. AdV5-Omicron-S2PL was formed by replacing and constructing antigens based on vectors carrying dsRNA sequences. AdV5-Omicron-SL and AdV5-Omicron-S2PL were used as candidate vaccines for immunization, and AdV5-pmeⅠ was used as a blank control.

[0096] The subjects were randomly divided into groups. Each group was given two doses of drugs by gavage, and serum, feces, and spleen samples were collected at different time points after inoculation. Same as Section 1.1.

[0097] Serum samples collected at weeks 6 and 9 were tested for pseudovirus neutralizing antibodies, and it was observed that the neutralizing antibody level gradually increased over time. In particular, at week 9, the neutralizing antibody titer of AdV5-Omicron-S2PL serum increased significantly and was 4.0443 times higher than that of the AdV5-Omicron-SL group, with a statistically significant difference (P < 0.05) ( Figure 7 ). In addition, the level of AdV5-Omicron-S2PL at week 9 increased 6.19-fold compared with that at week 6.

[0098] The intestinal mucosal immune response between the two groups was evaluated by detecting the expression level of SIgA in fecal samples. The results showed that both AdV5-Omicron-S2PL and AdV5-Omicron-SL candidate vaccines effectively induced the expression of S protein-specific SIgA antibodies, with the former being 10 higher than the latter. 1.65 times, the difference is statistically significant ( Figure 8 ).

[0099] The results of ELISpot detection of T cell immune response showed that every 10 6 An average of 482.5 IFN-γT cells were detected per splenic lymphocyte (95% CI, 242.4-722.6). 6 An average of 546.7 IFN-γT cells were detected per spleen lymphocyte (95% CI, 342.8-750.5), and the control group usually had no significant response (negligible) ( Figure 9 ).

[0100] 2.3 Oral administration of AdV5-Omicron-S2PL induces specific serum IgG and intestinal SIgA in a dose-dependent manner

[0101] In order to study the effect of vaccine dose on antibody levels, the subjects were randomly divided into four groups and received two doses of 1×10 7IU / piece, 1×10 8 IU / piece, 1×10 9 IU / pc and 1×10 10 IU / mouse (see Section 1.1 for immunization process), and samples were collected at multiple time points after vaccination. The results showed that IgG antibodies produced after vaccination ( Figure 10 ) and SIgA( Figure 11 )The antibody level shows a dose-dependent relationship with the vaccine dose administered.

[0102] For intestinal SIgA, the production of IgA antibodies was not effectively stimulated among the dose groups 3 weeks after the initial immunization. After booster immunization, we tested the IgA antibody levels at 5, 6, 9, and 12 weeks. The results showed that the IgA antibody level showed an overall upward trend with the increase of the vaccination dose. However, at 5 and 6 weeks, 10 9 and 10 10 There was no statistical difference in IgA antibody levels between the dose groups. 9 The IgA antibody level in the dose group was less than 10 10 The difference between the two groups was statistically significant (P<0.05). 9 Dose group and 10 10 The variation in the magnitude of the decline in IgA levels between the dose groups may explain why the difference between doses appeared during this period, but by week 12, this difference had disappeared.

[0103] 2.4 Oral administration of AdV5-Omicron-S2PL induces long-lasting specific serum IgG and intestinal SIgA

[0104] 1×10 9 The mice were immunized with a dose of 1×10 IU of viral infection titer. After vaccination, we regularly tested the IgG antibody level in the mouse serum and the SIgA antibody secretion in the intestine from the 3rd to the 20th week. The latter was analyzed by fecal samples. The experimental results showed that after vaccination, the IgG antibody level in the mouse serum increased significantly, up to 1×10 5 level and remained relatively stable over the next few weeks ( Figure 12 This high level of antibody maintenance indicates that the vaccine induces a strong humoral immune response and that this response can be maintained for a long time. Serum neutralizing antibody titers increased significantly after booster immunization, reaching a peak at week 8, and these values ​​were 4.50 times higher than those at week 6 (95% CI 1.43-7.57) ( Figure 13). Subsequently, the neutralizing antibody titer began to steadily decrease until the 16th week. The level of SIgA antibodies in the intestine also increased significantly after the second booster immunization, and then remained stable at a certain level until it began to slowly decrease at the 14th week. By the 20th week, the IgA antibody level had basically returned to the level before the second booster immunization ( Figure 14 ).

[0105] 2.5 Oral administration of AdV5-Omicron-S2PL induced cross-reactive SIgA in lung mucosal tissue

[0106] In an independent experiment, two doses of 1 × 10 9 BALB / c mice were immunized with the Ad5-Omicron-S2PL candidate vaccine at a dose of IU / mouse. The mice were killed at week 8 and bronchoalveolar lavage fluids (BALFs) were collected. The ELISA method was used to detect the level of SIgA in BALFs. The experiment found that oral administration can induce the production of mucosal SIgA, which has a higher affinity with the mother strain (the source strain of the vaccine antigen sequence) and shows the expression of cross-reactive SIgA. These SIgA bind to the spike proteins of SARS-CoV-2 variants Delta, BA.2, XBB, BA.4 / BA.5 / BA.5.2 and JN.1 ( Figure 15 ). According to the experimental results, no statistical differences were observed among the groups.

[0107] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for preparing an oral vaccine for a variant of the novel coronavirus B.1.1.529 with a built-in nucleic acid adjuvant, characterized in that: The steps include: (1) Using the S protein of the 2019-nCoV B.1.1.529 variant as the target gene, homologous recombination was performed with the adenovirus vector backbone to obtain a recombinant adenovirus plasmid; (2) the recombinant adenovirus plasmid is linearized by enzyme digestion and then transfected into cells. When more than 90% of the cells show cytopathic effect, the cells are collected to obtain the primary virus P0; (3) The primary virus P0 is continuously inoculated into cells and amplified and cultured until the P3 virus is obtained, the cell precipitate of the P3 virus is collected, and the virus liquid oral vaccine is obtained by repeated freezing and thawing.

2. The preparation method according to claim 1, characterized in that The S protein of the new coronavirus B.1.1.529 variant is Omi-S or Omi-S2P. The nucleotide sequence of Omi-S is shown in SEQ ID NO: 2, and the nucleotide sequence of Omi-S2P is shown in SEQ ID NO:

5.

3. The preparation method according to claim 2, characterized in that: The Omi-S and Omi-S2P respectively carry CMV promoters and then undergo homologous recombination with the adenovirus vector backbone.

4. The preparation method according to claim 3, characterized in that: The nucleotide sequence of Omi-S carrying the CMV promoter is shown in SEQ ID NO:

1.

5. The preparation method according to claim 4, characterized in that: The Omi-S and Omi-S2P respectively co-express an adjuvant sequence, and the adjuvant sequence is shown in SEQ ID NO: 6; the adjuvant sequence is co-expressed using the U6 promoter.

6. The preparation method according to claim 5, characterized in that: The nucleotide sequence of the target gene Omi-SL carrying the CMV promoter and co-expressing the adjuvant sequence is shown in SEQ ID NO:

3.

7. The preparation method according to claim 5, characterized in that: The nucleotide sequence of the target gene Omi-S2PL carrying the CMV promoter and co-expressing the adjuvant sequence is shown in SEQ ID NO:

4.

8. The preparation method according to any one of claims 1 to 7, characterized in that: The adenovirus vector backbone is pKAd5ES-pmeI.

9. An oral vaccine obtained by the preparation method according to any one of claims 1 to 8.

10. A recombinant adenovirus plasmid obtained by the preparation method according to any one of claims 1 to 8.

Images