Application of substance for reducing content or activity of PLOD2 protein in treatment of sarcoma-like renal cell carcinoma

Abstract

The invention discloses application of a substance for reducing the content or activity of PLOD2 protein in treatment of sarcoma-like renal cell carcinoma, and belongs to the field of biomedicine. According to the application disclosed by the invention, by inhibiting the content or activity of PLOD2 protein in the sarcoma-like renal cell carcinoma, the sarcoma-like renal cell carcinoma with low differentiation, high malignancy and high treatment tolerance is induced and differentiated into the epithelioid renal cell carcinoma with high differentiation, low malignancy and high treatment sensitivity, so that the treatment purpose is achieved. The substance for reducing the PLOD2 protein content or activity not only can be used for independently treating sarcoma-like renal cell carcinoma, but also can be used in combination with a traditional kidney cancer medicine, so that the sensitivity of the traditional kidney cancer medicine is improved. At present, no clear and effective treatment means exists for the sarcoma-like renal cell carcinoma, the lifetime of most patients is less than one year, a brand new treatment strategy and an intervention target are provided for the patients with the sarcoma-like renal cell carcinoma, and the application has an important clinical application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and in particular relates to the application of a substance capable of reducing the content or activity of PLOD2 protein in the treatment of sarcomatoid renal cell carcinoma. Background Art

[0002] Sarcomatoid renal cell carcinoma (sRCC) is a rare, extremely poorly differentiated, highly malignant, and extremely difficult to treat renal cell carcinoma. Its incidence accounts for only about 4-5% of all renal cell carcinomas. Due to its low incidence and limited research, there are no specific molecular markers so far, and the pathogenesis is even less known. Due to the lack of effective imaging diagnostic tools, current clinical diagnosis is almost entirely dependent on postoperative pathological examination of tissue morphology, and the effectiveness of preoperative biopsy is only about 7.5%.

[0003] sRCC is extremely malignant, progresses rapidly, and is prone to metastasis. Currently, there is no clear and effective treatment. Traditional renal cancer treatments (surgery, systemic drugs) have very limited efficacy on sRCC, and the vast majority of patients survive less than 1 year; survival periods of more than 1 year are usually only seen in early sRCC patients. However, even for early localized sRCC, about 80% of patients will relapse within 2 years after surgery. For decades, the survival rate of sRCC patients has hardly improved, and new treatment strategies are urgently needed. In contrast, patients with non-sarcomatoid (or epithelioid) renal cell carcinoma (non-sRCC / epithelioid RCC) have significantly better efficacy, and about 90% of early patients can be cured and have no recurrence five years after surgery.

[0004] sRCC tissue is usually composed of two malignant cell components: sarcomatoid and non-sarcomatoid (epithelioid) (non-sRCC). According to the 2016 WHO guidelines, renal cell carcinoma containing any number of sarcomatoid features can be diagnosed as sRCC. The current mainstream "common progenitor cell theory" believes that sarcomatoid tumor cells in sRCC originate from pre-existing well-differentiated epithelial cells, and gradually transform into sRCC cells through sarcomatoid dedifferentiation. Sarcomatoid dedifferentiation can occur in most subtypes of renal cell carcinoma, but because renal clear cell carcinoma (ccRCC) accounts for as much as 75% of RCC, the sarcomatoid renal clear cell carcinoma (sccRCC) subtype is the most common.

[0005] Sarcomatoid dedifferentiation is the direct cause of sRCC and the fundamental reason why the prognosis of sRCC patients is significantly lower than that of non-sarcomatoid RCC. The higher the content of sarcomatoid components, the greater the risk of death of the patient. According to statistics, for every 10% increase in sarcomatoid components, the risk of death of the patient will increase by about 6%.

[0006] Cell plasticity enables cells to switch between different states and acquire new phenotypic and functional characteristics, thereby promoting tumor initiation, progression, metastasis and therapeutic resistance. Cells achieve their plasticity through dedifferentiation (within the same lineage), transdifferentiation (lineage conversion) and epithelial-mesenchymal transition (EMT). Targeting tumor plasticity, such as inducing differentiation in poorly differentiated tumors, has been regarded as an important strategy for cancer treatment and has achieved remarkable success in the clinical treatment of blood cancers. The use of retinoic acid to induce differentiation in acute promyelocytic leukemia (APL) to differentiate APL cells into terminally differentiated granulocytes is a typical success story of this strategy. In the clinic, the combination of retinoic acid and arsenic acid treatment can cure more than 90% of APL patients, and even critically ill patients can achieve long-term survival through all-trans retinoic acid treatment. In contrast, differentiation induction in solid tumors is far more complex and challenging than leukemia, and there are very few successful cases. Summary of the invention

[0007] The technical problem to be solved by the present invention is how to treat sarcomatoid renal cell carcinoma.

[0008] In order to solve the above technical problems, the present invention first provides any of the following applications:

[0009] 1. The use of substances that knock out the PLOD2 gene or inhibit the expression of the PLOD2 gene in the preparation of products for the treatment of sarcomatoid renal cell carcinoma;

[0010] 2. Application of substances that knock out PLOD2 gene or inhibit PLOD2 gene expression in the treatment of sarcomatoid renal cell carcinoma;

[0011] 3. Use of substances that reduce the content or activity of PLOD2 protein in the preparation of products for the treatment of sarcomatoid renal cell carcinoma;

[0012] 4. The use of substances that reduce the content or activity of PLOD2 protein in the treatment of sarcomatoid renal cell carcinoma;

[0013] 5. Use of substances that knock out the PLOD2 gene or inhibit the expression of the PLOD2 gene in the preparation of products for the treatment of poorly differentiated renal cell carcinoma;

[0014] 6. Application of substances that knock out PLOD2 gene or inhibit PLOD2 gene expression in the treatment of poorly differentiated renal cell carcinoma;

[0015] 7. Use of substances that reduce the content or activity of PLOD2 protein in the preparation of products for the treatment of poorly differentiated renal cell carcinoma;

[0016] 8. Use of substances that reduce PLOD2 protein content or activity in the treatment of poorly differentiated renal cell carcinoma;

[0017] 9. Application of substances that knock out PLOD2 gene or inhibit PLOD2 gene expression in improving the sensitivity of renal cell carcinoma therapeutic drugs;

[0018] 10. Use of substances that knock out the PLOD2 gene or inhibit the expression of the PLOD2 gene in the preparation of products that improve the sensitivity of renal cell carcinoma therapeutic drugs;

[0019] 11. Application of substances that reduce PLOD2 protein content or activity in improving the sensitivity of renal cell carcinoma therapeutic drugs;

[0020] 12. Use of a substance that reduces the content or activity of PLOD2 protein in the preparation of a product for improving the sensitivity of renal cell carcinoma therapeutic drugs.

[0021] In the above application, the treatment of sarcomatoid renal cell carcinoma can be embodied in any one of X1)-X5):

[0022] X1) inhibiting tumor growth of sarcomatoid renal cell carcinoma;

[0023] X2) Inducing the transformation of sarcomatoid renal cell carcinoma tissue into epithelial renal cell carcinoma tissue;

[0024] X3) Induces transformation of sarcomatoid renal cell carcinoma cells into epithelioid renal cell carcinoma cells;

[0025] X4) Reduce the stemness of sarcomatoid renal cell carcinoma cells;

[0026] X5) induces mesenchymal-epithelial transition (MET) in renal cell carcinoma cells.

[0027] In the above application, the renal cell carcinoma therapeutic drug can be axitinib, doxorubicin, gemcitabine, IFN-α, everolimus or an anti-angiogenic drug.

[0028] In the above application, the substance that reduces the PLOD2 protein content or activity can be any substance that can specifically reduce the PLOD2 protein content or activity, such as PLOD2 antibodies, PLOD2 protein inhibitors, etc. In one embodiment of the present invention, the substance that reduces the PLOD2 protein content or activity is minoxidil.

[0029] The substance for knocking out the PLOD2 gene or inhibiting the expression of the PLOD2 gene may be a substance for editing the PLOD2 gene, such as a substance that specifically recognizes the PLOD2 gene in a common gene editing system. In one embodiment of the present invention, the gene editing system is a CRISPR / Cas9 system, and the substance that specifically recognizes the PLOD2 gene is an sgRNA targeting the PLOD2 gene. In one embodiment of the present invention, the target sequence of the sgRNA is 5'-ATATTTCAATTATACTGTGA-3' (SEQ ID No. 3); 5'-GTAGCAACAAAAGAAAGTGA-3' (SEQ ID No. 4); 5'-GTTGTGGCTGAGAAGATGAG-3' (SEQ ID No. 5).

[0030] The substance that knocks out the PLOD2 gene or inhibits the expression of the PLOD2 gene can also change its expression level by affecting the upstream or downstream signals of the PLOD2 gene, such as regulating the activity of transcription factors, and can also reduce the expression level of the PLOD2 gene by methods such as RNA interference (RNAi).

[0031] The present invention also provides a product, which contains Y1):

[0032] Y1) The substance for knocking out PLOD2 gene or inhibiting PLOD2 gene expression or the substance for reducing PLOD2 protein content or activity.

[0033] The above product may also contain Y2): Y2) a drug for treating renal cell carcinoma.

[0034] The product may be (or its active ingredient may be) the above-mentioned Y1). The product may also be (or its active ingredient may be) the above-mentioned Y1) and Y2).

[0035] When the product does not contain Y2), it can be used as a sensitizer for renal cell carcinoma therapeutic drugs (such as axitinib, doxorubicin, gemcitabine, IFN-α, everolimus or anti-angiogenic drugs), and can also be a drug for treating renal cell carcinoma. When the product contains Y1) and Y2), it can be a drug for treating renal cell carcinoma.

[0036] The present invention also provides a drug sensitizer for treating renal cell carcinoma, which contains (or its active ingredient may be) the substance for knocking out PLOD2 gene or inhibiting PLOD2 gene expression or the substance for reducing PLOD2 protein content or activity.

[0037] In the present invention, the renal cell carcinoma may be, but is not limited to, clear cell renal cell carcinoma, chromophobe renal cell carcinoma, and papillary renal cell carcinoma.

[0038] The present invention found that by inhibiting the expression / activity of PLOD2 in sarcomatoid renal cell carcinoma, poorly differentiated, highly malignant, and highly resistant sarcomatoid renal cell carcinoma can be induced to differentiate into highly differentiated, low-malignant, and highly sensitive epithelial renal cell carcinoma, thereby achieving the therapeutic purpose. On the one hand, the present invention can be used for the sole treatment of sarcomatoid renal cell carcinoma to directly inhibit tumor growth and metastasis; on the other hand, it can also be used in combination with traditional renal cancer therapies (axitinib, doxorubicin, gemcitabine, IFN-α, everolimus or anti-angiogenic drugs, etc.) to improve the sensitivity to traditional renal cancer treatments. There is currently no clear and effective treatment for sarcomatoid renal cell carcinoma, and the survival period of most patients is less than 1 year. The present invention provides a new treatment strategy and intervention target for patients with sarcomatoid renal cell carcinoma, and has important clinical application prospects.

[0039] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Schematic diagram of multi-omics screening for potential drivers of sarcomatoid dedifferentiation in ccRCC, based on the three main characteristics of sarcomatoid dedifferentiation ccRCC patients.

[0041] Figure 2 To compare the expression of PLOD family members in normal and tumor tissues and show their association with prognosis in the TCGA ccRCC cohort. OS: overall survival.

[0042] Figure 3 .Transcriptome sequencing of sarcomatoid renal cell carcinoma cells showed the expression of the other six candidate factors before and after PLOD2 knockout.

[0043] Figure 4 . Western blot detection results of PLOD2 expression in various cell lines.

[0044] Figure 5 .The expression of PLOD2 in clinical sample data from TCGA and CPTAC databases. PLOD2 protein indicates the PLOD2 protein content.

[0045] Figure 6 .Immunohistochemical validation results of clinical samples. H-score of PLOD2 indicates the PLOD2 content score.

[0046] Figure 7.The expression of PLOD2 in sarcomatoid and non-sarcomatoid components. H-score of PLOD2 indicates the PLOD2 content score.

[0047] Figure 8 .The expression of PLOD2 in the sarcomatoid component and non-sarcomatoid component in patient 1. The upper figure is the result of HE staining, and the lower figure is the expression of PLOD2 detected by immunohistochemical staining.

[0048] Fig. 9 . Expression of PLOD2 in sarcomatoid and non-sarcomatoid components in patient 2. The upper figure is the result of HE staining, and the bar on the far left is 1 mm; the lower figure is the expression of PLOD2 detected by immunohistochemical staining, and the bar on the far left is 1 mm.

[0049] Fig.10 .The expression of PLOD2 in the sarcomatoid component and non-sarcomatoid component in patient 3. The upper figure is the HE staining result, and the lower figure is the expression of PLOD2 detected by immunohistochemical staining.

[0050] Fig.11 .The expression of PLOD2 in the sarcomatoid component, non-sarcomatoid component and transitional area of ​​3 sRCC patients. H-score of PLOD2 indicates the PLOD2 content score.

[0051] Fig.12 .PLOD2 knockout causes sRCC cells to differentiate into epithelial-like cells.

[0052] Fig.13 .TCGA analysis showed the expression of PLOD2 in sarcomatoid and non-sarcomatoid chromophobe renal cell carcinoma.

[0053] Fig.14.PLOD2 promotes sarcomatoid dedifferentiation of ccRCC. (A) Western blot and RT-qPCR showed the effect of PLOD2 overexpression on the expression of stemness markers (DCLK1, CD44, ALDH1A1 and β-catenin) and epithelial markers (CD10, CA9 and MUC1) in 769-P eccRCC cells. (B) Flow cytometry evaluation of the proportion of SP cells in control and PLOD2-overexpressing 769-P eccRCC cells, stained with Hoechst 33342, with or without verapamil treatment. The gated cells in the figure represent SP cells. (C) Flow cytometry measurement of ALDH1A1 staining intensity and the proportion of ALDH1A1+ cancer stem cells in control and PLOD2-overexpressing 769-P eccRCC cells. (D) Western blot and RT-qPCR showed the effect of PLOD2 overexpression on the expression of EMT markers in 769-P eccRCC cells. The control in AD is the epithelial ccRCC cell line 769-P. (E) Western blot and RT-qPCR analysis of the effects of PLOD2 knockout on cancer cell stemness and epithelial differentiation markers in 786-O sccRCC cells. (F) Flow cytometry evaluation of the proportion of SP cells in the control group and PLOD2-deficient 786-O sccRCC cells, stained with Hoechst33342, with or without verapamil treatment. (G) Flow cytometry measurement of ALDH1A1 staining intensity and the proportion of ALDH1A1+ cancer stem cells in the control group and PLOD2-deficient 786-O sccRCC cells. (H) Immunofluorescence staining analysis of stemness markers (DCLK1 and ALDH1A1) and epithelial differentiation markers (CA9 and AQP1) in the control group and PLOD2-deficient 786-O sccRCC cells. (I) Western blot and RT-qPCR were used to evaluate the expression of EMT markers in the control group and PLOD2-deficient 786-O sccRCC cells. (J) Immunofluorescence staining was used to analyze the EMT markers in the control group and PLOD2-deficient 786-O sccRCC cells. (K) Heat map of RNA-seq data showed the effect of PLOD2 deficiency on cancer cell stemness, epithelial differentiation, and EMT markers in 786-O sccRCC cells. The control in EK was sarcomatoid renal cell carcinoma cell 786-O. Data are expressed as mean ± SD. Statistical analysis was performed by unpaired two-sided Student's t test [(A), (C), (D), (E), (G), and (I)].

[0054] Fig.15 Gene Ontology (GO) analysis of genes altered by PLOD2 loss showed significant enrichment for processes related to sRCC biology.

[0055] Fig.16 Potential association of PLOD2 with sarcomatoid dedifferentiation in chromohobe RCC. (A) TCGA analysis showing the expression of PLOD2 in sarcomatoid and non-sarcomatoid chromophobe RCC. (B) Correlation between PLOD2 expression and mesenchymal characteristics (defined by mesenchymal markers Vimentin, Snai1, and ZEB1) in chromophobe RCC samples from TCGA. Data were analyzed by Pearson's correlation test.

[0056] Fig.17 .PLOD2 deficiency induces sccRCC differentiation and improves therapeutic response. (A) Representative images showing the effect of PLOD2 deficiency on epithelial differentiation of 786-O-derived sccRCC nude mouse xenografts by IHC, HE, and Masson staining. (B) and (C) IHC staining analysis of epithelial differentiation, cancer cell stemness, and EMT markers in control and PLOD2-deficient sccRCC xenografts. (D) and (E) Correlation of PLOD2 expression with AQP1 and stemness markers in TCGA, CPTAC, and GSE73731 ccRCC patients. (F) TCGA analysis showing the relationship between cancer cell dedifferentiation and tumor stage and overall survival of ccRCC patients. (G) Tumor growth curves of sccRCC xenografts in the control and PLOD2-deficient groups. (H) IHC analysis showing the expression of Ki-67 in sccRCC nude mouse xenografts in the control and PLOD2-deficient groups. (I) Correlation between PLOD2 and Ki-67 in TCGA, CPTAC, and GSE73731 ccRCC patients. (J) CCK8 analysis of the effect of PLOD2 loss on the sensitivity of 786-O sccRCC cells to doxorubicin, gemcitabine, and IFN-α. (K) The effect of PLOD2 loss on sccRCC growth and sensitivity to axitinib treatment was evaluated, and tumor growth curves and weights were compared (n = 5). Data in the figures are expressed as mean ± SD. Statistical analysis included Pearson correlation test [(D), (E), and (I)], chi-square test (F, left), log-rank test (F, right), two-sided one-way ANOVA and Tukey test (K), or unpaired two-sided Student's t test [(G) and (H)].

[0057] Fig.18Minoxidil, a pharmacological targeted inhibitor of PLOD2, induces differentiation of sccRCC and enhances its sensitivity to treatment. (AB) Western blot and RT-qPCR analysis of the effects of minoxidil treatment on cancer cell stemness, epithelial differentiation, and EMT in 786-O sccRCC cells. (C) IHC analysis of the expression of epithelial differentiation markers CA9 and AQP1, cancer cell stemness markers ALDH1A1 and DCLK1, and EMT markers in 786-O-derived sccRCC xenografts treated with minoxidil and control. (D) HE and IHC evaluation of the effects of minoxidil on the tissue morphology of 786-O-derived sccRCC xenografts. In areas with more residual PLOD2, the tissue morphology tended to be more sarcomatoid, while in areas with less residual PLOD2, the morphology tended to be more epithelial. (E) CCK8 assay to evaluate the effects of minoxidil combination therapy on the sensitivity of sccRCC to doxorubicin, gemcitabine, and IFN-α. The abscissa is the concentration of doxorubicin, gemcitabine, and IFN-α. (F) CompuSyn calculated the synergy index (CI), with a CI value <1 indicating synergy and a CI value <0.1 indicating very strong synergy. (G) IHC analysis of the effect of minoxidil treatment on the Ki-67 index of sccRCC xenografts. (H) Tumor growth curves and tumor weight measurements were used to evaluate the effect of minoxidil (6 mg / kg) on ​​the growth of sccRCC xenografts and the effect on the sensitivity of axitinib (5 mg / kg) treatment (n=4). The data in the figures are expressed as mean ± SD. Statistical analysis included unpaired two-sided Student's t test [(A), (B), and (G)], or two-sided one-way ANOVA and Tukey test (H). DETAILED DESCRIPTION

[0058] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples are all repeated at least three times, and the results are averaged.

[0059] Statistical analysis: Statistical analyses were performed using R (version 4.2.2) or GraphPad Prism (version 8.4.0) unless otherwise stated. Overall, comparisons between two groups were performed using a two-sided Student's t test or Wilcoxon rank sum test, and comparisons between multiple groups were performed using a one-way ANOVA test with Tukey's post hoc test. The chi-square test was used to compare categorical variables. Kaplan-Meier curves were drawn and differences were assessed by log-rank test using the "survival" and "survminer" R packages. Correlation analysis was performed using the Pearson correlation coefficient. Data are expressed as mean ± standard deviation (SD). p values ​​less than 0.05 were considered statistically significant, and the symbols are as follows: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0060] Immunohistochemistry (IHC) and Multiplex Fluorescence IHC:

[0061] Tumor tissues were fixed with 4% paraformaldehyde and then embedded in paraffin. Tissues were sliced ​​into 4 μm slices for IHC analysis. First, the slices were dewaxed in xylene for 30 min and then dehydrated in a gradient alcohol series, 5 min per step. Antigen retrieval was performed by EDTA or citric acid treatment (ZSGB-BIO, China). They were then blocked with goat serum for 30 min at room temperature. The sections were then incubated with the following primary antibodies at 4°C overnight: anti-PLOD2 antibody (1:200, Proteintech), anti-CA9 antibody (1:100, Proteintech), anti-AQP1 antibody (1:3000, Proteintech), anti-ALDH1A1 antibody (1:100, Proteintech), anti-DCLK1 antibody (1:300, Cell Signaling Technology), anti-E-cadherin antibody (1:100, Cell Signaling Technology), anti-ZO-1 antibody (1:100, Proteintech), anti-vimentin antibody (1:100, Cell Signaling Technology), anti-Snail antibody (1:100, Proteintech), or anti-Ki67 antibody (1:150, ZSGB-BIO). The signals were then enhanced using enzyme-labeled goat anti-mouse or anti-rabbit IgG polymers (ZSGB-BIO, China). IHC staining was developed using DAB substrate (ZSGB-BIO, China) and observed under an optical microscope (Olympus Corporation, Tokyo, Japan). IHC staining scores were determined using SlideViewer 2.8 software (3DHISTECH, Hungary).

[0062] For multiplex fluorescent IHC, patient samples were processed using a 4-color manual IHC kit (Akoya, USA) according to the manufacturer's instructions. The primary antibodies used for primary staining were anti-human PLOD2 antibody (1:150, Proteintech) and anti-human DCLK1 antibody (1:100, Cell Signaling Technology). Cell nuclei were stained with DAPI (Solarbio, Beijing, China). Images were acquired using a PANNORAMIC Midi II digital slide scanner (3DHISTECH, Hungary) and exported using SlideViewer2.8.

[0063] HE staining and Masson's trichrome staining:

[0064] In the HE staining step, the sections were incubated in hematoxylin for 2 minutes and then counterstained with eosin for 3 minutes. Masson trichrome staining (Solarbio, Beijing, China) was performed according to the manufacturer's instructions. Images were collected by a biological microscope (Leica, Germany) and a PANNORAMIC Midi II digital slide scanner (3DHISTECH, Hungary).

[0065] Flow Cytometry:

[0066] The cells were resuspended in cold PBS containing 2% FBS at a density of 1×10^6 cells / mL. To determine ALDH1A1 expression, cells were fixed with 4% paraformaldehyde (Solarbio, Beijing, China) for 15 minutes at room temperature. After fixation, the cells were centrifuged at 3000 rpm for 5 minutes and the supernatant was discarded. The cells were permeabilized with 0.1% Triton X-100 (Beyotime Biotechnology, China) for 10 minutes at room temperature, followed by incubation with ALDH1A1 primary antibody (1:100, Proteintech, China) for 30 minutes at room temperature, followed by incubation with fluorescently labeled secondary antibody (1:100 dilution) for 30 minutes in the dark. To detect side population (SP) cells, the cells were divided into two groups. One group was stained with Hoechst 33342 dye (KeyGEN BioTECH, China) at a concentration of 5 μg / ml and incubated at 37°C with gentle agitation for 90 minutes. Another group of cells were pre-treated with 50 μM Verapamil (Glpbio, USA) for 20 minutes and then stained with Hoechst dye at 37°C for 90 minutes. After washing twice with PBS containing 2% FBS, the cells were stained with 7-aminoactinomycin D (7-AAD, BD Biosciences, USA) at a concentration of 2 μg / ml. The fluorescence at 450 and 670 nm was measured by flow cytometry (BD LSRFortessa, USA) to distinguish between SP and non-side population (NSP) cells, and the data were analyzed by FlowJo software version 10.8.1 (BD Biosciences, USA).

[0067] Immunofluorescence Assay:

[0068] Immunofluorescence analysis used antibodies such as anti-DCLK1 (1:100, Cell Signaling Technology), anti-ALDH1A1 (1:100, Proteintech), anti-CA9 (1:100, Proteintech), anti-AQP1 (1:100, Proteintech), anti-ZO-1 (1:1000, Proteintech), anti-Snail (1:250, Proteintech), and anti-N-cadherin (1:500, CellSignaling Technology). The experimental steps are as follows: cells were seeded in 24-well plates at a density of 2×10^4 per well, and fixed in 4% paraformaldehyde solution (Solarbio, Beijing, China) for 10 minutes after attachment for 24 hours. After fixation, permeabilization with 0.2% Triton X-100 was performed at room temperature for 10 minutes. After blocking with goat serum for 30 minutes, incubation with primary antibodies was performed overnight at 4°C. Subsequently, the samples were incubated with fluorescent dye-labeled secondary antibodies (1:200 dilution) in a dark room for 1 h and stained with DAPI (Solarbio, Beijing, China) for 5 min. The final images were taken by fluorescence microscopy (Olympus, Japan).

[0069] Human clear cell renal carcinoma cell lines 786-O, 769-P, OS-RC-2, Caki-1 and human embryonic kidney cell line HEK293T were obtained from the National Certified Cell Bank (Beijing, China). The 786-O cell line is currently the only ccRCC cell line that can form sarcomatoid ccRCC xenografts. 786-O, 769-P and OS-RC-2 cells were cultured in RPMI-1640 medium (SIGMA, Vienna, Austria). Caki-1 cells were cultured in McCoy's 5A medium (KeyGEN BioTECH, Jiangsu, China), and HEK293T cells were cultured in DMEM medium (Gibco, California, USA). Normal human renal epithelial cells HK-2 were maintained in DMEM / F-12 medium (Gibco, California, USA). All media were supplemented with 10% fetal bovine serum (FBS, Ausbian, Australia) and 1% penicillin-streptomycin mixture (Solarbio, Beijing, China). All cell lines were cultured at 37°C in a humidified atmosphere with 5% CO2.

[0070] Clinical tissue samples of ccRCC patients with or without sarcomatoid features used in the following examples were obtained from Beijing Chaoyang Hospital affiliated to Capital Medical University. All samples were reviewed by a dedicated urogenital pathologist to confirm the presence of sarcomatoid / epithelioid components. This study was approved by the Ethics Committee of Beijing Chaoyang Hospital, and all participants signed informed consent in accordance with the Declaration of Helsinki.

[0071] All animal experiments were approved by the Capital Medical University Laboratory Animal Care and Use Committee. Mice used in the experiments were purchased from Beijing Weitonglihua Laboratory Animal Company and housed under specific pathogen isolation conditions.

[0072] The antibodies used in the following examples and the names of their selling companies are as follows:

[0073] PLOD2 antibody: Proteintech (21214-1-AP);

[0074] DCLK1 antibody: Cell Signaling Technology (D2U3L);

[0075] CD44 antibody: Cell Signaling Technology (156-3C11);

[0076] β-catenin antibody: Cell Signaling Technology (D10A8);

[0077] ALDH1A1 antibody: Proteintech (15910-1-AP);

[0078] CD10 antibody: Proteintech (18008-1-AP);

[0079] CA9 antibody: Proteintech (66243-1-AP);

[0080] AQP1 antibody: Proteintech (20333-1-AP);

[0081] MUC1 antibody: Proteintech (23614-1-AP);

[0082] ZO1 antibody: Cell Signaling Technology (D7D12);

[0083] E-Cadherin antibody: Cell Signaling Technology (4A2);

[0084] N-Cadherin antibody: Cell Signaling Technology (D4R1H);

[0085] Vimentin antibody: Cell Signaling Technology (D21H3);

[0086] Snail antibody: Cell Signaling Technology (C15D3);

[0087] GAPDH antibody: Cell Signaling Technology (14C10);

[0088] β-actin antibody: Proteintech (81115-1-RR);

[0089] HRP-labeled Goat Anti-Rabbit IgG(H+L): Beyotime(A0208);

[0090] HRP-labeled Goat Anti-Mouse IgG (H+L): Beyotime (A0216).

[0091] The primers involved in the following examples are shown in Table 1.

[0092] Table 1. Primer information

[0093]

[0094] Among them, E-Cadherin can be abbreviated as E-Cad, Vimentin can be abbreviated as Vim, and N-Cadherin (N-cadherin) can be abbreviated as N-Cad.

[0095] Example 1: Screening potential molecular markers for sarcomatoid renal cell carcinoma using multi-omics data

[0096] In this example, the transcriptome and proteome data of ccRCC in the TCGA and CPTAC databases were used to screen potential regulatory factors that promote sarcomatoid dedifferentiation of ccRCC based on the three key features of sarcomatoid dedifferentiation (low differentiation, high EMT, and poor prognosis). Figure 1 ).

[0097] Clinical information and high-throughput RNA sequencing data of ccRCC patients were obtained from UCSC Xena (https: / / xenabrowser.net / datapages / ). Expression values ​​were expressed in FPKM (fragments per kilobase) and logarithmically transformed using log2(FPKM+1) for statistical analysis. Clinical information and proteomic expression data of ccRCC patients were obtained from the Clinical Proteomic Tumor Analysis Consortium (CPTAC) through Proteomic Data Commons (PDCStudyID: PDC000411) at https: / / proteomic.datacommons.cancer.gov / . TCGA and CPTAC ccRCC patient information containing sarcomatoid annotations was referenced from previous studies (Zuo Y, Fu S, Zhao Z, et al. Sarcomatoid-associated gene risk index for clear cell renal cell carcinoma. Front Genet. 2022. 13: 985641.; Li Y, Lih TM, Dhanasekaran SM, et al. Histopathologic and proteogenomic heterogeneity reveals features of clear cell renal cell carcinoma aggressiveness. Cancer Cell. 2023. 41 (1): 139-163. e17.). Gene expression profiles of other ccRCC samples and xenograft samples from renal cancer patients were downloaded from Gene Expression Omnibus (GEO, access number GSE73731 and GSE78806) at https: / / www.ncbi.nlm.nih.gov / geo / .

[0098] The heatmaps in this study were generated by the “ComplexHeatmap” R package. Survival analysis was performed using the “survminer” R package. The EMT score was based on the gene definition in a previous study (Mak MP, Tong P, Diao L, et al. A Patient-Derived, Pan-Cancer EMT Signature Identifies Global Molecular Alterations and Immune Target Enrichment Following Epithelial-to-Mesenchymal Transition. Clin Cancer Res. 2016. 22 (3): 609-20.), and the stemness score was calculated using the previously identified ccRCC-specific stemness markers CD44, CXCR4, and MET (Fendler A, Bauer D, Busch J, et al. Inhibiting WNT and NOTCH in renal cancer stem cells and the implications for human patients. Nat Commun. 2020. 11 (1): 929.). The formulas for calculating the EMT score and stemness score are as follows:

[0099]

[0100]

[0101] To screen candidate drivers of sarcomatoid dedifferentiation in RCC, the inventors analyzed transcriptomic data of ccRCC patients from TCGA and proteomic data of ccRCC patients from CPTAC based on the three characteristics of sarcomatoid dedifferentiation ccRCC: poor differentiation, high EMT, and poor prognosis. All analyses were performed using R software (version 4.2.2). The Wilcoxon rank sum test was used to identify differentially expressed genes that were gradually upregulated during ccRCC dedifferentiation (p value < 0.05, FDR < 0.05). In ccRCC patient samples, Pearson correlation analysis was used to identify genes that were significantly positively correlated with EMT scores (r> 0.35, adjusted p value < 0.0001). The "survminer" R package was used to screen genes associated with poor overall survival in ccRCC patients (p value < 0.05). Finally, genes overlapping with “poor differentiation,” “high EMT,” and “poor prognosis” analyses at both mRNA and protein levels in TCGA and CPTAC data were considered as candidate drivers of sarcomatoid dedifferentiation in RCC.

[0102] Screening revealed that all three genes of the lysine hydroxylase (PLOD) family (PLOD1, PLOD2, PLOD3) appeared in the final list of 13 candidate genes, suggesting that the genes of this family are more closely related to ccRCC sarcomatoid dedifferentiation. Among the three genes, PLOD2 has the highest expression level, the largest upregulation, and the highest relative risk (HR) of death in patients with ccRCC, with an HR of 2.51 ( Figure 2 ), the inventors prioritized PLOD2 as the priority validation target. The reliability of this choice was in turn supported by subsequent RNA-seq analysis in sccRCC cells, which showed that the loss of PLOD2 could simultaneously lead to a significant decrease in the expression of the other six candidate driver factors ( Figure 3 ).

[0103] Example 2: PLOD2 is significantly overexpressed in sarcomatoid renal cell carcinoma cell lines and patient tissues

[0104] The cell lines tested were: normal renal proximal tubule cell line HK-2, epithelioid renal clear cell carcinoma cell lines OS-RC-2, 769-P, Caki-1, and sarcoma-like renal clear cell carcinoma cell line 786-O.

[0105] Western blot was used to detect the expression of PLOD2 in each cell. The antibodies used were PLOD2 antibody (Proteintech, 21214-1-AP) and β-actin antibody (Proteintech, 81115-1-RR). The secondary antibody was horseradish peroxidase-labeled secondary antibody (1:8000, ZSGB-BIO, China). Cell line level verification found that the expression of PLOD2 in sarcomatoid renal clear cell carcinoma cell line was significantly higher than that in epithelial renal clear cell carcinoma cell line and normal renal cell line ( Figure 4 ).

[0106] The clinical sample data validation in TCGA and CPTAC databases also showed that the expression of PLOD2 in sarcomatoid renal cell carcinoma tissues was significantly higher than that in adjacent normal tissues ( Figure 5 ).

[0107] The inventors collected clinical samples for immunohistochemical verification and PLOD2 content scoring statistics, and also found that the expression of PLOD2 in sarcomatoid renal clear cell carcinoma tissue was significantly higher than that in epithelial renal clear cell carcinoma tissue ( Figure 6 ).

[0108] Example 3: PLOD2 expression increases with the progression of sarcomatoid dedifferentiation in renal cell carcinoma

[0109] Sarcomatoid renal cell carcinoma tissue generally contains two tumor cell components, epithelial and sarcomatoid. In order to further show the expression of PLOD2 in the sarcomatoid and epithelial components in the same sRCC tissue, the inventors performed HE staining, immunohistochemical staining and scoring statistics on 6 patient tissues containing obvious epithelial and sarcomatoid components.

[0110] The results showed that the expression of PLOD2 in the sarcoma-like component was significantly higher than that in the adjacent epithelial-like component and adjacent normal renal tissue ( Figure 7 The inventors specifically demonstrated three typical cases: Patient 1 ( Figure 8 )、Patient 2( Fig. 9 )、Patient 3( Fig.10 ). Immunohistochemical staining showed that PLOD2 could specifically recognize the sarcomatoid component in sarcomatoid renal cell carcinoma tissue, and the inventors found that the expression of PLOD2 in the epithelial-sarcomatoid transition zone was between the epithelial area and the sarcomatoid area ( Figure 8-11 ), indicating that with the progression of sarcomatoid dedifferentiation in RCC, PLOD2 expression gradually increased, which further illustrates the specificity of PLOD2 in recognizing sarcomatoid components.

[0111] Example 4: PLOD2 knockout can cause sarcomatoid renal cell carcinoma to differentiate into epithelial-like

[0112] To further verify the reliability of PLOD2 as a molecular marker for sarcomatoid renal cell carcinoma, the inventors knocked out PLOD2 in sarcomatoid renal cell carcinoma cell line 786-O. Through HE staining and Masson staining, it was found that the nude mouse transplanted tumor changed from a typical sarcoma-like morphology to a clear cell-like epithelial morphology, and an epithelial morphology similar to that of normal renal proximal tubules appeared ( Fig.12 ), further confirming the key role of PLOD2 in the sarcomatoid transformation of RCC, which in turn supports the reliability of PLOD2 as a molecular marker for sRCC.

[0113] CRISPR / Cas9-mediated PLOD2 gene knockout:

[0114] The expression of PLOD2 gene was precisely knocked out by CRISPR / Cas9 technology. The single guide RNA (sgRNA) sequence targeting PLOD2 was synthesized, annealed and inserted into the upstream of the sgRNA backbone in the lentiCRISPRv2 vector to obtain three recombinant vectors, all of which could transcribe the sgRNA targeting PLOD2. The three recombinant vectors were co-transfected into HEK293T cells with the packaging vectors psPAX2 and pMD2.G using Lipofectamine 3000 (Invitrogen, Carlsbad, California, USA) to produce lentiviral particles. After 48-72 hours of transfection, the three recombinant lentiviruses were collected and purified through a 0.45μm filter membrane. Subsequently, the three recombinant lentiviruses were mixed and infected with ccRCC cells 786-O. Three days after infection, 2μg / ml puromycin (Gibco, USA) was used to screen out the cell line with stable knockout of PLOD2 gene. The obtained cell line was detected by Western Blot, and the PLOD2 protein content was significantly decreased compared with 786-O cells. The three PLOD2-specific sgRNA target sequences are as follows: PLOD2-sgRNA-1: 5'-ATATTTCAATTATACTGTGA-3' (SEQ ID No. 3); PLOD2-sgRNA-2: 5'-GTAGCAACAAAAGAAAGTGA-3' (SEQ ID No. 4); PLOD2-sgRNA-3: 5'-GTTGTGGCTGAGAAGATGAG-3' (SEQ ID No. 5).

[0115] Example 5: PLOD2 is also a molecular marker for sarcomatoid dedifferentiation in other subtypes of renal cell carcinoma

[0116] Renal cell carcinoma includes common subtypes such as renal clear cell carcinoma, chromophobe renal cell carcinoma, and papillary renal cell carcinoma. The above studies are mainly focused on renal clear cell carcinoma subtypes. In addition, analysis of PLOD2 expression in TCGA chromophobe renal cell carcinoma patient samples showed that two of the three patients with clear annotations of sarcomatoid dedifferentiation had significantly higher PLOD2 expression than all patients with annotations of non-sarcomatoid ( Fig.13 ), indicating that PLOD2 is likely to be a universal molecular marker for the sarcomatoid dedifferentiation phenotype of various subtypes of renal cell carcinoma.

[0117] Example 6: PLOD2 drives sarcomatoid dedifferentiation of ccRCC

[0118] Epithelial RCC cells acquire a sarcomatoid phenotype through progressive dedifferentiation and EMT activation. To explore the role of PLOD2 in sarcomatoid dedifferentiation, the inventors overexpressed PLOD2 in the epithelial ccRCC cell line 769-P, which has low PLOD2 expression.

[0119] Overexpression of human PLOD2:

[0120] Overexpression of PLOD2 was achieved by using the pLV(Exp)-mCherry / Neo-EF1A>hPLOD2 lentiviral vector (Cat. No.: VB900122-1045uaw) from Yunzhou Biotech (Guangzhou) Co., Ltd. (Guangzhou, China). pLV(Exp)-mCherry / Neo-EF1A>hPLOD2 contains the PLOD2 gene coding sequence shown in SEQ ID No.1 and can express the PLOD2 protein shown in SEQ ID No.2.

[0121] PLOD2 gene coding sequence (SEQ ID No.1):

[0122] ATGGGGGGATGCACGGTGAAGCCTCAGCTGCTGCTCCTGGCGCTCGTCCTCCACCCCTGGAATCCCTGTCTGGGTGCGGACTCGGAGAAGCCCTCGAGCATCCCCACAGATAAATTATTAGTCATAACT GTAGCAACAAAAGAA AGTGA TGGATTCCATCGATTTATGCAGTCAGCCAA ATATTTCAATTATACTGTGA

[0123] PLOD2 protein (SEQ ID No. 2):

[0124] .

[0125] The obtained recombinant vector pLV(Exp)-mCherry / Neo-EF1A>hPLOD2 was co-transfected with packaging plasmids pMD2G and psPAX2 into HEK293T cells to produce lentiviral particles. The obtained lentivirus was transfected into ccRCC cells 769-P. Three days after transfection, 400 μg / mL G418 was used to select stable cell lines with overexpression of PLOD2.

[0126] Western Blot and qPCR were used to detect the expression of PLOD2 and stemness markers and epithelial markers in the obtained cell lines. The results showed that stemness markers such as DCLK1, CD44, ALDH1A1 and β-catenin were significantly upregulated, while ccRCC-related epithelial markers CD10, CA9 and MUC1 were significantly downregulated ( Fig.14 A), indicating that the cells have undergone a dedifferentiation process. Flow cytometry analysis showed an increase in the proportion of side population (SP) cells ( Fig.14 Middle B), ALDH1A1 staining intensity increased, and the proportion of ALDH1A1+ cancer stem cells increased ( Fig.14 Middle C), further verifying that PLOD2 overexpression enhanced the cancer stemness of epithelial-like ccRCC cells.

[0127] In addition to promoting cell dedifferentiation, overexpression of PLOD2 also activated the EMT program in epithelial ccRCC cells. This was reflected in the decreased expression of epithelial markers E-cadherin and ZO-1 and the increased expression of mesenchymal markers vimentin, Snail, and N-cadherin proteins, which were verified at the mRNA and protein levels ( Fig.14 Middle D). These results indicate that PLOD2 both promotes dedifferentiation and activates EMT in epithelial ccRCC cells, emphasizing its role in sarcomatoid dedifferentiation.

[0128] To further verify the functional necessity of PLOD2 in ccRCC sarcomatoid dedifferentiation, the inventors knocked out PLOD2 in sccRCC cells (786-O) (the cells tested were the cell lines with stable PLOD2 gene knockout obtained in Example 4). The results showed that the stemness of the cancer cells was significantly reduced, while epithelial differentiation was increased, which can be clearly seen from the changes in the expression of molecular markers ( Fig.14 In addition to ccRCC-related epithelial markers, the inventors also observed a significant increase in AQP1, a molecular marker specific for normal renal proximal tubular epithelial cells, from which ccRCC originates ( Fig.14 Middle E).

[0129] Flow cytometry results showed that the proportion of SP cells was significantly reduced ( Fig.14 Middle F), ALDH1A1 staining intensity decreased, and the proportion of ALDH1A1+ cancer stem cells decreased ( Fig.14 These findings were further supported by immunofluorescence staining, which showed a significant decrease in the stemness markers DCLK1 and ALDH1A1, while a significant increase in the epithelial differentiation markers CA9 and AQP1 ( Fig.14 Middle H).

[0130] These results indicate that PLOD2 knockdown can reduce cancer cell stemness and promote differentiation toward an epithelial phenotype in sccRCC cells, highlighting the value of PLOD2 as a potential therapeutic target for reversing sarcomatoid dedifferentiation in ccRCC.

[0131] It should be noted that specific markers for sccRCC have not yet been identified. However, based on existing literature, the inventors found that high expression of CA9 (an epithelial marker associated with ccRCC) and AQP1 (a specific marker for the proximal tubules of the kidney) may characterize the differentiation status of sccRCC at the molecular level: (1) Although CA9 is significantly upregulated during ccRCC tumor formation, its expression gradually decreases during ccRCC dedifferentiation. More importantly, recent studies have shown that in the same sccRCC tissue, CA9 expression in the epithelial component is higher than that in the sarcoma-like component. (2) ccRCC originates from the proximal tubules of the normal kidney, and AQP1 is a specific marker for the proximal tubules. This suggests that the expression of AQP1 can help assess the degree of differentiation of ccRCC. In fact, high expression of AQP1 was significantly correlated with the high differentiation level of ccRCC, a finding that was also verified by TCGA and CPTAC data.

[0132] EMT plays a key role in maintaining the sarcomatoid morphology of sccRCC. Fig.14 I) and immunofluorescence staining ( Fig.14 In Figure 5 (J), we observed that knockout of PLOD2 in sccRCC cells significantly reversed EMT, with increased expression of epithelial markers (E-cadherin and ZO-1) and decreased expression of mesenchymal markers (vimentin, Snail, and N-cadherin).

[0133] In addition, in PLOD2-deficient sccRCC cells, the inventors' RNA sequencing data also showed significant changes in the expression of molecular markers associated with cancer cell stemness, epithelial differentiation, and EMT ( Fig.14 Middle K). Gene ontology (GO) analysis showed that the gene changes caused by PLOD2 deficiency were significantly enriched in processes related to sRCC biology, including the establishment of cell polarity, stem cell differentiation, tubular development, and mitotic cell cycle G2 / M transition ( Fig.15 These results further confirm the critical role of PLOD2 in driving the molecular events of sarcomatoid dedifferentiation in ccRCC.

[0134] In addition, TCGA analysis of chromophobe RCC subtype samples showed that PLOD2 expression was significantly higher in three patients annotated as sarcomatoid dedifferentiation than in all 22 patients annotated as non-sarcomatoid ( Fig.16 PLOD2 was also significantly associated with the stromal characteristics of the chromophobe renal cell carcinoma subtype ( Fig.16 These results suggest that PLOD2 is a key regulator of sarcomatoid dedifferentiation in multiple RCC types.

[0135] Example 7: PLOD2 knockout induces sccRCC differentiation and improves therapeutic response

[0136] Pathological morphological examination is the gold standard for diagnosing sRCC. To further explore the effect of PLOD2 knockout on sccRCC differentiation, the inventors performed histopathological analysis of sarcomatoid tumor masses derived from 786-O cells in mice.

[0137] A total of 5×10^6 control cells (sarcomatoid renal cell carcinoma cell 786-O) or PLOD2 knockout sccRCC cells (cell line with stable knockout of PLOD2 gene obtained in Example 4) were injected into the back region of 4-week-old male NOD / Scid nude mice to establish sccRCC xenograft tumor models with or without PLOD2. Mice were killed 40 days after transplantation, and tumors were removed for detection.

[0138] HE staining showed that the spindle sarcoma-like appearance of sccRCC was significantly reversed to a clear cell epithelial morphology after PLOD2 knockout. Fig.17 In addition, Masson staining showed that cytoplasm-rich proximal tubule-like structures appeared in PLOD2-deficient sccRCC xenografts, similar to normal kidney tissue ( Fig.17 (A).

[0139] These morphological changes were accompanied by a significant increase in the differentiation markers CA9 and AQP1 and a significant decrease in the stemness markers ALDH1A1 and DCLK1, which were validated by IHC analysis in PLOD2-deficient sccRCC xenografts ( Fig.17 Further IHC analysis also showed a significant decrease in EMT markers, indicating the induction of mesenchymal-epithelial transition (MET) ( Fig.17 These in vivo results further confirm that PLOD2 knockout drives sccRCC differentiation toward an epithelial-like morphology (eccRCC) by reducing cancer cell stemness, enhancing epithelial differentiation, and inducing MET.

[0140] Analysis of patient sample data from TCGA, CPTAC, and GSE73731 showed that there was a significant negative correlation between PLOD2 and the epithelial differentiation marker AQP1 ( Fig.17 D), and showed a significant positive correlation with specific ccRCC stemness markers (CXCR4+MET+CD44+) ( Fig.17 Middle E), supporting a dedifferentiation role for PLOD2 in ccRCC.

[0141] In ccRCC, poor differentiation is directly associated with rapid tumor progression and poor survival ( Fig.17 In this example, PLOD2 knockout-induced sccRCC differentiation significantly inhibited tumor growth ( Fig.17 G), accompanied by a significant decrease in the Ki-67 proliferation index ( Fig.17 These results were confirmed in a nude mouse subcutaneous xenograft tumor model. In addition, PLOD2 expression was significantly correlated with Ki-67 levels in the TCGA, CPTAC, and GSE73731 datasets ( Fig.17 Middle I).

[0142] Sarcomatoid dedifferentiation is associated with resistance to cytotoxic chemotherapy and anti-angiogenic therapy. Sarcomatoid renal cell carcinoma cell 786-O or PLOD2 knockout sccRCC cells (cell lines with stable PLOD2 gene knockout obtained in Example 4) were treated with doxorubicin, gemcitabine and IFN-α (α interferon). The results showed that PLOD2 knockout-induced differentiation significantly enhanced the sensitivity of sccRCC cells to doxorubicin, gemcitabine and IFN-α, as shown by a significant decrease in IC50 values ​​( Fig.17 In xenograft mouse model experiments, intervention with PLOD2 alone showed stronger anti-tumor effects than the anti-angiogenic drug axitinib ( Fig.17 In addition, combining PLOD2 intervention with axitinib significantly enhanced the sensitivity of sccRCC xenografts to axitinib ( Fig.17 K). The experimental steps of the xenograft tumor mouse model are as follows: a total of 5×10^6 control cells (sarcomatoid renal cell carcinoma cell 786-O) or sccRCC cells with PLOD2 knockout (cell line with stable PLOD2 gene knockout obtained in Example 4) were injected into the back area of ​​4-week-old male NOD / Scid nude mice to establish sccRCC xenograft tumor models with or without PLOD2. The mice were killed 40 days after transplantation, and the tumor xenografts were cut into approximately 4 mm 3The sccRCC xenografts were transplanted into the right abdomen of 4-week-old male BALB / C nude mice. When the sccRCC xenografts reached the specified size, each tumor-bearing mouse was randomly divided into two groups (n=5 per group) and treated with DMSO or 5 mg / kg / day of axitinib, respectively. The mice were killed 40 days after tumor transplantation, and the tumors were removed to measure the size and weight, and the tumor volume was monitored before the mice were killed. DMSO was administered by intraperitoneal injection, and axitinib was administered by gavage.

[0143] These findings suggest that PLOD2 plays a key role in sarcomatoid dedifferentiation and therapeutic resistance in sccRCC, and targeting PLOD2 may become a new strategy to improve the efficacy of existing treatments.

[0144] Example 8: Minoxidil, a pharmacologically targeted inhibitor of PLOD2, drives sccRCC differentiation and increases its sensitivity to treatment

[0145] Minoxidil is an FDA-approved drug for the treatment of androgenetic alopecia and was recently discovered to be an inhibitor of PLOD2. To explore whether pharmacological targeting of PLOD2 could bring therapeutic benefits to sccRCC patients, the inventors treated sccRCC cells with minoxidil.

[0146] 1. Drug sensitivity test

[0147] Sarcomatoid renal cell carcinoma cells 786-O were seeded in 96-well plates (2000 cells per well) and cultured in a humidified incubator with 5% CO2. CCK8 analysis was performed after treatment with different concentrations of doxorubicin (MedChemExpress, China), gemcitabine (MedChemExpress, China) or everolimus (MedChemExpress, China) for 48 hours, or IFN-α (Genscript, USA) for 72 hours. For the combination drug experiment, pre-cultured 786-OsccRCC cells (2000 cells per well) were treated with different concentrations of therapeutic drugs and low doses (0.25mM and 0.5mM) of minoxidil (MedChemExpress, China) for 48 hours. CCK8 reagent (Lablead, China) was then mixed with 90μL RPMI-1640 medium and incubated at 37°C for 1 hour, and the absorbance was measured at 450nm. Cell viability was expressed in %, and the calculation formula was: [(OD value of the experimental group - OD value of the blank group) / (OD value of the control group - OD value of the blank group)] × 100%. Data analysis was performed using GraphPad 8.0 software (GraphPad, San Diego, California), and the combination index (CI) was calculated using CompuSyn software version 1.0. CI < 1 indicated synergistic effect, and CI < 0.1 indicated extremely strong synergistic effect.

[0148] The results showed that minoxidil treatment (0.5 mM) significantly increased the expression of epithelial differentiation markers in ccRCC, while significantly reduced the expression of cancer stemness and EMT markers, which was confirmed by in vitro Western blot and RT-qPCR analysis ( Fig.18 A and B), and further confirmed by IHC staining of tumor tissues from in vivo xenograft experiments ( Fig.18 These molecular changes were accompanied by significant epithelial differentiation in approximately 60% of sccRCC xenograft tumors ( Fig.18 In areas with more PLOD2 residues, the tissue morphology tends to be sarcomatous, while in areas with less PLOD2 residues, the morphology tends to be more epithelial ( Fig.18 D). The in vivo xenograft experiment steps are as follows: 5×10^6 786-O cells were injected into the back region of 4-week-old male NOD / Scid nude mice to establish a sccRCC xenograft tumor model. The mice were killed 40 days after transplantation, and the tumor xenografts were cut into approximately 4 mm 3 The sccRCC xenografts were transplanted into the right abdomen of 4-week-old male BALB / C nude mice. When the sccRCC xenografts reached the specified size, the tumor mice were randomly divided into two groups (n=5 in each group) and given DMSO or 6 mg / kg / day minoxidil by gavage. The mice were killed 40 days after tumor transplantation and the tumors were removed for detection.

[0149] To evaluate whether the combination of minoxidil and conventional drugs can enhance therapeutic sensitivity, the inventors treated sccRCC cells with two milder minoxidil doses of 0.25mM and 0.5mM. When used alone, it did not cause significant cell death. It was then used in combination with doxorubicin, gemcitabine and IFN-α. The results showed that minoxidil significantly enhanced the tumor killing effect of all three drugs at both doses and showed synergistic effects. The results of the combination index (CI) calculated by CompuSyn showed that all CI values ​​were <1 ( Fig.18 E and F).

[0150] 2. In vivo xenograft experiments

[0151] To investigate the effect of PLOD2 knockout on sccRCC biology, a total of 5 × 10^6 control cells (sarcomatoid renal cell carcinoma cell 786-O) or PLOD2 knockout sccRCC cells (cell line with stable knockout of PLOD2 gene obtained in Example 4) were injected into the dorsal region of 4-week-old male NOD / Scid nude mice to establish sccRCC xenograft tumor models with or without PLOD2. Mice were sacrificed 40 days after transplantation, and tumor xenografts were excised and cut into approximately 4 mm 3The sccRCC xenografts were transplanted into the right abdomen of 4-week-old male BALB / C nude mice. When the sccRCC xenografts reached the specified size, the tumor mice were randomly divided into two groups (n=5 in each group) and given DMSO or 5 mg / kg / day of axitinib by gavage. The tumor size was monitored and recorded every two days, and the tumor volume was calculated according to the following formula: tumor volume = (tumor length × tumor width 2) / 2.

[0152] For in vivo combination therapy experiments, BALB / C nude mice bearing 786-O-derived sccRCC xenografts of comparable size were randomly divided into four groups (n=4 per group): one group received DMSO (control group), one group received 6 mg / kg / day minoxidil, one group received 5 mg / kg / day axitinib, and the other group received 6 mg / kg / day minoxidil combined with 5 mg / kg / day axitinib. DMSO and minoxidil were administered by intraperitoneal injection, and axitinib was administered by oral gavage.

[0153] In the sccRCC xenograft mouse model, minoxidil (6 mg / kg) alone significantly reduced the Ki-67 index ( Fig.18 G) and tumor growth rate ( Fig.18 H), while combined minoxidil treatment significantly increased the sensitivity of sccRCC xenografts to axitinib (a therapy targeting angiogenesis) ( Fig.18 These findings suggest that PLOD2 is a promising pharmacological target for future sRCC treatment, and minoxidil combined with conventional treatment may be a more effective strategy for the management of sccRCC.

[0154] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of substances that knock out the PLOD2 gene or inhibit the expression of the PLOD2 gene in the preparation of products for the treatment of sarcomatoid renal cell carcinoma; or use in the treatment of sarcomatoid renal cell carcinoma.

2. Use of a substance that reduces the content or activity of PLOD2 protein in the preparation of a product for treating sarcomatoid renal cell carcinoma; or use of a substance in the treatment of sarcomatoid renal cell carcinoma.

3. The use according to claim 1 or 2, characterized in that: The treatment of sarcomatoid renal cell carcinoma is embodied in any one of X1)-X5): X1) inhibiting tumor growth of sarcomatoid renal cell carcinoma; X2) Inducing the transformation of sarcomatoid renal cell carcinoma tissue into epithelial renal cell carcinoma tissue; X3) Induces transformation of sarcomatoid renal cell carcinoma cells into epithelioid renal cell carcinoma cells; X4) Reduce the stemness of sarcomatoid renal cell carcinoma cells; X5) induces mesenchymal-epithelial transition in renal cell carcinoma cells.

4. Use of substances that knock out the PLOD2 gene or inhibit the expression of the PLOD2 gene in the preparation of products for the treatment of poorly differentiated renal cell carcinoma; or use in the treatment of poorly differentiated renal cell carcinoma.

5. Use of a substance that reduces the content or activity of PLOD2 protein in the preparation of a product for treating poorly differentiated renal cell carcinoma; or use of a substance in the treatment of poorly differentiated renal cell carcinoma.

6. Use of a substance that knocks out the PLOD2 gene or inhibits the expression of the PLOD2 gene in improving the sensitivity of renal cell carcinoma therapeutic drugs, or in the preparation of a product that improves the sensitivity of renal cell carcinoma therapeutic drugs.

7. Use of a substance that reduces the content or activity of PLOD2 protein in improving the sensitivity of a drug for treating renal cell carcinoma, or in the preparation of a product for improving the sensitivity of a drug for treating renal cell carcinoma.

8. A product containing Y1): Y1) A substance that knocks out the PLOD2 gene or inhibits the expression of the PLOD2 gene, or a substance that reduces the content or activity of the PLOD2 protein.

9. The product according to claim 8, characterized in that: The product also contains Y2): Y2) Drugs for the treatment of renal cell carcinoma.

10. A drug sensitizer for the treatment of renal cell carcinoma, comprising a substance that knocks out the PLOD2 gene or inhibits the expression of the PLOD2 gene or a substance that reduces the content or activity of the PLOD2 protein.

Images