Application of VISTA protein or gene as drug target for preventing and treating central nervous system diseases

Abstract

The invention discloses application of VISTA protein or gene as a drug target for preventing and treating central nervous system diseases. The VISTA protein or gene can intervene in activation regulation of microglial cells, the phagocytic ability of the microglial cells can be enhanced by inhibiting the activity and / or expression quantity of the VISTA protein, beta amyloid protein deposition in an extracellular environment of a central nervous system is reduced, the problem of cognitive memory function degeneration is solved, and the cognitive memory function degeneration effect is improved. Therefore, the incidence and the incidence process of central nervous system diseases such as Alzheimer's disease can be delayed. Therefore, the VISTA protein or gene can be used as a target spot for developing, screening or preparing medicines for preventing and treating central nervous system diseases, and has a wide application prospect in the field of prevention and treatment of nervous diseases.

Description

Technical Field

[0001] The present invention belongs to the technical field of drug development, and specifically relates to the application of VISTA protein or gene as a drug target for preventing and treating central nervous system diseases. Background Art

[0002] Microglia are resident macrophages of the central nervous system that develop from the embryonic yolk sac and invade the central nervous system before the blood-brain barrier is fully healed in early embryonic development. Microglia have two morphologies: resting branching and activated ameba, which help them adapt to different functional needs, such as pruning synapses, secreting or responding to cytokines and chemokines, supporting neural networks, phagocytizing cell debris and precipitating proteins. Immune checkpoint blockade therapy has become a focus of research as a new cancer treatment. Immune regulation is achieved by targeted inhibition of immune checkpoints, especially negative immune checkpoint regulators, such as PD-1, TIGIT, LAG-3, etc. VISTA, a V-domain immunoglobulin inhibitor of T cell activation, is a type I transmembrane protein that has great homology with programmed death ligand 1 (PD-L1) and belongs to the B7 protein family. VISTA can act as a ligand or receptor and is mainly expressed in myeloid cells.

[0003] At present, the functional characteristics and mechanism of action of VISTA in the maintenance of central nervous system homeostasis and diseases, especially in the pathogenesis of aging-related neurodegenerative diseases such as Alzheimer's disease (AD), are still unclear. At present, the treatment of Alzheimer's disease mainly focuses on the removal of beta-amyloid plaques in patients. The intervention time is in the middle and late stages of the disease development, which has caused irreversible damage to neurons. Understanding it from the perspective of neuroinflammation also provides new ideas for the development of diagnostic and intervention methods.

[0004] Starting from neuroinflammation, the present invention regulates microglial activity through VISTA, enhances the clearance of amyloid beta (Aβ), and reduces neurotoxicity, thereby delaying the onset of neurodegenerative diseases such as Alzheimer's disease and the abnormal deposition of pathogenic proteins and the progression of neuronal damage, providing direction and basis for the development of therapeutic drugs and treatment methods for central nervous system diseases. Summary of the invention

[0005] In view of this, one of the objects of the present invention is to provide the use of the protein VISTA as a target in the development, screening or preparation of drugs, the functions of which include any one or more of the following: 1) enhancing the phagocytic ability of microglia; 2) reducing the deposition of amyloid-β in the extracellular environment of the central nervous system; 3) improving the deterioration of cognitive memory function.

[0006] Furthermore, the VISTA protein is a protein whose amino acid sequence is shown in SEQ ID NO.1 or a protein encoded by a nucleotide sequence shown in SEQ ID NO.2.

[0007] The second object of the present invention is to provide an agent for inhibiting the activity and / or expression of VISTA protein for use in the preparation of a drug, wherein the functions of the drug include any one or more of the following: 1) enhancing the phagocytic ability of microglia; 2) reducing the deposition of amyloid-β protein in the extracellular environment of the central nervous system; 3) improving the deterioration of cognitive memory function.

[0008] Furthermore, the reagent is selected from VISTA antibodies, siRNAs, shRNAs, antisense molecules targeting VISTA gene sequences, or gene editing vectors that inhibit VISTA gene expression.

[0009] Furthermore, the gene editing vector is an expression vector comprising siRNAs, shRNAs, and antisense molecules.

[0010] Furthermore, the target site sequence targeting the VISTA gene sequence is: GAACCCTGCTCCTTGCTATTT.

[0011] Furthermore, the VISTA protein is a protein whose amino acid sequence is shown in SEQ ID NO.1 or a protein encoded by a nucleotide sequence shown in SEQ ID NO.2.

[0012] The third object of the present invention is to provide an application of VISTA protein in the preparation of products, the functions of which include any one or more of the following: 1) preparing an animal model with reduced phagocytic ability of microglia; 2) preparing an animal model with abnormal deposition of β-amyloid protein in the extracellular environment of the central nervous system as a pathological feature; 3) preparing an animal model with deterioration of cognitive memory function; 4) preparing an animal model of related diseases caused by reduced phagocytic ability of microglia; 5) reducing the phagocytic ability of microglia; 6) promoting the deposition of β-amyloid protein in the extracellular environment of the central nervous system; 7) promoting the deterioration of cognitive memory function.

[0013] Furthermore, the VISTA protein is a protein whose amino acid sequence is shown in SEQ ID NO.1 or a protein encoded by a nucleotide sequence shown in SEQ ID NO.2.

[0014] The present invention provides a target capable of intervening in the regulation of microglial activation, namely, VISTA protein. By inhibiting the activity and / or expression of VISTA protein, the phagocytic ability of microglia can be enhanced, the deposition of amyloid-β in the extracellular environment of the central nervous system can be reduced, and the degeneration of cognitive memory function can be improved, thereby delaying the onset and progression of central nervous system diseases such as Alzheimer's disease. Therefore, VISTA protein or gene can be used as a target for the development, screening or preparation of drugs for the prevention and treatment of central nervous system diseases, and has broad application prospects in the field of neurological disease prevention and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a schematic diagram of immunofluorescence expression of VISTA in microglia of the present invention;

[0016] Figure 2 This is a picture of Thio S immunofluorescence staining of mouse brain slices of the present invention;

[0017] Figure 3 This is a graph showing the qPCR expression detection results of VISTA knockdown of the present invention;

[0018] Figure 4 The phagocytic ability of VISTA knocked down microglial cell line BV2 to PHrodo is analyzed by flow cytometry and statistical graphs;

[0019] Figure 5 The cognitive memory ability of 5xFAD mice knocked out by VISTA of the present invention was significantly improved. DETAILED DESCRIPTION

[0020] The present invention will be described in detail below in conjunction with the examples, which are merely illustrative and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples, and any modifications and variations made without violating the spirit of the present invention should be included within the scope of the present invention. The experimental materials or reagents used in the following examples are commercially available unless otherwise specified. The mice used in the experiments in the following examples were all 14 weeks old.

[0021] Example 1: Immunofluorescence staining experiment of the expression difference of VISTA in AD and healthy mice

[0022] 1.1 Objective: To determine the difference in VISTA expression between AD mice (5xFAD model) and healthy mice. The 5xFAD mouse model was provided by the Institute of Brain Science and Brain Diseases, Chongqing Medical University; healthy C57 mice were purchased from the Animal Center of Chongqing Medical University.

[0023] 1.2 Markers: Aβ amyloid plaques labeled with X-34, microglia labeled with IbaI, and VISTA protein labeled with VISTA antibody.

[0024] 1.3 Experimental methods:

[0025] (1) After the mice were anesthetized with isoflurane, PBS was perfused into the heart and the left brain was isolated;

[0026] (2) Place the half-brain tissue in 4% PFA and fix for 24 h;

[0027] (3) Dehydrate the half brain tissue in 30% sucrose for 72 h;

[0028] (4) Embed half of the brain tissue with OCT, freeze it in a -80°C refrigerator, and make 40 μm frozen sections;

[0029] (5) Wash the sections twice in 0.05% TBST, 5 min each time;

[0030] (6) Punching: The slices were placed in TBSX containing 1% TritonX-100 and punched for 30 min;

[0031] (7) Block with 5% donkey serum at room temperature for 30 min;

[0032] (8) Wash with TBST three times, 5 min each time;

[0033] (9) Incubate the primary antibody at 4°C overnight. The ratio is as follows:

[0034] VISTA antibody (biolegend #143702, anti amerien hamster, 1:100)

[0035] IBaI antibody (HUABIO#T1705-78, anti Rabbit, 1:500)

[0036] Antibodies were diluted proportionally with TBS containing 1% BSA, 0.1% cold fish skin gelatin, and 0.5% triton x-100;

[0037] (10) Wash with TBST three times, 5 min each time;

[0038] (11) Incubate the secondary antibody at room temperature for 1 hour. The preparation ratio is as follows:

[0039] Goat anti Amerien hamster FL488,1:400

[0040] Goat anti Rabbit, FL561,1:800

[0041] X-34, FL405, 1:2000

[0042] Antibodies were diluted proportionally with TBS containing 1% BSA, 0.1% cold fish skin gelatin, and 0.5% triton x-100;

[0043] (12) Wash three times with TBST, 5 min each time;

[0044] (13) After the slices are mounted and dried, anti-fluorescence quenching agent is added to seal the slices;

[0045] (14) Observe with a confocal 40x objective lens.

[0046] 1.4 Experimental results:

[0047] like Figure 1 The immunofluorescence image of VISTA expression in microglia shown in the figure records Aβ amyloid plaques labeled with X-34, microglia labeled with IbaI, and VISTA protein labeled with VISTA antibody. It can be seen that VISTA signal is mainly co-localized with microglial IBaI signal, and the co-localization phenomenon is more obvious around X-34 positive plaques, and the expression level of VISTA is also higher, indicating that VISTA in the central nervous system is mainly expressed in microglia, and affects microglia in the pathological development of Alzheimer's disease, showing a significant high expression feature. Conclusion: The expression level of VISTA in microglia is closely related to the deposition of β-amyloid protein in AD, and has a potential role in the pathological development of AD.

[0048] Example 2: Immunofluorescence staining of VISTA knockout on the development of Aβ pathology in AD

[0049] 1.1 Objective: To understand the effect of VISTA knockout on the pathogenesis of Aβ in AD. The 5xFAD mouse model was provided by the Institute of Brain Science and Brain Diseases, Chongqing Medical University; the VISTA knockout mouse model (VISTA - / - ) was provided by the School of Laboratory Medicine, Chongqing Medical University. - / - The mouse model was hybridized to obtain 5xFAD and 5xFAD; VISTA - / - Two mouse models were used for the immunofluorescence staining experiments described below.

[0050] 1.2 Marker: Aβ amyloid plaques labeled with Thio S.

[0051] 1.3 Experimental method of immunofluorescence staining of brain tissue sections:

[0052] (1) Preparation of frozen sections, the preparation method is the same as that in Section 1.3 of Example 1;

[0053] (2) Wash the sections twice in PBS, 5 min each time;

[0054] (3) 0.05% Thio S (dissolved in 50% ethanol) incubated at room temperature for 8 min;

[0055] (4) Wash with 80% ethanol for 15 seconds;

[0056] (5) Wash with ddH2O 5 times, 5 min each time;

[0057] (6) Wash twice with PBS, 5 min each time;

[0058] (7) After the slices are mounted and dried, anti-fluorescence quenching agent is added to seal the slices;

[0059] (8) Scanner 10x scanning.

[0060] 1.4 Experimental results:

[0061] like Figure 2 5xFAD and 5xFAD shown;VISTA - / - Thio S immunofluorescence staining of mouse brain slices, which records the expression of Thio S + The dense amyloid plaques in the brain of 5xFAD mice showed that Aβ deposition was significantly reduced in VISTA-knockout mice, which improved AD pathology. Conclusion: Knockout of VISTA in the 5xFAD mouse model can significantly reduce the abnormal deposition of β-amyloid protein in its brain and improve AD pathology.

[0062] Example 3: Microglial PHrodo phagocytosis-flow cytometry experiment

[0063] 1.1 Objective: To investigate the effect of VISTA knockout on the function of microglial BV2 cell line. Microglial BV2 cell line was provided by the Institute of Brain Science and Brain Diseases, Chongqing Medical University.

[0064] 1.2 Marker: pHrodo TM Red Zymosan BioParticles TM The conjugate, thermofisher, P35364) is a pH-sensitive conjugate. The pHrodo Red dye conjugate has no fluorescence outside the cell, but exhibits strong red fluorescence in the phagosome.

[0065] 1.3 Experimental methods:

[0066] (1) Use shRNA to obtain a VISTA knockdown BV2 stable cell line;

[0067] The amino acid sequence and nucleotide sequence of the VISTA gene are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0068] Design of shRNA,

[0069] The targeting sequence was as follows: GAACCCTGCTCCTTGCTATTT;

[0070] The synthetic primer sequences are as follows:

[0071] Upstream primer shRNA-F: CCGGGAACCCTGCTCCTTGCTATTTCTCGAGAAATAGCAAGGAGCAGGGTTCTTTTTG;

[0072] Downstream primer shRNA-R: AATTCAAAAAGAACCCTGCTCCTTGCTATTTCTCGAGAAATAGCAAGGAGCAGGGTTC.

[0073] step:

[0074] ① Annealing

[0075] Dilute the primer to 100Um. Prepare the system as follows: shRNA-F 11.25uL, shRNA-R 11.25uL, 10xannealing buffer; after mixing the system, incubate in boiling water for 3min; stop heating and let stand until the water temperature drops to 30℃;

[0076] The product was diluted into 1x SHRNA according to the following system: 1uL shrnA oligomer, 20uL 10x annealing buffer, 379uL water.

[0077] ②Connection

[0078] Select pLKO.1puro plasmid (addgene #8453) and mix evenly according to the following system: 0.59uL vector 8453, 1uL 1XshRNA, 0.5uL T4DNA ligase, 1uL T4DNA ligase buffer, 6.9u water;

[0079] Let stand at room temperature for 30 minutes.

[0080] ③Conversion

[0081] Select STBL3 competent cells and gently mix according to the following system: 50uL STBL3, 10uL ligation product; incubate on ice for 30min; heat shock at 42℃ for 1min 30s; incubate on ice for 3min; add 500uL LB medium and resuscitate on a shaker at 180rpm and 37℃ for 1h.

[0082] ④Coating board

[0083] In AMP + The revived bacterial solution was spread on LB solid plates, cultured in a 37°C incubator for 12 hours, and single clones were selected for sequencing.

[0084] ⑤ Packaging lentivirus

[0085] Mix the following contents: System 1: 100uL reduced serum medium opti-mem, 1ug ​​shRNA plasmid, 0.5ug pCMV-VSV-G, 0.5ug pMDLG / PRRE, 0.5ug pRSV-Rev; System 2: 100uL reduced serum medium opti-mem, 3.2uL lipo8000, mix well and let stand at room temperature for 5min;

[0086] Mix system 1 and system 2, and let stand at room temperature for 15 min to obtain a packaging system;

[0087] The packaging system was added dropwise to 293T cells at a density of 70% in a 6-well plate, and the cells were incubated in a cell culture incubator at 37°C and 5% CO2 for 48 hours to obtain the virus supernatant.

[0088] ⑥ Infection of BV2 cells

[0089] Use a syringe to collect the virus supernatant, filter it with a 0.45um bacterial filter; operate in a six-well plate, replace the culture medium (1.5uL polybrene + 1.5mL DMEM complete culture medium) with BV2 cells at a density of 80%, and add 1.5mL of virus supernatant, and incubate in a cell culture incubator at 37°C and 5% CO2 for 24h. DMEM complete culture medium is: DMEM + 10% FBS + 1% penicillin-streptomycin double antibody solution.

[0090] ⑦Drug screening knockdown cells

[0091] The DMEM complete medium containing 2ug / mL puromycin was replaced, and drug screening was performed for 7 days to obtain a stable knockdown cell line.

[0092] ⑧qPCR verification of knockdown efficiency

[0093] qPCR upstream primer: AACAACGGTTCTACGGGTCC; downstream primer: CGTGATGCTGTCACTGTCCT.

[0094] (2) Plate: 3 × 10 4 The cells were cultured in DMEM complete medium in a 37°C, 5% CO2 cell culture incubator overnight;

[0095] (3) Replace the medium containing 1 ug / mL LPS (1 mg / mL LPS: DMEM complete medium = 1:1000. After 4 h of induction, replace the medium containing PHrodo (5 mg / mL PHrodo: DMEM complete medium = 3:100). After culturing for 1.5 h, collect the cells for flow cytometry analysis;

[0096] (4) Statistical analysis: The proportion of pHrodo+BV2 in the total cells in the cell population was counted. Each point represents an independent experiment.

[0097] 1.4 Experimental results:

[0098] like Figure 3 The qPCR detection result of VISTA knockdown is shown in the figure. After VISTA knockdown, the expression of VISTA gene was significantly reduced, indicating that the BV2 cell line with VISTA knockdown was successfully obtained.

[0099] like Figure 4 The flow cytometry analysis and statistical graphs shown in the figure show that the proportion of PHrodo+ cells in the VISTA knockdown microglial cell line BV2 is significantly increased compared with the control group BV2, indicating that VISTA knockdown enhances the phagocytic ability of microglia. Conclusion: VISTA knockdown can enhance the phagocytic ability of microglia, affecting their monitoring and clearance functions in the central nervous system, thereby affecting the occurrence and development of AD pathology.

[0100] Example 3: Cognitive memory ability experiment of VISTA knockout 5xFAD mice (Y maze)

[0101] 1.1 Objective: To investigate the effect of VISTA knockout on the degeneration process of cognitive memory function in 5xFAD mice. The source of VISTA knockout mice is the same as that in Example 2.

[0102] 1.2Y maze experimental method:

[0103] (1) Place the mouse in a Y-maze and monitor its locomotor exploratory behavior in the three arms for 8 min;

[0104] (2) Statistical analysis: Spontaneous alternation rate = the number of times a mouse enters the three arms in sequence / (total number of times it enters the arms - 2). The greater the spontaneous alternation rate, the better the cognitive memory function of the mouse. Each statistical point represents a mouse.

[0105] 1.3 Experimental Results

[0106] like Figure 5 The mouse Y-maze experiment and statistical graph shown in the figure evaluate the degree of degeneration of the mouse's cognitive memory function by analyzing the spontaneous alternation rate of the mouse's active exploration in different arms of the Y-maze. The experimental results show that 5xFAD; VISTA - / - The spontaneous alternation rate of mice was significantly increased compared with that of 5xFAD mice, indicating that cognitive memory function was significantly improved. Conclusion: VISTA knockout can improve the deterioration of cognitive memory function in 5xFAD mice and play a protective role at the behavioral level.

[0107] In summary, VISTA knockout can improve the phagocytic ability of microglia, thereby reducing Aβ deposition and promoting the improvement of cognitive memory function. Therefore, VISTA protein or gene can be used as a target for the development, screening or preparation of drugs for the prevention and treatment of central nervous system diseases.

[0108] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art, so they will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, the technical scheme of the present invention can be subjected to a variety of simple modifications, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Use of the protein VISTA as a target in the development, screening or preparation of drugs, wherein the functions of the drugs include any one or more of the following: 1) enhancing the phagocytic ability of microglia; 2) reducing the deposition of amyloid-β in the extracellular environment of the central nervous system; 3) improving the deterioration of cognitive memory function.

2. The use according to claim 1, characterized in that The VISTA protein is a protein having an amino acid sequence as shown in SEQ ID NO.1 or a protein encoded by a nucleotide sequence as shown in SEQ ID NO.

2.

3. Use of an agent that inhibits the activity and / or expression of VISTA protein in the preparation of a drug, wherein the functions of the drug include any one or more of the following: 1) enhancing the phagocytic ability of microglia; 2) reducing the deposition of amyloid-β in the extracellular environment of the central nervous system; 3) improving the deterioration of cognitive memory function.

4. The use according to claim 3, characterized in that The reagent is selected from VISTA antibodies, siRNAs, shRNAs, antisense molecules targeting VISTA gene sequences, or gene editing vectors that inhibit VISTA gene expression.

5. The use according to claim 4, characterized in that The gene editing vector is an expression vector containing siRNAs, shRNAs or antisense molecules.

6. The use according to claim 4 or 5, characterized in that The target site sequence targeting the VISTA gene sequence is: GAACCCTGCTCCTTGCTATTT.

7. The use according to any one of claims 3 to 6, characterized in that: The VISTA protein is a protein having an amino acid sequence as shown in SEQ ID NO.1 or a protein encoded by a nucleotide sequence as shown in SEQ ID NO.

2.

8. Use of VISTA protein in the preparation of products, the functions of which include any one or more of the following: 1) preparing an animal model with reduced phagocytic ability of microglia; 2) preparing an animal model with abnormal deposition of β-amyloid protein in the extracellular environment of the central nervous system as a pathological feature; 3) preparing an animal model with deterioration of cognitive memory function; 4) preparing an animal model of related diseases caused by reduced phagocytic ability of microglia; 5) reducing the phagocytic ability of microglia; 6) promoting the deposition of β-amyloid protein in the extracellular environment of the central nervous system; 7) promoting the deterioration of cognitive memory function.

9. The use according to claim 8, characterized in that The VISTA protein is a protein having an amino acid sequence as shown in SEQ ID NO.1 or a protein encoded by a nucleotide sequence as shown in SEQ ID NO.2.

Images