Application of MrDNAJB13 gene in regulating and controlling drought resistance of hairy roots of medicago ruthenica

Abstract

The invention discloses application of an MrDNAJB13 gene in regulation and control of drought resistance of hairy roots of medicago ruthenica, and relates to the technical field of biology. The invention finds that hairy roots with improved drought resistance can be obtained through overexpression of the MrDNAJB13 gene, and further, an overexpression MrDNAJB13 gene vector and a hairy root transformation method are constructed aiming at a hairy root system of medicago ruthenica. The transformation method for transforming the hairy roots of the medicago ruthenica can be used as a biotechnological means for researching the functions of the drought-resistant genes of the medicago ruthenica, can be popularized to other fields including stress resistance mechanism research, and lays a foundation for verification and genetic breeding of gene functions of the medicago ruthenica.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of MrDNAJB13 gene in regulating drought resistance of Medicago truncatula hairy roots. Background Art

[0002] Medicago ruthenica, also known as flower alfalfa, wild alfalfa, net-fruit fenugreek, etc., belongs to the genus Medicago of the Leguminosae family. This plant is mainly distributed in the high mountains, typical grasslands and desert grassland areas in northern China. With its excellent cold and drought resistance, Medicago ruthenica can thrive in cold and arid environments, showing great potential to become a high-quality forage resource. Researchers have found that Medicago ruthenica is the only species in the genus Alfalfa that can survive in harsh environments such as cold, drought and petrification. In terms of adaptability and tolerance, Medicago ruthenica has obvious advantages over alfalfa, which makes its ability to survive in harsh environments particularly outstanding.

[0003] Meadow lily exhibits strong stress resistance, but the exploration of its resistance mechanism has mostly remained at the cytological and eco-physiological levels. Historical studies have shown that the research focus of Meadow lily has been on its ecological characteristics, geographical distribution range, planting technology, genetic diversity, and distant hybridization breeding with alfalfa. Despite this, environmental fluctuations pose multiple pressures on the normal growth and development of plants, and drought is particularly critical, which has a profound impact on the survival, growth and even distribution of plants. In view of the increasing frequency and intensity of drought, it has become particularly important to further deepen the research on Meadow lily at the molecular level based on existing morphological and physiological studies. This includes discovering its drought-resistant related genes and exploring the mechanisms behind them, which has great scientific and practical value for understanding and improving the drought tolerance of plants.

[0004] Since Agrobacterium rhizogenes can induce some plants to grow hairy roots, and the Ri plasmid it carries can trigger the formation of hairy roots in damaged parts of plants and promote the production of a large number of secondary metabolites, there are currently some technologies that use Agrobacterium rhizogenes to genetically transform Medicago truncatula. However, these methods generally have low transformation efficiency and unsatisfactory results, which limits the possibility of in-depth exploration of the genetic functions of Medicago truncatula.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to provide an application of the MrDNAJB13 gene in regulating the drought resistance of the hairy roots of Medicago truncatula. The transgenic plants obtained by transforming Medicago truncatula plants using the overexpression vector constructed by the present invention can significantly improve the drought resistance of the hairy roots of Medicago truncatula, which is of great significance for the research on the functional genes of Medicago truncatula.

[0007] The present invention is achieved in that:

[0008] In a first aspect, the present invention provides a protein MrDNAJB13 that can improve the drought resistance of plants. The amino acid sequence of the protein MrDNAJB13 is shown in SEQ ID NO.1.

[0009] In a second aspect, the present invention provides a biological material related to the above-mentioned protein MrDNAJB13, which comprises any one of the following (1)-(4):

[0010] (1) a nucleic acid molecule encoding the above protein MrDNAJB13;

[0011] (2) an expression cassette containing the above nucleic acid molecule;

[0012] (3) a recombinant vector containing the above-mentioned nucleic acid molecule or expression cassette;

[0013] (4) A recombinant microorganism containing the above nucleic acid molecule, expression cassette or recombinant vector.

[0014] In a third aspect, the present invention provides the use of the above-mentioned protein MrDNAJB13 or biological material in improving the drought resistance of plants, and the use includes overexpressing the protein MrDNAJB13 in plants.

[0015] In a fourth aspect, the present invention provides a method for improving the drought resistance of Medicago truncatula hairy roots, comprising:

[0016] A rhizogenes Agrobacterium bacterial film carrying the coding gene of the above-mentioned protein MrDNAJB13 is prepared, and the Agrobacterium is transfected into Medicago truncatula seedlings, which are treated for rooting. After rooting, drought phenotype identification is performed to obtain transgenic plants with improved drought resistance of hairy roots compared with normal Medicago truncatula.

[0017] The present invention has the following beneficial effects:

[0018] The present invention has found that overexpression of MrDNAJB13 gene can obtain hairy roots with improved drought resistance. Furthermore, the present invention constructs an overexpression MrDNAJB13 gene vector and a hairy root transformation method for the hairy root system of Medicago truncatula. Experiments show that the transformation method of the present invention is faster and simpler than obtaining transgenic plants using the genetic transformation system mediated by Agrobacterium tumefaciens. The relative average expression of MrDNAJB13 overexpressed after drought stress treatment is 5.93 times that of the empty load, and the root length and freshness of the overexpressed transgenic hairy roots obtained after drought stress treatment are significantly higher than those of the empty load. Therefore, the hairy root transformation of Medicago truncatula using the transformation method of the present invention can be used as a biotechnology means for studying the function of drought-resistant genes of Medicago truncatula, and it may be extended to the development of other fields including the study of stress resistance mechanisms, laying a foundation for the verification of gene functions and genetic breeding of Medicago truncatula. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0020] Figure 1 This is a morphological picture of the Medicago truncatula seedlings on FA medium after being dipped in Agrobacterium in Example 1; Figure 1 (A) is the morphological picture of the Medicago truncatula seedlings 1 day after being dipped in Agrobacterium, and (B) is the morphological picture of the Medicago truncatula seedlings 12 days after being dipped in Agrobacterium;

[0021] Figure 2 This is the positive identification result of MrDNAJB13 overexpression in Medicago truncatula in Example 2;

[0022] Figure 3 is the relative expression of MrDNAJB13 in the MrDNAJB13-overexpressing Medicago truncatula in Example 2;

[0023] Figure 4 This is the overall level GFP fluorescence observation diagram of the empty vector, overexpression and wild-type Medicago truncatula in Example 3;

[0024] Figure 5 This is the cellular level GFP fluorescence observation diagram of the empty vector, overexpression and wild-type Medicago truncatula in Example 4;

[0025] Figure 6 This is a root length morphology diagram of the Medicago truncatula seedlings treated on 1 / 2B5 and 300 mM Mannitol medium for 10 days in Example 5; Figure 6(A) is the root length morphology of Medicago truncatula seedlings treated on 1 / 2B5 medium for 10 days; Figure 6 (B) is the root length morphology of the Medicago truncatula seedlings treated on 300 mM Mannitol medium for 10 days;

[0026] Figure 7 The statistical analysis of root length and fresh weight of the Medicago truncatula seedlings treated on 1 / 2B5 and 300 mM Mannitol medium for 10 days in Example 6; Figure 7 (A) Statistical analysis of root length of A. truncatula seedlings treated on 1 / 2B5 and 300 mM Mannitol medium for 10 days; Figure 7 (B) Statistical analysis of the fresh weight of A. truncatula seedlings treated on 1 / 2B5 and 300 mM Mannitol medium for 10 days;

[0027] Figure 8 The results of rooting of Example 1 and Comparative Example 1 are compared, wherein Figure 8 (A) is the rooting result of Example 1, Figure 8 (B) is the rooting result of Comparative Example 1. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0029] In the preliminary study of the present invention, it was found that the MrDNAJB13 gene may be involved in the regulation of drought resistance of Medicago truncatula. On this basis, the present invention constructed an expression vector capable of overexpressing the MrDNAJB13 gene and transferred it into Agrobacterium, and obtained the hairy root material overexpressing MrDNAJB13 by the Agrobacterium-mediated method. The results showed that the drought resistance of the hairy roots overexpressing the MrDNAJB13 gene was improved. That is, a new use of the Medicago truncatula MrDNAJB13 protein and its encoding gene in improving the drought resistance of Medicago truncatula was obtained.

[0030] The amino acid sequence of the MrDNAJB13 protein is shown in SEQ ID NO. 1. In some embodiments, in order to facilitate purification of the MrDNAJB13 protein, a conventional purification tag may be connected to the amino terminus or carboxyl terminus of the protein with the amino acid sequence shown in SEQ ID NO. 1.

[0031] Correspondingly, the present invention also provides biological materials related to the above protein MrDNAJB13, which include: a nucleic acid molecule encoding the above protein MrDNAJB13.

[0032] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA.

[0033] In some embodiments, the nucleic acid molecule is a cDNA molecule or a DNA molecule as shown in SEQ ID NO.2; or a cDNA molecule or a genomic DNA molecule that has more than 75% identity with the nucleotide sequence as shown in SEQ ID NO.2 and encodes the protein MrDNAJB13.

[0034] A person skilled in the art can easily mutate the nucleotide sequence encoding MrDNAJB13 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence encoding MrDNAJB13 protein are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode MrDNAJB13 protein and have the same function.

[0035] The above-mentioned biological material includes an expression cassette containing the above-mentioned nucleic acid molecule, and the expression cassette is a DNA capable of expressing MrDNAJB13 protein in a host cell, which includes but is not limited to a promoter and a terminator, and may also include an enhancer. The above-mentioned promoter, terminator, enhancer and other elements can be selected according to actual needs, and the present invention does not limit this.

[0036] Recombinant vectors containing the above-mentioned nucleic acid molecules or expression cassettes can be constructed using existing expression vectors; the expression vectors include but are not limited to: single-stranded, double-stranded or partially double-stranded nucleic acid molecules; nucleic acid molecules containing one or more free ends, no free ends (e.g., circular); nucleic acid molecules containing DNA, RNA or both; and other polynucleotide types known in the art.

[0037] Among the most commonly used vector types are "plasmids," which refer to circular double-stranded DNA loops into which additional DNA segments can be inserted, for example, by standard molecular cloning techniques. Recombinant expression vectors can comprise a form suitable for expressing nucleic acids in a host cell, which means that the recombinant expression vector includes one or more regulatory elements, which can be selected based on the host cell used for expression and to which the nucleic acid sequence to be expressed can be operably linked.

[0038] In addition, the above biological materials also include: recombinant microorganisms containing the above nucleic acid molecules, expression cassettes or recombinant vectors. The microorganisms can be bacteria or fungi, such as Escherichia coli, yeast and Agrobacterium. The specific selection can be made according to actual needs, and the present invention does not limit this.

[0039] Based on the above MrDNAJB13 protein or the above biological material, the present invention also provides the application of the above MrDNAJB13 protein or the above biological material in improving the drought resistance of plants, specifically: the DNA molecule encoding the protein MrDNAJB13 is introduced into the plant through a recombinant vector containing the DNA molecule encoding the protein MrDNAJB13 to obtain transgenic hairy roots. Under drought stress, the root length and fresh weight of the transgenic hairy roots are higher than those of the hairy roots carrying an empty vector. It is proved that the MrDNAJB13 protein and its encoding gene MrDNAJB13 are related to plant drought resistance and can significantly improve the drought resistance of plants.

[0040] Therefore, the present invention also provides a method for improving the drought resistance of Medicago truncatula hairy roots, the steps are as follows:

[0041] S1. Preparation of Agrobacterium rhizogenes biofilm carrying target gene;

[0042] S2. Preparation of Medicago truncatula seedlings;

[0043] S3. Transfecting Agrobacterium into Medicago truncatula to treat the seedlings for rooting;

[0044] S4. Identify drought phenotypes after rooting.

[0045] Among them, the method for preparing Medicago truncatula seedlings is as follows: after grinding and breaking the hard particles of Medicago truncatula seeds, disinfecting them with 20% sodium hypochlorite and then spreading them on water agar medium, wrapping the medium with tin foil and placing it upright in a refrigerator at 4°C for vernalization for 2-3 days, and then culturing it in a walk-in incubator with a temperature of 22°C and a lighting condition of 16h light / 8h dark. The culturing time is 1-2 days, and the preparation of Medicago truncatula seedlings is completed when the hypocotyl grows to about 1 cm.

[0046] The components of the water agar culture medium in the present invention are: 8g agar and 1L distilled water.

[0047] The rooting treatment includes two steps: cutting the roots of the Medicago truncatula and infection. The rooting method of the Medicago truncatula is to quickly cut off the root tip 1-3 mm above the root tip with a scalpel; the infection method is to scratch the cut end of the Medicago truncatula through the Agrobacterium rhizogenes bacterial film and dip a small amount of Agrobacterium, then place it in FA culture medium, seal it with sealing film, and place it in a walk-in incubator with a temperature of 22°C and a light condition of 16h light / 8h dark. The rooting process is completed after 7-8 days of culture.

[0048] Compared with other alfalfa such as alfalfa, the rooting time of Medicago truncatula is relatively late, and the nutrient requirement of the culture medium is relatively high. It is found in the experiment that Medicago truncatula can only root on FA culture medium, and Medicago truncatula is very wild, the rooting efficiency is lower than that of alfalfa, and it is easy to be contaminated if not handled properly. In order to achieve a better rooting effect, the present invention designs the following culture medium for Medicago truncatula:

[0049] The components of the FA medium used in the present invention are 20 mL of macroelements (6.16 g MgSO 4 7H 2 O, 4.76gKH 2 PO 4 、10.72g Na 2 HPO 4 7H 2 O, 2.00 g NH 4 NO 3 dissolved in 1L distilled water); 1mL trace elements (10mg MnCl 2 、10mg CuSO 4 、10mg ZnCl 2 , 10mg H 3 BO 3 , 10mg Na 2 MoO 4 dissolved in 100 mL distilled water); 1 mL CaCl 2 (13.23 gCaCl 2 ·2H 2 0 dissolved in 100 mL of distilled water); 1 mL of ferric citrate (0.05 g of ferric citrate dissolved in 100 mL of distilled water), 1 mL of 1 mM AIB, ferric citrate and AIB were sterilized by filtration, and the pH was adjusted to 6.5, and 8 g of plant agar.

[0050] The method for drought phenotype identification after rooting is as follows: when the root length reaches 5-6 cm, select the empty load and MrDNAJB13 gene overexpressing plants with the same root length and growth momentum and transfer them to 1 / 2B5 medium and 300mM Mannitol medium for drought phenotype identification.

[0051] Among them, the components of 1 / 2B5 culture medium are: 1.6g B5 culture medium, 10g sucrose, 10g agar, 1L distilled water, adjust the pH to 5.8, and add 400mg / L Cef and Tim each.

[0052] 300 mM Mannitol medium is composed of the following ingredients: 1.6 g B5 medium, 10 g sucrose, 54.651 g mannitol, 10 g agar, 1 L distilled water to adjust the pH to 5.8, and 400 mg / L Cef and Tim each.

[0053] The above-mentioned method for transformation of Medicago truncatula hairy roots can obtain transgenic hairy roots about two weeks after the seedlings are cut and infected. This method has the characteristics of high efficiency, high transformation rate and low time consumption, and can effectively promote the research on Medicago truncatula functional genes.

[0054] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0055] The methods for obtaining the target gene and constructing the vector involved in the embodiments of the present invention are as follows:

[0056] 1.TOPO cloning

[0057] The CDS sequence of MrDNAJB13 was extracted using the transcriptome sequencing results of alfalfa, and the cDNA of Medicago truncatula root was used as a template for candidate gene cloning. The complete CDS sequences of 12 candidate genes were cloned using Cloning Kits (Invitrogen, K2400-20) and Phusion high-fidelity enzyme (Thermo Fisher Scientific, F530-S). Primers for gene amplification were designed using DNAMAN software. The primer information is MrDNAJB13-F: CACCATGGGTGTAGACTACTACAAAATCTTGC-SEQ ID NO.3; MrDNAJB13-R: GGCCGAGGAAGCCAGG-SEQ ID NO.4. The recognition site "CACC" of the PENTR / D-TOPO entry vector was introduced at the 5' end upstream of the primer. The gene cloning reaction system is as follows: 1 μL 10 μM Forward Prime, 1 μL 10 μM Reverse Primer, 10 μL 5×Phusion HF Buffer, 4 μL 2.5 mM dNTP, 0.5 μL Phusion DNA Polymerase, 1 μL cDNA, ddH 2 The reaction was completed to 50 μL with 0.05% O. The reaction procedure was as follows: 98°C pre-denaturation for 30 s; 98°C denaturation for 10 s, 57°C annealing for 30 s, 72°C extension for 15 s / kb, for a total of 35 cycles; 72°C extension for 5 min; 4°C termination.

[0058] 2.TOPO connection

[0059] Prepare an agarose gel with a concentration of 1.5%, and dot the amplified target gene into the gel hole in turn. Perform electrophoresis at a constant current of 135mA and a voltage of 135V for 25min. After electrophoresis, use a gel imaging analysis system (FluorChem FC2, Alpha USA) for image scanning and gel cutting and recovery. Cut the expected target band and put it into a 1.5mL EP tube. Use a gel recovery kit (Tiangen Biotech, China) to recover the target band. For specific operation methods, see the instructions. After the PCR product gel recovery is completed, connect it with the PENTR / D-TOPO entry vector. The TOPO connection system is as follows: 4μL PCR product purification, 1μL PENTR / D-TOPO entry vector and 1μL Salt solution; connect at room temperature (25℃) for 30min.

[0060] 3. Heat shock transformation of E. coli

[0061] 1) Take out a centrifuge tube containing 100 μL of E. coli competent cells DH5α (Tiangen Biotech, China) from a -80°C refrigerator and place it in ice. After the competent cells melt, add 3 μL of the ligation product, mix gently, and place on ice for 30 min.

[0062] 2) Heat shock the competent cells with the ligation product at 42°C for 90 seconds, then quickly move to ice for 2 minutes;

[0063] 3) Add 900 μL of sterilized LB liquid medium to the centrifuge tube, mix well, and place in a 37°C shaker at 200 rpm for 1 hour to recover;

[0064] 4) Spread the revived E. coli on LB solid medium containing Kan, and invert the medium in a 37°C incubator for overnight culture.

[0065] 5) The grown single clone was streaked and propagated on LB solid medium containing Kan, and cultured again in a 37°C incubator overnight.

[0066] 4.TOPO vector colony PCR detection

[0067] Use a sterile white gun tip to dip the colony into the PCR reaction solution, use primers M13-F: CTGTAAAACGACGGCCAG (SEQ ID NO.5) and M13-R: CAGGAAACAGCTATGAC (SEQ ID NO.6) for PCR reaction, use 2×F8FastLong PCR MasterMix (Beijing Adlai Biotechnology Co., Ltd., PC80) for amplification, the reaction system is as follows: 0.5μL 10μM Forward Primer, 0.5μL 10μM Reverse Primer, 5μL 2×F8FastLong PCR MasterMix, dip the white gun tip into the colony DNA, ddH 2 The reaction was completed to 10 μL with 0.05% HO. The reaction procedure was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 20 s, 57°C annealing for 15 s, 72°C extension for 10 s / kb, for a total of 35 cycles; 72°C extension for another 4 min; 4°C termination.

[0068] Three suitable clone colonies detected by PCR were selected, cultured in LB liquid medium containing Kan at 37°C and 240 rpm overnight, and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0069] 5.LR connection

[0070] The monoclonal clone suitable for sequencing was selected and incubated overnight in LB liquid medium containing Kan at 37°C and 240rpm. The plasmid was extracted using a plasmid extraction kit (Tiangen Biotech, China). The specific operation method is described in the instruction manual. The LR ligation system was prepared as follows: 1 μL (≤150 ng / μL) pMDC83 expression vector, 1 μL (≤100 ng / μL) PENTR / D-TOPO entry vector, 2 μL LR enzyme and 6 μL ddH 2 O.

[0071] Using LR II Plus Enayme Mix (Invitrogen, 11791-020) was used to carry out LR ligation reaction between the entry vector plasmid and the pMDC83 expression vector, and the ligation was carried out overnight at 25°C on a PCR instrument.

[0072] After the ligation is completed, 2 μL of 10×Proteinase K Solution is added to the reaction tube, mixed and incubated at 37°C for 10 min, and the ligation product is heat-shocked and transformed into E. coli DH5α as described above, and then primers 35s-F: GAGGACCTCGACTCTAGAACTAGT (SEQ ID NO.7) and MrDNAJB13-R: GGCCGAGGAAGCCAGG (SEQ ID NO.4) are used for colony PCR detection. The PCR reaction system and procedure are the same as step 4. Pick 3 clone colonies suitable for PCR detection, shake the colonies and send them to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The clone colonies suitable for sequencing are shaken and plasmids are extracted.

[0073] 6. Transformation of Agrobacterium

[0074] The expression vector plasmid was heat-shocked to transform Agrobacterium rhizogenes Ar.Qual (Puente Biotechnology), and the specific operation was as follows:

[0075] 1) Take Ar.Qual Agrobacterium rhizogenes competent cells stored at -80℃ and place them at room temperature or in the palm of your hand for a while until they partially melt. When they are in a state of mixing ice and water, insert them into ice;

[0076] 2) Add 2 μL of plasmid DNA to every 100 μL competent medium, quickly and vigorously stir the bottom of the tube to mix well or blow and suck with a gun to mix well, and then place it in ice for 15 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes;

[0077] 3) Take out the tube from the ice bath and bring it to room temperature, add 700 μL of sterilized LB liquid medium, and culture at 28°C with shaking for 2 h;

[0078] 4) Centrifuge at 6000 rpm for 1 min to collect the bacteria, take about 100 μL of the supernatant, blow and resuspend the bacteria, spread it on LB solid medium containing Kan and streptomycin resistance, and place it upside down in a 28°C incubator for 2-3 days;

[0079] 5) The grown single clones were streaked and propagated on LB solid medium containing Kan and streptomycin resistance, and cultured again in a 28°C incubator overnight.

[0080] Primers 35s-F and MrDNAJB13-R were used for colony PCR detection, and the PCR reaction system and procedure were the same as step 4. The appropriate clone colonies for PCR detection were picked and cultured in LB liquid medium containing Kan and streptomycin resistance at 28°C and 200rpm overnight, and the bacterial solution was mixed with 50% glycerol in a 1:1 ratio and stored at -80°C for subsequent rooting experiments.

[0081] Example 1

[0082] This example is a rooting treatment of the Medicago truncatula MrDNAJB13 overexpression gene, comprising the following steps:

[0083] Plant material: 'Zhongke No. 1' Medicago truncatula.

[0084] (1) Preparation of Agrobacterium rhizogenes biofilm with target gene

[0085] Take 200 μL of the prepared Agrobacterium rhizogenes culture solution containing empty PMDC83 and target gene MrDNAJB13 and evenly apply it to LB solid culture medium containing corresponding antibiotics, and culture it upside down at 28°C for two days.

[0086] (2) Preparation of Medicago truncatula seedlings

[0087] ① Seed treatment: Grind the Medicago truncatula seeds to remove the hard particles, disinfect the seeds with 20% sodium hypochlorite for 10 minutes, wash them 10 times with sterilized water, clean them thoroughly, and evenly spot them on 8% water agar medium in an ultra-clean workbench.

[0088] ② Seed germination: Wrap the culture medium with tin foil and place it in a refrigerator at 4°C for 3 days for vernalization. Then place it in a walk-in incubator at 22°C and 16h light / 8h dark for 2 days. When the hypocotyl grows to about 1 cm, the preparation of Medicago truncatula seedlings is completed.

[0089] (3) Transfecting Agrobacterium into Medicago truncatula

[0090] ① Root cutting of flat clover: In a clean bench, sterilize tweezers, small scissors and scalpels with an inoculator, and when the temperature returns to normal, use a scalpel to horizontally cut from left to right about 4 cm above the FA square culture medium and remove this part of the culture medium. Then use a scalpel to evenly cut 10 1 cm notches vertically at the cut point. Gently pick up the seedlings with tweezers and quickly cut them 1 mm above the root tip with small scissors to prevent wilting.

[0091] ② Infection: Pick up the Medicago truncatula with tweezers, and then scratch the cut end through the Agrobacterium rhizogenes bacterial film to dip a small amount of Agrobacterium. After dipping a small amount of Agrobacterium, insert it into the gap of the FA square culture medium described in ① ( Figure 1 A), wherein the FA medium formula includes: 20mL macronutrients (6.16gMgSO 4 7H 2 O, 4.76 g KH 2 PO 4 、10.72g Na 2 HPO 4 7H 2 O, 2.00 g NH 4 NO3 dissolved in 1L distilled water); 1mL trace elements (10mg MnCl 2 、10mg CuSO 4 、10mg ZnCl 2 , 10mgH 3 BO 3 , 10mg Na 2 MoO 4 dissolved in 100 mL distilled water); 1 mL CaCl 2 (13.23 gCaCl 2 ·2H 2 O dissolved in 100 mL of distilled water); 1 mL of ferric citrate (0.05 g of ferric citrate dissolved in 100 mL of distilled water), 1 mL of 1 mM AIB, ferric citrate and AIB were sterilized by filtration, pH was adjusted to 6.5, 8 g of plant agar, sealed with 3M sealing film, and cultured in a walk-in incubator at 22°C and 16 h of light / 8 h of darkness. The transfection and rooting process was completed after 7 days of culture, and the cut roots of the seedlings began to swell clearly. After 12 days, the root length could grow to about 3 cm ( Figure 1 B).

[0092] Example 2

[0093] Positive identification and expression level determination of MrDNAJB13 overexpression in Medicago truncatula

[0094] (1) Positive identification of MrDNAJB13 overexpression in Medicago truncatula

[0095] Grasp the seedlings with tweezers and cut them at the root swelling with small scissors, put them into a 1.5mL tube filled with steel balls and immediately put them into liquid nitrogen, crush the samples with a ball mill, use the Tiangen DNA extraction kit to extract DNA (see the instructions for the extraction steps), and perform PCR detection on the phenotyped Medicago plants on 1 / 2B5 and 300mM Mannitol medium, where the primers used for PMDC83 empty load are:

[0096] GFP-F:AGTGGAGAGGGTGAAGGTG-SEQ ID NO.8;

[0097] GFP-R:CTTGTCGGCCATGATGTATA-SEQ ID NO.9;

[0098] Amplification was performed, and the amplified band size was 381 bp;

[0099] The primers used for MrDNAJB13 gene are:

[0100] 35sF-L1:GAGGACCTCGACTCTAGAACTAGT-SEQ ID NO.7;

[0101] MrDNAJB13-R:GGCCGAGGAAGCCAGG-SEQ ID NO.4;

[0102] Amplification was performed and the amplified band size was 1044 bp. The identification results were as follows Figure 2 As shown, the results showed that all the plants were positive.

[0103] (2) Determination of MrDNAJB13 expression in Medicago truncatula

[0104] Grasp the seedlings with tweezers and cut them at the root swelling with small scissors. Put them into a 1.5mL RNase-Free tube filled with sterilized steel balls and immediately put them into liquid nitrogen. Use a ball mill to crush the sample, use the Sikejie RNA extraction kit to extract RNA (see the manual for the extraction steps), and then use the Tiangen FastKing one-step reverse transcription kit for reverse transcription (see the manual for the experimental method) to obtain cDNA for qRT-PCR to determine the relative expression of MrDNAJB13 in transgenic Medicago truncatula. qRT-PCR detection was performed on Medicago truncatula plants with phenotypes on 1 / 2B5 and 300mM Mannitol medium. The primers used are as follows:

[0105] QMrDNAJB13-F:CTTATGAGGTACTTAGTGATCCTG-SEQ ID NO.10;

[0106] QMrDNAJB13-R:GATTGAACCGAAACGATCCA-SEQ ID NO. 11.

[0107] The amplification reaction used the Yugong Bio Kit, and the reaction system was 10μM Forward Primer: 0.2μL, 10μM Reverse Primer: 0.2μL, cDNA: 1μL, ddH 2 O: 3.6 μL. The PCR amplification reaction program is: pre-denaturation at 95°C for 30 seconds, denaturation at 95°C for 10 seconds, annealing & extension at 55°C for 30 seconds, denaturation to annealing & extension for 40 cycles. Figure 3 As shown, the expression level of MrDNAJB13 increased in the overexpression lines, and under drought stress, the expression level of MrDNAJB13 increased further.

[0108] Example 3

[0109] Observation of GFP fluorescence at the whole level of Medicago truncatula

[0110] Grasp the seedlings with forceps and cut them off at about 1.5 cm from the root tip with small scissors, soak them in 0.01% Tween 20 and evacuate for 30 min, rinse them twice with distilled water, then wash them with washing buffer (10 mM Tris-HCl pH = 7.2 and 50 mM KCl), and finally wash them with ddH 2 O rinse 5-6 times, and make sure to keep it on ice. A research-grade stereo fluorescence microscope was used to observe the overall level of GFP fluorescence in the empty PMDC83, overexpressed MrDNAJB13 gene, and wild-type WT. The results are shown in Figure 4 As shown, the WT under the control and 300 mM Mannitol treatment had no fluorescence, while the empty vector and MrDNAJB13 gene overexpression plants all showed GFP green fluorescence, indicating that they were all positive plants.

[0111] Example 4

[0112] Observation of GFP fluorescence at the cellular level in Azela truncatula

[0113] Grasp the seedlings with forceps and cut them off at about 1.5 cm from the root tip with small scissors, soak them in 0.01% Tween 20 and evacuate for 30 min, rinse them twice with distilled water, then wash them with washing buffer (10 mM Tris-HCl pH = 7.2 and 50 mM KCl), and finally wash them with ddH 2 O rinse 5-6 times, note that the whole process is carried out on ice. Laser confocal microscopy (inverted) was used to observe the GFP fluorescence level of empty PMDC83, overexpressed MrDNAJB13 gene and wild-type WT cells. The observation results are as follows Figure 5 As shown, the WT under the control and 300 mM Mannitol treatment had no fluorescence, while the empty vector and MrDNAJB13 gene overexpression plants all showed GFP green fluorescence, indicating that they were all positive plants.

[0114] Example 5

[0115] Observation on rooting phenotype of Azela truncatula

[0116] (1) Preparation of 1 / 2B5 and 300 mM Mannitol culture medium

[0117] ①1 / 2B5 medium is composed of the following ingredients: 1 / 2B5 medium 1.6g, sucrose 10g, agar 10g, 1L distilled water, adjust the pH to 5.8, add Cef and Tim 400mg / L each.

[0118] ②300mM Mannitol medium is composed of the following ingredients: 1 / 2B5 medium 1.6g, sucrose 10g, mannitol 54.651g, agar 10g, 1L distilled water to adjust the pH to 5.8, and add Cef and Tim 400mg / L each.

[0119] (2) Transfer the Medicago truncatula seedlings to 1 / 2B5 and 300 mM Mannitol medium

[0120] In the clean bench, tweezers, small scissors and scalpels were sterilized with an inoculator. When the temperature returned to normal, a scalpel was used to cut horizontally from left to right about 4 cm above the 1 / 2B5 and 300mM Mannitol square culture medium and remove this part of the culture medium. Seedlings with the same root length were selected and placed so that the cut roots were on the same horizontal line. Note that each seedling should be covered with a lid to prevent the plant from wilting. Four replicates of PMDC83 and MrDNAJB13 genes were placed without any expression ( Figure 6 A), obvious phenotype will appear after 10 days ( Figure 6 B), as can be seen from the figure, under drought stress, MrDNAJB13 overexpression Medicago truncatula has better root growth.

[0121] Example 6

[0122] Statistical analysis of root length and fresh weight of Medicago truncatula seedlings after 10 days of treatment

[0123] Use tweezers to pick up the seedlings and use small scissors to cut off the root swelling. Place them on a ten-thousandth scale to weigh the fresh weight of each root. Use Digimier software to calculate the length from the root swelling to the root tip. Then use SPSS software for significance analysis and Origin software for drawing. The results are as follows Figure 7 As shown, the root length and fresh weight of the group overexpressing MrDNAJB13 were higher, proving that the MrDNAJB13 gene can regulate the drought resistance of the Medicago truncatula hairy roots.

[0124] Comparative Example 1

[0125] The difference between this experiment and Example 1 is that the culture medium used in the infection step is: 8 g agar, 1 L distilled water, 1 mL 1 mM AIB.

[0126] After the same treatment time, the rooting results of Example 1 and Comparative Example 1 are compared. Figure 8 As shown, the root length in Figure A is obviously longer, indicating that the rooting effects of different culture media are significantly different, and the culture medium selected by the present invention has a better culture effect.

[0127] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A protein MrDNAJB13 that can improve plant drought resistance, characterized in that: The amino acid sequence of the protein MrDNAJB13 is shown in SEQ ID NO.

1.

2. A biological material related to the protein MrDNAJB13 according to claim 1, characterized in that: Including any one of the following (1)-(4): (1) a nucleic acid molecule encoding the protein MrDNAJB13; (2) an expression cassette containing the nucleic acid molecule; (3) a recombinant vector containing the nucleic acid molecule or expression cassette; (4) A recombinant microorganism containing the nucleic acid molecule, expression cassette or recombinant vector.

3. The biomaterial according to claim 2, characterized in that The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

2.

4. The use of the protein MrDNAJB13 according to claim 1 or the biomaterial according to claim 2 or 3 in improving the drought resistance of plants, characterized in that: The application comprises overexpressing the protein MrDNAJB13 in plants.

5. The use according to claim 4, characterized in that: The plants include Medicago truncatula.

6. A method for improving the drought resistance of Medicago truncatula hairy roots, characterized in that: include: A rhizogenes Agrobacterium bacterial film carrying the coding gene of the protein MrDNAJB13 according to claim 1 is prepared, and the Agrobacterium is transfected into Medicago truncatula seedlings, which are subjected to a rooting treatment, and drought phenotype identification is performed after rooting to obtain transgenic plants with improved drought resistance of hairy roots compared with normal Medicago truncatula.

7. The method according to claim 6, characterized in that The preparation method of the Medicago truncatula seedlings comprises: sterilizing the Medicago truncatula seeds and paving them on a water agar medium, then placing them in a refrigerator for vernalization, and then placing them in an incubator for culturing until the hypocotyl grows to 1 cm; Preferably, the disinfection agent is sodium hypochlorite with a mass concentration of 20%; Preferably, the conditions of the vernalization treatment are: temperature 4°C, time 2-3 days; Preferably, the culture conditions in the incubator are: temperature 22° C., light exposure time 16 h, and culture time 1-2 d.

8. The method according to claim 6, characterized in that The transfection comprises: quickly cutting the root tip 1-3 mm above the root tip, scratching the cut end through the Agrobacterium rhizogenes bacterial film to dip a small amount of Agrobacterium, then placing it in FA culture medium, sealing it with a sealing film and then placing it in an incubator for culture; Preferably, the ingredients of the FA medium are: MgSO4·7H2O, KH2PO4, Na2HPO4·7H2O, NH4NO3, MnCl2, CuSO4, ZnCl2, H3BO3, Na2MoO4, CaCl2, ferric citrate, AIB and agar, pH = 6.5; Preferably, the culture conditions in the incubator are: temperature 22°C, light exposure time 16h, and culture time 7-8d.

9. The method according to claim 6, characterized in that The drought phenotype simply includes: when the root length grows to 5-6 cm, select the empty load and MrDNAJB13 gene overexpressing plants with the same root length and growth momentum and transfer them to 1 / 2B5 medium and 300mMMannitol medium for drought phenotype identification; Preferably, the components of the 1 / 2B5 medium are: B5 medium, sucrose, agar, Cef and Tim, and the pH is adjusted to 5.8; Preferably, the components of the 300 mM Mannitol medium are: B5 medium, sucrose, mannitol, agar, Cef and Tim, and the pH is adjusted to 5.

8.

10. Use of the method for improving the drought resistance of Medicago truncatula hairy roots as described in any one of claims 6 to 9 in cultivating drought-tolerant plants.

Images